Portal de Periódicos da CAPES

pH Dependency and Desensitization Kinetics of Heterologously Expressed Combinations of Acid-sensing Ion Channel Subunits

2004; Elsevier BV; Volume: 279; Issue: 12 Linguagem: Inglês

10.1074/jbc.m313507200

1083-351X

Mette Hesselager, Daniel B. Timmermann, Philip K. Ahring,

Ion Channels and Receptors

The exact subunit combinations of functional native acid-sensing ion channels (ASICs) have not been established yet, but both homomeric and heteromeric channels are likely to exist. To determine the ability of different subunits to assemble into heteromeric channels, a number of ASIC1a-, ASIC1b-, ASIC2a-, ASIC2b-, and ASIC3-containing homo- and heteromeric channels were studied by whole-cell patch clamp recordings with respect to pH sensitivity, desensitization kinetics, and level of sustained current normalized to peak current. Analyzing and comparing data for these three features demonstrated unique heteromeric channels in a number of co-expression experiments. Formation of heteromeric ASIC1a+2a and ASIC1b+2a channels was foremost supported by the desensitization characteristics that were independent of proton concentration, a feature none of the respective homomeric channels has. Several lines of evidence supported formation of ASIC1a+3, ASIC1b+3, and ASIC2a+3 heteromeric channels. The most compelling was the desensitization characteristics, which, besides being proton-independent, were faster than those of any of the respective homomeric channels. ASIC2b, which homomerically expressed is not activated by protons per se, did not appear to form unique heteromeric combinations with other subunits and in fact appeared to suppress the function of ASIC1b. Co-expression of three subunits such as ASIC1a+2a+3 and ASIC1b+2a+3 resulted in data that could best be explained by coexistence of multiple channel populations within the same cell. This observation seems to be in good agreement with the fact that ASIC-expressing sensory neurons display a variety of acid-evoked currents. The exact subunit combinations of functional native acid-sensing ion channels (ASICs) have not been established yet, but both homomeric and heteromeric channels are likely to exist. To determine the ability of different subunits to assemble into heteromeric channels, a number of ASIC1a-, ASIC1b-, ASIC2a-, ASIC2b-, and ASIC3-containing homo- and heteromeric channels were studied by whole-cell patch clamp recordings with respect to pH sensitivity, desensitization kinetics, and level of sustained current normalized to peak current. Analyzing and comparing data for these three features demonstrated unique heteromeric channels in a number of co-expression experiments. Formation of heteromeric ASIC1a+2a and ASIC1b+2a channels was foremost supported by the desensitization characteristics that were independent of proton concentration, a feature none of the respective homomeric channels has. Several lines of evidence supported formation of ASIC1a+3, ASIC1b+3, and ASIC2a+3 heteromeric channels. The most compelling was the desensitization characteristics, which, besides being proton-independent, were faster than those of any of the respective homomeric channels. ASIC2b, which homomerically expressed is not activated by protons per se, did not appear to form unique heteromeric combinations with other subunits and in fact appeared to suppress the function of ASIC1b. Co-expression of three subunits such as ASIC1a+2a+3 and ASIC1b+2a+3 resulted in data that could best be explained by coexistence of multiple channel populations within the same cell. This observation seems to be in good agreement with the fact that ASIC-expressing sensory neurons display a variety of acid-evoked currents. It is well established that tissue acidification, which may be present in inflammatory and ischemic conditions, causes pain (1Steen K.H. Reeh P.W. Neurosci. Lett. 1993; 154: 113-116Crossref PubMed Scopus (170) Google Scholar, 2Steen K.H. Issberner U. Reeh P.W. Neurosci. Lett. 1995; 199: 29-32Crossref PubMed Scopus (104) Google Scholar, 3Steen K.H. Steen A.E. Kreysel H.W. Reeh P.W. Pain. 1996; 66: 163-170Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). In line with this, peripheral sensory neurons exhibit sensitivity toward acid by activating several types of depolarizing currents (4Bevan S. Yeats J. J. Physiol. (Lond.). 1991; 433: 145-161Crossref Scopus (301) Google Scholar, 5Krishtal O.A. Pidoplichko V.I. Neuroscience. 1981; 6: 2599-2601Crossref PubMed Scopus (154) Google Scholar, 6Petruska J.C. Napaporn J. Johnson R.D. Gu J.G. Cooper B.Y. J. Neurophysiol. 2000; 84: 2365-2379Crossref PubMed Scopus (214) Google Scholar). Although the repertoire of ion channels responsible for these currents is not fully known, the family of acid-sensing ion channels (ASICs) 1The abbreviations used are: ASIC, acid-sensing ion channel; ENaC, epithelial Na+ channel; DEG, degenerin; FaNaC, Phe-Met-Arg-Phe-amide-activated Na+ channel; CHO, Chinese hamster ovary; DRG, dorsal root ganglion; MES, 4-morpholineethanesulfonic acid. is believed to be an important constituent. The ASIC family is a member of the ENaC/DEG superfamily, which also includes the amiloride-sensitive epithelial sodium channels (ENaCs), the mechanically gated degenerins of Caenorhabditis elegans (DEGs), and a neuropeptide-gated channel of Helix aspersa (FaNaC). The membrane topology of all channels within this superfamily comprises two transmembrane domains, intracellular N and C termini and a large extracellular loop with a number of conserved cysteine residues (7Kellenberger S. Schild L. Physiol. Rev. 2002; 82: 735-767Crossref PubMed Scopus (855) Google Scholar). Currently, four genes encoding six ASIC transcripts have been cloned and characterized from mammalian organisms. ASIC1a (BNaC2) and ASIC1b (ASIC1β) are the products of alternatively spliced transcripts of the ASIC1 gene that differ in the N-terminal region, including the first transmembrane domain and the proximal part of the large extracellular domain (8Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar, 9Chen C.C. England S. Akopian A.N. Wood J.N. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10240-10245Crossref PubMed Scopus (401) Google Scholar, 10Bassler E.L. Ngo-Anh T.J. Geisler H.S. Ruppersberg J.P. Grunder S. J. Biol. Chem. 2001; 276: 33782-33787Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). ASIC2a (BNaC1, MDEG) and ASIC2b (MDEG2) are alternatively spliced forms of the ASIC2 gene product. These, too, have unique N termini and share the C-terminal amino acids (11Lingueglia E. de Weille J.R. Bassilana F. Heurteaux C. Sakai H. Waldmann R. Lazdunski M. J. Biol. Chem. 1997; 272: 29778-29783Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar). Splice variants have not yet been identified for ASIC3 (DRASIC) (12Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (475) Google Scholar, 13Babinski K. Le K.T. Seguela P. J. Neurochem. 1999; 72: 51-57Crossref PubMed Scopus (159) Google Scholar) and ASIC4 (SPASIC) (14Akopian A.N. Chen C.C. Ding Y. Cesare P. Wood J.N. Neuroreport. 2000; 11: 2217-2222Crossref PubMed Scopus (182) Google Scholar, 15Grunder S. Geissler H.S. Bassler E.L. Ruppersberg J.P. Neuroreport. 2000; 11: 1607-1611Crossref PubMed Scopus (197) Google Scholar). Except for ASIC2b and ASIC4, all subunits have the ability to form functional homomeric channels when expressed in Xenopus laevis oocytes or mammalian cells. The functional and pharmacological properties of homomeric ASIC1a match one type of acid-evoked current described in peripheral sensory neurons (16Escoubas P. de Weille J.R. Lecoq A. Diochot S. Waldmann R. Champigny G. Moinier D. Menez A. Lazdunski M. J. Biol. Chem. 2000; 275: 25116-25121Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar, 17Voilley N. de Weille J. Mamet J. Lazdunski M. J. Neurosci. 2001; 21: 8026-8033Crossref PubMed Google Scholar), and the properties of ASIC3-mediated currents mimic acid-evoked currents in cardiac sensory neurons, believed to mediate the pain of angina (18Sutherland S.P. Benson C.J. Adelman J.P. McCleskey E.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 711-716Crossref PubMed Scopus (331) Google Scholar). Different ASIC subunits often co-localize within the same neurons (19Alvarez de la Rosa D. Zhang P. Shao D. White F. Canessa C.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2326-2331Crossref PubMed Scopus (210) Google Scholar), and heteromeric channels are likely to exist, as is the case for most ligand-gated ion channels. However, the exact composition of endogenous acid-sensitive channels is at present largely unknown. To study heteromerization of ASICs, we examined co-expressions of different ASIC subunits in Chinese hamster ovary (CHO) cells. By analyzing currents obtained in whole-cell voltage clamp experiments using ultrafast solution exchange for providing acidification, data for all possible combinations of ASICs (except ASIC4) were obtained. These data reveal unique properties for several of the homomerically expressed ASIC subunits and clearly demonstrate the formation of heteromeric channels in a number of co-expression experiments. Interestingly, not all the tested co-expressions led to channels that could be identified as unique; in the case of experiments involving co-expression of three different subunits, the data suggested existence of multiple channel populations. To summarize, this is the first comprehensive study of ASICs co-expressed in a mammalian expression system. Cloning of ASICs—Poly(A)+ mRNA was purified from fetal rat dorsal root ganglion (DRG) neurons using the Oligotex® direct mRNA mini kit (Qiagen) according to the manufacturer's protocol. ASIC1b, ASIC2b, and ASIC4 were cloned from fetal rat DRG poly(A)+ mRNA, whereas ASIC1a, ASIC2a, and ASIC3 were cloned from rat total brain poly(A)+ mRNA (Clontech) using reverse transcription PCR. First and second strand cDNA was obtained in a one-tube reverse transcriptase-PCR reaction using Avian myoblastosis virus reverse transcriptase, DYNazyme™ DNA polymerase (Finnzymes), and the following primer sets (MWG Biotech): ASIC1a –53s TGTGCCTGTGCCTGTTTGAGAG and ASIC1a 1678as ATGCAGTTAAGTCCACAGGGTAGC; ASIC1b –50s ATGCAGTTAAGTCCACAGGGTAGC and ASIC1b 960as CAGGGTGAGGGCAGGTAGATGA; ASIC2a –110s CACCGGCAGCAGCAGGAC and ASIC2a 1614as CTGCGCTTGCTGTCTCCTGTC; ASIC2b –14s CAGGGTGAGGGCAGGTAGATGA and ASIC2b 1787as CCCCCTTGACCGTGGTGA; ASIC3 –6s GCCGCCATGAAACCTCGCTCCGGACTGGAGGAGGCCC and ASIC3 744as GGGCTCATCCTGGCTGTGAAT; and ASIC3 515s GTGGGCCTGAGAACTTCACAGTG and ASIC3 1602as CTAGAGCCTTGTGACGAGGTAACAGGT. Subsequently, an aliquot of the reverse transcriptase-PCR reactions was used as template for nested PCR in reactions with the specific primer sets listed below and the Expand™ high fidelity DNA polymerase (Roche Applied Science): ASIC1a –6s GCCGCCATGGAATTGAAGACCGAGGAGGA and ASIC1a 1581as TTAGCAGGTAAAGTCCTCAAACGTGCCTC; ASIC1b –6s GCCGCCATGCCCATCCAGATCTTTTGTTC and ASIC1b 870as AAAGGGGGTTCATCCTGACTGTG; ASIC2a –6s GCCGCCATGGACCTCAAGGAGAGCCCCAGT and ASIC2a 1539as TCAGCAGGCAATCTCCTCCAGGGT; ASIC2b –6s GCCGCCATGAGCCGGAGCGGCGGAGCC and ASIC2b 1692as TCAGCAGGCAATCTCCTCCAGGGT; ASIC3 –6s GCCGCCATGAAACCTCGCTCCGGACTGGAGGAGGCCC and ASIC3 719as ACTCGGATCCCCACCTCAAAC; and ASIC3 543s TACTCGAATGGGGCAATGCTACA and ASIC3 1602as CTAGAGCCTTGTGACGAGGTAACAGGT. The cDNAs were cloned into pSwas, which is a custom-designed vector derived from pZero™ (Invitrogen), and positive clones were sequenced bidirectionally. ASIC1a, ASIC2a, ASIC2b, and ASIC4 were subcloned directly into the pNS1z vector. The ASIC1b fragment, which encoded the N-terminal part of the channel, was subcloned into pNS1z-ASIC1a, substituting the corresponding part of ASIC1a. ASIC3 was cloned in two overlapping fragments and subcloned in pNS1z in a unique restriction site of ASIC3 (BsrGI) within the overlapping region. The pNS1z vector is a customized vector derived from pcDNA3 (Invitrogen) with expression of the insert under control of the cytomegalovirus promoter. Expression of ASICs—All constructs were expressed in CHO-K1 cells (ATCC No. CCL61). CHO-K1 cells were cultured at 37 °C in a humidified atmosphere of 5% CO2 and 95% air and passaged twice/week. Cells were maintained in Dulbecco's modified Eagle's medium (10 mm HEPES, 2 mm GlutaMAX) supplemented with 10% fetal bovine serum and 2 mm l-proline (Invitrogen). CHO-K1 cells were co-transfected with the plasmids containing ASICs and a plasmid encoding enhanced green fluorescent protein using the LipofectAMINE PLUS kit (Invitrogen) according to the manufacturer's protocol. When more than one ASIC subunit was expressed, this was done in a 1:1 ratio. For each transfection we attempted to use an amount of DNA that would yield whole-cell currents within a reasonable range (0.5–10 nA) to avoid saturation of the patch clamp amplifier: ASIC1a and ASIC1b, 800 ng; ASIC2a and ASIC3, 400 ng; ASIC1a+1b, 2 × 250 ng; ASIC1a+2a, 2 × 100 ng; ASIC1a+2b and ASIC1b+2b, 2 × 400 ng; ASIC1a+3 and ASIC2a+3, 2 × 25 ng; ASIC1b+3, 2 × 75 ng; ASIC1b+2a and ASIC2a+2b, 2 × 200 ng; and ASIC1a+2a+3, ASIC1a+2b+3, and ASIC1b+2a+3, 3 × 75 ng. Electrophysiological measurements were performed 16–48 h after transfection. Electrophysiology—All experiments were performed under voltage clamp using conventional whole-cell patch clamp methods (20Hamill O.P. Marty A. Neher E. Sakmann B. Sigworth F.J. Pfluegers Arch. Eur. J. Physiol. 1981; 391: 85-100Crossref PubMed Scopus (15145) Google Scholar) at 20–22 °C. A Macintosh G4 computer was used to control an EPC-9 amplifier (HEKA-electronics) via an ITC-16 interface. The experimental conditions were defined by the Pulse software accompanying the amplifier, and data were sampled at 2 kHz and low pass-filtered at 667 Hz. Pipettes were pulled from borosilicate glass (Modulohm) using a horizontal electrode puller (Zeitz-Instrumente). The pipette was filled with an intracellular solution containing 120 mm KCl, 31 mm KOH, 2 mm MgCl2, 10 mm EGTA, and 10 mm HEPES adjusted to pH 7.2. The pipette electrode was a chloridized silver wire, and the reference electrode was a silver chloride pellet electrode (In Vivo Metric) fixed to the experimental chamber. The electrodes were zeroed with the open pipette in the bath just prior to sealing, and the pipette resistances were 1.5–3.0 megohms. Series resistance compensation was set at 80%. Coverslips with cells were transferred to the recording chamber (RC-25F, Warner Instruments) mounted on the stage of an inverted microscope (Olympus). Transfected cells were identified by the emission of green fluorescence when exposed to UV light. After giga-seal formation, the whole-cell configuration was attained by suction. Cells were continuously superfused at a rate of 2.5 ml/min with an extracellular solution (Na-R) containing 140 mm NaCl, 4 mm KCl, 2 mm CaCl2, 1 mm MgCl2, 5 mm HEPES, and 5 mm MES adjusted to pH 7.4. Test solutions were made from standard Na-R, adjusting pH with HCl. Rapid pH changes were achieved by placing a piezo-driven double-barreled application pipette (theta tube) in front of the cell. Using this system, complete solution exchange can be achieved in 0.14). The sustained current remaining at pH 4.0 was in the range of 3–8%, relative to the peak current, for ASIC1a, -1b, and -2a (Table I). ASIC3 displayed a significantly larger sustained current of 26% (p < 0.001) (Table I). ASIC1a Co-expressed with ASIC1b, ASIC2a, ASIC2b, or ASIC3—Co-expression of ASIC1a and one other ASIC subunit gave rise to functional acid-sensitive channels in all cases (Fig. 1, F–I). Proton sensitivities of the different subunit combinations fell into two categories. The ASIC1a+1b, ASIC1a+2a, and ASIC1a+2b combinations all showed proton sensitivities similar to ASIC1a (Fig. 3, A and B, respectively), whereas the sensitivity of the ASIC1a+3 combination was indistinguishable from that of ASIC3 homomeric channels (Fig. 3C). For three of four of these combinations desensitization kinetics were affected in one way or another relative to the respective homomeric receptors; only ASIC1a+2b appeared unchanged compared with the ASIC1a homomeric receptor. The desensitization rate of the ASIC1a+1b combination was dependent on the proton concentration as was the case for the respective homomeric channels (Fig. 4A). Contrary to this, the rates for the ASIC1a+2a and ASIC1a+3 combinations were independent of the proton concentration (p > 0.98 and p > 0.48, respectively) (Fig. 4, B and C). Comparing desensitization rates at pH50, ASIC1a+1b was significantly slower than ASIC1a and ASIC1b (p < 0.001 and p < 0.05, respectively), whereas ASIC1a+3 was significantly faster than ASIC1a and ASIC3 (p < 0.001 and p < 0.05, respectively). Due to the pH dependence of ASIC1a desensitization, a comparison of the rates of ASIC1a+2a and ASIC1a was complex with significant differences at some proton occupancy levels but not at others. However, measured at pH = 4.0 (∼pH100), ASIC1a+2a desensitization was significantly slower than that of ASIC1a (p < 0.05) but faster than that of ASIC2a (p < 0.001). The sustained current at pH 4.0 of all the combinations was in the range of 3–6% of peak currents, which is not significantly different from homomeric ASIC1a (Table I). Interestingly, when compared with homomeric ASIC3, the ASIC1a+3 combination displayed a major reduction of the level of sustained current (p < 0.001). ASIC1b Co-expressed with ASIC2a, ASIC2b, or ASIC3— ASIC1b co-expressed with ASIC2a or ASIC3 in CHO cells yielded functional channels (Fig. 1, J–K); however, contrary to all other combinations of subunits, ASIC1b+2b did not exhibit proton-activated currents in 30 of 36 cells. In the transfection procedure for ASIC1b+2b, an increase of DNA levels to the highest level possible (before cellular death occurred) was tried, but still, in the few cells that did show a proton-evoked current, the amplitude was very low ( 0.23 and p > 0.15, respectively) (Fig. 4, D and E). Again, comparing proton-independent with proton-dependent desensitization is problematic. In general, desensitization rates of ASIC1b+2a could be characterized as intermediate to the respective homomeric channels; ASIC1b+2a was significantly faster than ASIC2a at pH50 (p < 0.05) but significantly slower than ASIC1b at pH100 (p < 0.05). The general picture of ASIC1b+3 was one of a channel desensitizing faster than the respective homomeric channels (Fig. 4E). Indeed, it desensitized significantly faster than ASIC1b at pH50 (p < 0.001); however, despite the pH independence of both ASIC3 and ASIC1b+3 significant differences were not observed for all proton occupancy levels. Still, at pH100 (pH = 4.0) ASIC1b+3 clearly desensitized significantly faster than ASIC3 (p = 0.01). For the ASIC1b+2a combination the level of sustained current at pH 4.0 relative to peak current was 14%, which represents a significant increase compared with either homomeric channel (p < 0.001). The level of sustained current for the ASIC1b+3 combination (15%) was intermediate to the levels determined for the respective homomeric channels (Table I). Co-expression of ASIC2a+2b, ASIC2a+3, and ASIC2b+3— Acid-sensitive channels were formed from co-expressing dual combinations of ASIC2a, ASIC2b, and ASIC3 (Fig. 1, L–O). The activation characteristics of ASIC2a+3 resembled ASIC3 with two different profiles. In some cells ASIC2a+3 had an apparent simple transient activation profile (Fig. 1M), whereas in other cells a slower activating current followed the transient current (Fig. 1N). Despite functionality of all these subunit combinations, the acid sensitivity of ASIC2a and ASIC3 was largely unaffected by the presence of ASIC2b (Fig. 3, D and F, respectively), whereas the sensitivity of ASIC2a+3 was intermediate to either homomeric channel (Fig. 3F). Overall, desensitization kinetics of ASIC2a+2b and ASIC2b+3 were identical to the kinetics of homomeric ASIC2a and ASIC3, respectively (p > 0.05) (Fig. 4, F and G). The τdesens values of ASIC2a+3 were independent on the proton concentration (p > 0.54) (Fig. 4G). At pH50 ASIC2a+3 desensitized significantly faster than ASIC2a (p < 0.01); however, although desensitization of ASIC2a+3 always appeared faster than ASIC3 (Fig. 4G), this difference did not reach significance. Interestingly, the desensitization phase of ASIC2a+3 was masked at pH ≤ 4.5 due to activation of a prominent sustained current (see below). Whole-cell currents measured from cells co-expressing ASIC2a+2b maintained a level of sustained current of 17% at pH 4.0; this represents a significant increase relative to the 7.5% determined for homomeric ASIC2a (p < 0.0001) (Table I). Interestingly the ASIC2a+3 combination displayed a pronounced mean sustained current of 105% at pH 4. The reason for a measured sustained current larger than the peak current is the second slower activating current observed in some cells, which frequently exceeds the amplitude of the transient peak. The sustained current of 105% was significantly greater than the values corresponding to both homomeric ASIC2a and ASIC3 (p < 0.05). The level of sustained current determined for ASIC2b+3 was of a similar magnitude to that of ASIC3 homomers (p > 0.16) (Table I). Co-expression of ASIC1a+2a+3—Co-expressing these three subunits gave rise to channels with peculiar characteristics (Fig. 1P). The proton sensitivity of acid-evoked currents in these cells was highly unusual (Fig. 5A), with activation starting at pH 6.5 and not fully saturating at pH 4, which is also clearly reflected in a low Hill slope of 0.65 (Table I). The τdesens values of ASIC1a+2a+3-mediated whole-cell currents displayed unusual pH dependence, in the range of pH 6–4.5, in that τdesens actually increased with increasing proton concentration (p < 0.01) (Fig. 6A). The desensitization rate at pH50 was similar to that of ASIC1a+2a (p > 0.05) but significantly slower when compared with the rates of ASIC1a+3 and ASIC2a+3 (p < 0.001). The level of sustained current at pH 4.0 did not differ significantly from that of ASIC1a+2a and ASIC1a+3 (p > 0.05) but was significantly lower than that of ASIC2a+3 (p < 0.01) (Table I). Co-expression of ASIC1a+2b+3—Although this co-expression experiment yielded functional channels (Fig. 1Q) the channel characteristics were similar to those of ASIC1a+3. First, the proton sensitivity of acid-evoked currents was virtually identical to that of ASIC1a+3-mediated currents (Fig. 5B). Next, desensitization kinetics were not significantly different from those of ASIC1a+3 at any pH value (p > 0.05) (Fig. 6B). Finally, the level of sustained current normalized to peak current at pH 4.0 was not significantly different from that of ASIC1a+3 (p > 0.35) (Table I). Co-expression of ASIC1b+2a+3—The last triple co-expression tested also yielded functional acid-sensitive channels (Fig. 1R) but again with peculiar characteristics. With respect to the proton sensitivity, the ASIC1b+2a+3 combination was reminiscent of ASIC1a+2a+3 (Fig. 5A) and was thus less acid-sensitive than any of the corresponding pairwise subunit combinations (Table I). Time constants of desensitization for ASIC1b+2a+3-mediated currents were also unusual compared with other subunit combinations, as τdesens increased at increasing proton concentration (Fig. 6A). The desensitization rate at pH50