Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

A pH-dependent Conformational Change of NhaA Na+/H+ Antiporter of Escherichia coli Involves Loop VIII–IX, Plays a Role in the pH Response of the Protein, and Is Maintained by the Pure Protein in Dodecyl Maltoside

1999; Elsevier BV; Volume: 274; Issue: 35 Linguagem: Inglês

10.1074/jbc.274.35.24617

ISSN

1083-351X

Autores

Yoram Gerchman, Abraham Rimon, Etana Padan,

Tópico(s)

DNA and Nucleic Acid Chemistry

Resumo

Digestion with trypsin of purified His-tagged NhaA in a solution of dodecyl maltoside yields two fragments at alkaline pH but only one fragment at acidic pH. Determination of the amino acid sequence of the N terminus of the cleavage products show that the pH-sensitive cleavage site of NhaA, both in isolated everted membrane vesicles as well as in the pure protein in detergent, is Lys-249 in loop VIII–IX, which connects transmembrane segment VIII to IX. Interestingly, the two polypeptide products of the split antiporter remain complexed and co-purify on Ni2+-NTA column. Loop VIII–IX has also been found to play a role in the pH regulation of NhaA; three mutations introduced into the loop shift the pH profile of the Na+/H+ antiporter activity as measured in everted membrane vesicles. An insertion mutation introducing Ile-Glu-Gly between residues Lys-249 and Arg-250 (K249-IEG-R250) and Cys replacement of either Val-254 (V254C) or Glu-241 (E241C) cause acidic shift of the pH profile of the antiporter by 0.5, 1, and 0.3 pH units, respectively. Interestingly, the double mutant E241C/V254C introduces a basic shift of more than 1 pH unit with respect to the single mutation V254C. Taken together these results imply the involvement of loop VIII–IX in the pH-induced conformational change, which leads to activation of NhaA at alkaline pH. Digestion with trypsin of purified His-tagged NhaA in a solution of dodecyl maltoside yields two fragments at alkaline pH but only one fragment at acidic pH. Determination of the amino acid sequence of the N terminus of the cleavage products show that the pH-sensitive cleavage site of NhaA, both in isolated everted membrane vesicles as well as in the pure protein in detergent, is Lys-249 in loop VIII–IX, which connects transmembrane segment VIII to IX. Interestingly, the two polypeptide products of the split antiporter remain complexed and co-purify on Ni2+-NTA column. Loop VIII–IX has also been found to play a role in the pH regulation of NhaA; three mutations introduced into the loop shift the pH profile of the Na+/H+ antiporter activity as measured in everted membrane vesicles. An insertion mutation introducing Ile-Glu-Gly between residues Lys-249 and Arg-250 (K249-IEG-R250) and Cys replacement of either Val-254 (V254C) or Glu-241 (E241C) cause acidic shift of the pH profile of the antiporter by 0.5, 1, and 0.3 pH units, respectively. Interestingly, the double mutant E241C/V254C introduces a basic shift of more than 1 pH unit with respect to the single mutation V254C. Taken together these results imply the involvement of loop VIII–IX in the pH-induced conformational change, which leads to activation of NhaA at alkaline pH. transmembrane domain n-dodecyl β-d-maltoside polyacrylamide gel electrophoresis N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine 1,3-bis[tris(hydroxymethyl)methylamino]propane Sodium proton antiporters are ubiquitous membrane proteins found in the cytoplasmic and organelle membranes of cells of many different origins, including plants, animals and microorganisms. They are involved in cell energetics and play primary roles in the regulation of intracellular pH, cellular Na+ content, and cell volume (reviewed in Refs. 1Padan E. Schuldiner S. Bakker E. Alkali Cation Transport Systems in Procaryotes. CRC Press, Boca Raton, FL1992: 3-24Google Scholar, 2Padan E. Schuldiner S. Biochim. Biophys. Acta. 1994; 1185: 129-151Crossref PubMed Scopus (143) Google Scholar, 3Schuldiner S. Padan E. Bakker E. Alkali Cation Transport Systems in Procaryotes. CRC Press, Boca Raton, FL1992: 25-51Google Scholar, 4Padan E. Oren A. Microbiology and Biochemistry of Hypersaline Environments. CRC Press, Boca Raton, FL1998: 163-175Google Scholar). Escherichia coli has two antiporters, NhaA (5Goldberg B.G. Arbel T. Chen J. Karpel R. Mackie G.A. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2615-2619Crossref PubMed Scopus (183) Google Scholar) and NhaB (6Pinner E. Padan E. Schuldiner S. J. Biol. Chem. 1992; 267: 11064-11068Abstract Full Text PDF PubMed Google Scholar), which specifically exchange Na+ or Li+ for H+ (3Schuldiner S. Padan E. Bakker E. Alkali Cation Transport Systems in Procaryotes. CRC Press, Boca Raton, FL1992: 25-51Google Scholar). nha A is indispensable for adaptation to high salinity, for challenging Li+ toxicity, and for growth at alkaline pH (in the presence of Na+) (7Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Abstract Full Text PDF PubMed Google Scholar). Accordingly, expression of nha A, which is dependent on NhaR, a positive regulator, is induced by Na+, in a pH-dependent manner (8Karpel R. Alon T. Glaser G. Schuldiner S. Padan E. J. Biol. Chem. 1991; 266: 21753-21759Abstract Full Text PDF PubMed Google Scholar, 9Rahav-Manor O. Carmel O. Karpel R. Taglicht D. Glaser G. Schuldiner S. Padan E. J. Biol. Chem. 1992; 267: 10433-10438Abstract Full Text PDF PubMed Google Scholar, 10Carmel O. Rahav-Manor O. Dover N. Shaanan B. Padan E. EMBO J. 1997; 16: 5922-5929Crossref PubMed Scopus (28) Google Scholar). nha B by itself confers a limited sodium tolerance to the cells, but becomes essential when the lack of NhaA activity limits growth (11Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Abstract Full Text PDF PubMed Google Scholar). Both the NhaA and NhaB are electrogenic antiporters that have been purified to homogeneity and reconstituted in a functional form in proteoliposomes (12Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar, 13Pinner E. Padan E. Schuldiner S. J. Biol. Chem. 1994; 269: 26274-26279Abstract Full Text PDF PubMed Google Scholar, 14Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 5382-5387Abstract Full Text PDF PubMed Google Scholar). The H+/Na+stoichiometry of NhaA is 2H+/Na+ and that of NhaB 3H+/2Na+. NhaB but not NhaA is sensitive to amiloride derivatives, and the rate of activity of NhaA but not of NhaB is drastically dependent on pH, changing its Vmax over 3 orders of magnitude from pH 7 to pH 8 (12Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar). Interestingly, a strong pH sensitivity is characteristic of antiporters as well as other transporters that are involved in pH regulation (reviewed in Ref. 4Padan E. Oren A. Microbiology and Biochemistry of Hypersaline Environments. CRC Press, Boca Raton, FL1998: 163-175Google Scholar). Identifying the amino acid residues involved in the pH sensitivity of these proteins is important for understanding the mechanism of pH regulation. NhaA contains eight histidines, none of which were found essential for the Na+/H+ antiporter activity of NhaA (15Gerchman Y. Olami Y. Rimon A. Taglicht D. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1212-1216Crossref PubMed Scopus (131) Google Scholar). However, replacement of histidine 225 by Arg (H225R) suggested that His-225 has an important role in the pH sensitivity of the antiporter. Whereas the activation of the wild-type NhaA occurs between pH 7.5 and pH 8, that of H225R antiporter occurs between pH 6.5 and pH 7.5. In addition, while the wild-type antiporter remains almost fully active, at least up to pH 8.5, H225R is reversibly inactivated above pH 7.5, retaining only 10–20% of the maximal activity at pH 8.5 (15Gerchman Y. Olami Y. Rimon A. Taglicht D. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1212-1216Crossref PubMed Scopus (131) Google Scholar). Furthermore, replacement of His-225 with either cysteine (H225C) or serine (H225S) but not alanine (H225A) yielded an antiporter with a wild-type pH-sensitive phenotype, implying that polarity and/or hydrogen bonding, the common properties shared by His, Cys, and Ser, are essential at position 225 for pH regulation of NhaA (16Rimon A. Gerchman Y. Olami Y. Schuldiner S. Padan E. J. Biol. Chem. 1995; 270: 26813-26817Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Glycine 338 affects the pH response of NhaA; its replacement with serine (G338S in TMS1 XI) produced a transporter, which in contrast to the wild-type protein lacks pH control; it is active between pH 6.5 and 8.5 (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Recently, we have found that NhaA undergoes a conformation change upon its activation by pH which can be probed by trypsin (18Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14577-14582Crossref PubMed Scopus (38) Google Scholar). At acidic pH the protein in everted membrane vesicles is completely resistant to trypsin, while at alkaline pH it is digested in a pattern reflecting the pH profile of the antiporter activity. Furthermore, two mutants with a modified pH profile are susceptible to trypsin in isolated membrane vesicles only at the pH range, where they are active and reflecting the level of activity (18Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14577-14582Crossref PubMed Scopus (38) Google Scholar). H225R, the mutant with a pH profile shifted toward acidic pH, is digested at the pH where it is active; G338S, which lost pH control, is active and exposed to trypsin throughout the entire pH range of activity. Although NhaA has many trypsin-cleavable sites, only two main fragments were observed following digestion of isolated membrane vesicles at alkaline pH. This observation suggests that only one cleavage site is exposed by pH while all the other sites are masked. It was therefore inferred that the trypsin cleavage site is located in, and therefore serves as a tag of, that part of the protein which undergoes a conformational change in response to pH. Identification and study of this site was therefore undertaken in this study. The results show that loop VIII–IX is important for the pH regulation of NhaA and bears the trypsin cleavage site, which is involved in the pH-dependent conformational change of NhaA. This change is maintained by the pure protein in DM. EP432 is an E. coli K12 derivative, which is mel BLid, Δnha A1::kan, Δnha B1::cat, Δlac ZY, thr1 (11Pinner E. Kotler Y. Padan E. Schuldiner S. J. Biol. Chem. 1993; 268: 1729-1734Abstract Full Text PDF PubMed Google Scholar). TA16 is nha A+ nha B+ lac IQand otherwise isogenic to EP432 (12Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar). DH5α (U. S. Biochemical Corp.) and JM109 were used as hosts for construction of plasmids. Cells were grown in modified L broth in which NaCl was replaced by KCl (Ref. 7Padan E. Maisler N. Taglicht D. Karpel R. Schuldiner S. J. Biol. Chem. 1989; 264: 20297-20302Abstract Full Text PDF PubMed Google Scholar; 87 mm, pH 7.5). Where indicated, the medium was buffered by 60 mm Bis-Tris propane, and pH was titrated with HCl. Cells were also grown in minimal medium A without sodium citrate (19Davies B.D. Mingioli E.S. J. Bacteriol. 1950; 60: 17-28Crossref PubMed Google Scholar) with either glycerol (0.5%) or melibiose (10 mm) as a carbon source. Thiamine (2.5 μg/ml) was added to all minimal media. For plates, 1.5% agar was used. Antibiotics were 100 μg/ml ampicillin, and/or 50 μg/ml kanamycin, and/or 12 μg/ml chloramphenicol, and/or 12.5 μg/ml tetracycline. Resistance to Li+ and Na+ was tested as described previously (15Gerchman Y. Olami Y. Rimon A. Taglicht D. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1212-1216Crossref PubMed Scopus (131) Google Scholar). pGM36 and pGMAR100 are pBR322 derivatives (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar,20Karpel R. Olami Y. Taglicht D. Schuldiner S. Padan E. J. Biol. Chem. 1988; 263: 10408-10414Abstract Full Text PDF PubMed Google Scholar); the first bears nha A and most of the nha R gene. The latter carries nha A and C-terminal truncated nha R. pAR100 is a pACYC184 derivative, which carries an insert identical to that of pGMAR100 (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). pIQ is a pACYC184 derivative, which carries lac IQ (kindly provided by E. Bibi, Weizman Institute of Science, Rehovot, Israel). pAXH is a plasmid carrying Xa-His-tagged NhaA. It was constructed previously (21Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) and contains NhaA fused at its N terminus to the tac promoter for over expression and at its C terminus to a sequence encoding in tandem two factor Xa protease cleavage sites and 6 His. pMXH was constructed by digestion of pAXH by Mlu I and Xho I, followed by end filling with T4 DNA polymerase and self-ligation of the 4960-base pair fragment. The resulting plasmid carries nha A fusion encoding NhaA, of which RLRPSV C terminus is replaced by EHHHHHH. Site-directed mutagenesis was conducted following a polymerase chain reaction-based protocol (22Ho S.F. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6832) Google Scholar). DNA of pGMAR100 was used as a DNA template. The end primers and the mutagenic primers are described in Table I.Table IPrimers used for construction of NhaA mutantsMutationMutagenic primer1-aAll primers start at 5′. Mutated codons are sown in lowercase. The mutated codons introducing new restriction site are underlined and indicated consecutively from the 5′ end.Location1-bLocations are relative to the initiation codon. The nhaA sequence appears in the GenBank™ data base (accession no. J03879).Codon changeNew restriction siteE241CTTCCTTTGAAAtgtAAGCATGGGCG710-735GAG → TGTNoneV254CCTGGAGCATtgcTTGCACCCATGGGTGG751-778GTG → TGCStyΔ(K242-H253)TTATTCCCCTGAAAGAG1-cBase pairs 724-758 were deleted.707-723 and 759-781Codons to amino acidsBsg I, Eco NI, Ppu MI, Sty IGTCCTGCACCCTTGGGTGGCGT242-253 deletedK249-IEGR250CGCCGGCGAAGattgaaggtCGACTCGAGCATG737-747 and 748-760Insert codons for amino acidsSaI I, Sgr AIForwardIEG between K249 and R250K249-IEGR250GCTCGAGTCGaccttcaatCTTCGCCCGGCGAAC757-748 and 747-734As aboveSal I, Xho IReverseStart primerTTTAACGATGATTCGTGGCGG−67 to −47NoneEnd primerGCTCATTTCTCTCCCTGATAAC1298-1276None1-a All primers start at 5′. Mutated codons are sown in lowercase. The mutated codons introducing new restriction site are underlined and indicated consecutively from the 5′ end.1-b Locations are relative to the initiation codon. The nhaA sequence appears in the GenBank™ data base (accession no. J03879).1-c Base pairs 724-758 were deleted. Open table in a new tab In the case of E241C and V254C, the resulting mutagenized DNA (1295 base pairs) was digested with Nhe I and Mlu I, yielding a fragment of 879 base pairs, which was ligated either to the 4436-base pair Nhe I-Mlu I fragment of pGMAR100 to yield plasmids pV254C or pE241C or to the 4139-base pair Nhe I-Mlu I fragment of pAXH to yield plasmids p(V254C)-XH or p(E241C)-XH. In the case of Δ(Lys-242–His-253), the resulting 1259-base pair polymerase chain reaction fragment was digested as above to yield an 820-base pair fragment and cloned as above to yield pGMAR100 derivative pΔ(Lys-242–His-253). In the case of the IEG insert between Lys-249 and Arg-250 (K249-IEG-R250), the 1304-base pairs polymerase chain reaction fragment was digested as above to yield an 888-base pair fragment and cloned as above into both pGMAR100 and pAXH to yield plasmids p(K249-IEG-R250) (5324 base pairs) or p(Lys-249-IEG-R250A)-XH (5027 base pairs), respectively. Assays of Na+/H+antiport activity were conducted on everted membrane vesicles (23Rosen B.P. Methods Enzymol. 1986; 125: 328-336Crossref PubMed Scopus (113) Google Scholar). The assay of antiport activity was based upon the measurement of Na+ (or Li+)-induced changes in the ΔpH as described (5Goldberg B.G. Arbel T. Chen J. Karpel R. Mackie G.A. Schuldiner S. Padan E. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2615-2619Crossref PubMed Scopus (183) Google Scholar, 24Schuldiner S. Fishkes H. Biochemistry. 1978; 17: 706-711Crossref PubMed Scopus (103) Google Scholar). High pressure membrane vesicles were prepared essentially as everted membrane vesicles but the pressure used was 20,000 p.s.i. (French pressure cell press; SLM Aminco). Quantitation of the NhaA and its mutated derivative in membranes was determined by Western analysis as described previously (16Rimon A. Gerchman Y. Olami Y. Schuldiner S. Padan E. J. Biol. Chem. 1995; 270: 26813-26817Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). To overexpress the wild-type and the mutated antiporters, plasmids overexpressing the His-tagged proteins in TA16 cells were used. The transformed cells were grown in minimal medium to A600 0.6, induced with 0.5 mmisopropyl-1-thio-β-d-galactopyranoside, grown for 2 h to A600 1–1.2, harvested (12Taglicht D. Padan E. Schuldiner S. J. Biol. Chem. 1991; 266: 11289-11294Abstract Full Text PDF PubMed Google Scholar), and used for preparation of high pressure membranes either after storage overnight at 4 °C or after freezing at −20 °C. Xa-His-tagged NhaA or His-tagged NhaA were affinity-purified on Ni2+-NTA-agarose column (Qiagen, Hilden, Germany) as described (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Purified antiporter was subjected to trypsin in a 30-μl reaction mixture containing 10 μg of antiporter protein, 30 ng of trypsin (type III from bovine pancreas, Sigma T-8253), 0.1% DM, 8.3 mm potassium acetate, 200 mm KCl, 6.5% glycerol, 0.7 mm Na/EDTA, 20 mm Hepes/Tris (pH 8, if not indicated otherwise), 1 mm CaCl2. Incubation was for 30 min at 37 °C. The reaction was terminated by the addition of 100 ng of trypsin inhibitor (type II-S from soybean, Sigma T-9128). Samples of 5 μg of protein were run on SDS-PAGE (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Digestion of membrane vesicles (200 μg of protein, 4 μg of trypsin) was carried out in 100 μl of reaction mixture containing 140 mm KCl, 10 mm Tricine (pH 8), and 5 mm MgCl and incubation conducted for 1 h at 37 °C. This reaction mixture, which is also used for the Na+/H+ antiporter activity assay, gave similar digestion pattern and was occasionally used also with pure proteins as indicated. The protein sample (50 μg) was resuspended in SDS-PAGE sampling buffer and loaded on 12.5% bisacrylamide gel. After separation the polypeptides were transferred (400 mA for 60 min) to polyvinylidene difluoride type (Millipore ImmobilonTM-P) transfer membranes in transfer buffer containing 25 mm Tris, 192 mm glycine, 10% methanol, 0.025% SDS (pH 8.4). The filters were then washed in distilled water, stained for 5 min in 0.1% Coomassie (R-250) in 50% methanol, destrained for 5–10 min in 10% acetic acid in 50% methanol, and washed for 5–10 min in distilled water. The stained bands were cut and subjected to N-terminal sequencing in a Perkin-Elmer (Applied Biosystem Division) 492 (Procise) microsequencer system. Protein was determined according to Ref. 25Zor T. Selinger Z. Anal. Biochem. 1996; 236: 302-308Crossref PubMed Scopus (881) Google Scholar. Sequencing of DNA was conducted by an automated DNA sequencer (ABI PRISMTM 377, Perkin-Elmer). For affinity purification of NhaA, we have previously engineered NhaA fused at its C terminus to two factor Xa cleavage sites and 6 His residues (designated henceforth Xa-His-tagged NhaA instead of pYG10; Ref. 21Olami Y. Rimon A. Gerchman Y. Rothman A. Padan E. J. Biol. Chem. 1997; 272: 1761-1768Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). Trypsin digestion of both native NhaA (18Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14577-14582Crossref PubMed Scopus (38) Google Scholar) and Xa-His-tagged NhaA (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) in everted membrane vesicles showed identical pH profile, which is similar to that of the activity of the antiporter, and thus has been suggested to reflect a native active conformational change of the antiporter. Both activities are shut off at acidic pH and increase above pH 7 to reach the maximum at pH 8.5. The digestion products of each protein are two main fragments similar in size. Given that the trypsin digestion pattern probes a native conformation of the protein, it was interesting to use trypsin digestion to test whether this conformation of NhaA is maintained by the pure protein in DM. Xa-His-tagged NhaA was affinity-purified in DM, subjected to digestion by trypsin at various pH values, and the products separated on SDS-PAGE (Fig. 1 A). Upon alkalinization, two protein fragments appear in a pH-dependent fashion, similar in size to that previously obtained by trypsin digestion of isolated membrane vesicles (17Rimon A. Gerchman Y. Kariv Z. Padan E. J. Biol. Chem. 1998; 273: 26470-26476Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). In the acidic pH digest, a single fragment was observed, suggesting that the cleavage site, which splits the pure protein at alkaline pH, is masked. However, when the separation on SDS-PAGE was prolonged (Fig.1 B), the single band obtained at acidic pH was found to be slightly shorter than the control protein, implying the existence of an additional exposed cleavage site(s). Since the His tag was fused at the C terminus of NhaA, binding to Ni2+-NTA column was used to test whether the C terminus is intact. Hence, Xa-His-tagged NhaA was treated with trypsin either at acidic or alkaline pH and the capacity of the products to affinity-purify on Ni2+-NTA tested. Neither the acidic nor the basic pH digestion products bound to the column, implying that at both pH values the C terminus together with the His tag was trimmed off. Similar results were obtained when the trypsin treatment was conducted on everted membrane vesicles overexpressing Xa-His-tagged NhaA (data not shown). In contrast to Xa-His-tagged NhaA, native NhaA in isolated membrane vesicles did not seem to be cleaved by trypsin at its C terminus (18Rothman A. Gerchman Y. Padan E. Schuldiner S. Biochemistry. 1997; 36: 14577-14582Crossref PubMed Scopus (38) Google Scholar); the size of the protein following acidic digestion did not change; Western analysis with a site-directed polyclonal antibody against the C terminus recognized the apparently uncut protein obtained at acidic pH and the light tryptic fragment obtained at alkaline pH. This antibody did not recognize the intact Xa-His-tagged protein, most probably due to steric hindrance of the tags. We thus assumed that the trypsin cleavage site at the C terminus of Xa-His-tagged NhaA was introduced by the Xa tag. Indeed, as shown below, deleting the factor Xa sequences yielded His-tagged NhaA, which is not clipped by trypsin at the C terminus. The N terminus remained intact following trypsin digestion of pure Xa-His-tagged protein; as shown below, the large fragment obtained at alkaline pH starts with the original N-terminal sequence of the native protein (Fig. 2). To identify the trypsin cleavage site that is exposed by pH and splits NhaA, each of the two fragments (heavy and light) obtained from the trypsin digest of Xa-His-NhaA at alkaline pH (Fig. 1) were isolated from the gels and subjected to N-terminal sequencing (Fig. 2). The N terminus of the heavy fragment was found (with less than 1% contaminations) identical to that of the native protein. The light fragment fraction contained mainly (about 90%) a fragment with a N-terminal sequence that overlaps a sequence between Arg-250 and Leu-264 (Arg-250–Leu-264) of loop VIII–IX. In addition, it contained small amounts (about 5% each) of two additional peptides with sequences overlapping Ser-246–Ala-259 in loop VIII–IX and Val-50–Asn-64 in loop I-II, respectively. Hence, the main cleavage site of trypsin that is exposed at alkaline pH is in Lys-249 of loop VIII–IX. The similarity in the pH profile of the trypsin digestion and the size of the products have suggested that the cleavage site in situ in everted membrane vesicles is identical to that of the pure protein in DM. However, proving this suggestion was difficult since it is a very laborious task to purify the products that lost the His tag during the in situ digestion by trypsin, from the membranous fraction. We therefore constructed a plasmid (pMXH) from pAXH, which encodes His-tagged NhaA with no factor Xa cleavage sites. Everted membrane vesicles isolated from cells overexpressing this protein exhibit a Na+/H+ antiporter activity and a pH profile identical to that of the wild-type protein (data not shown). These everted membrane vesicles were exposed to trypsin both at acidic (data not shown) and alkaline pH (Fig.3), the treated membranes solubilized in DM, the solubilized fraction affinity-purified on Ni2+-NTA column. and the eluted polypeptides separated on SDS-PAGE (Fig. 3). Following treatment at acidic pH, the protein purified on the column behaved in SDS-PAGE in a fashion similar to that of the undigested control: one band, of a size identical to the untreated control. These results suggest that following trypsinolysis the His tag remains intact in this recombinant protein and allows the affinity purification of the protein. The results also show that indeed the trypsin cleavage site at the C terminus of the Xa-His-tagged NhaA reside in the factor Xa cleavage site. When alkaline pH digest of His-tagged NhaA was applied to the column, two fragments were affinity-purified on the Ni2+-NTA (Fig. 3, lanes b and c): a heavy fragment similar in size to that observed following treatment of Xa-His-tagged NhaA, and a slightly shorter light fragment as expected on the basis of the difference between the two C termini of Xa-His-tagged and His-tagged NhaA. In contrast, none of the tryptic polypeptides derived from Xa-His-tagged NhaA subjected to the same treatment were purified by the column (Fig. 3, lane e). It is remarkable that despite the trypsin split in His-tagged NhaA two fragments co-purify via the His tag: the C-terminal fragment with His tag and the N-terminal fragment without it. This result implies that both C-terminal and N-terminal fragments formed by the trypsin split are bound to each other and do not separate in DM. To verify that the trypsin cleavage site of His-tagged NhaA in situ (in the membrane) is identical to that of the pure protein, the light C-terminal fragments obtained from the trypsin digest of His-tagged NhaA membranes were isolated by SDS-PAGE and subjected to N-terminal sequencing. The results show that indeed the trypsin cleavage site that is exposed in situ at alkaline pH is identical to that identified in the pure protein in DM, namely Lys-249 of loop VIII–IX. Also similar to the pure protein is a minor split occurring in situ at Arg-245. Since loop VIII–IX changes its conformation with pH, the question arises as to whether loop IV-IX plays any role in the activity of NhaA or its regulation by pH. To answer this question, three types of mutations have been introduced to loop VIII–IX. The first type is a deletion mutation lacking 12 amino acids from Lys-242 to His-253 (ΔLys-242–His-253). This mutant was expressed to a very low level (2% of the expression of the wild type; TableII) and did not grow in the presence of 0.6 m NaCl either at pH 7 or at pH 8.3. As measured in isolated membrane vesicles, the mutant did not show any Na+/H+ antiporter activity at pH 7 but at pH 8.5 a very low but reproducible activity was monitored (Fig.4). Whereas, with the wild-type membranes, 100% of dequenching of the fluorescence was obtained within 30 s, 30% of this activity was obtained by the mutant only after 10 min. This low activity was ascribed to the mutant-NhaA since the control membranes derived from cells transformed with the vector (pBR322) did not show any activity.Table IIExpression of loop VIII-IX NhaA mutantsPlasmidExpression%pGMAR100 (wild-type)100pE241C120pV254C110pE241CV254C100pK249-IEG-R250100pΔ(K242-H253) 2pΔ(K242-H253)P257S 4Δnha AΔnha B cells transformed with the indicated plasmids were grown to A600 = 0.7 in LBK. The membrane fraction, prepared by sonication (16Rimon A. Gerchman Y. Olami Y. Schuldiner S. Padan E. J. Biol. Chem. 1995; 270: 26813-26817Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar), was treated with 6m urea and then used for Western analysis. To compare the level of expression, densitometry was used; pGMAR100, which harbors wild-type nha A, and all other plasmids carrying mutated nha A are pBR322 derivatives. Open table in a new tab Δnha AΔnha B cells transformed with the indicated plasmids were grown to A600 = 0.7 in LBK. The membrane fraction, prepared by sonication (16Rimon A. Gerchman Y. Olami Y. Schuldiner S. Padan E. J. Biol. Chem. 1995; 270: 26813-26817Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar), was treated with 6m urea and then used for Western analysis. To compare the level of expression, densitometry was used; pGMAR100, which harbors wild-type nha A, and all other plasmids carrying mutated nha A are pBR322 derivatives. A spontaneous suppressor mutation was obtained by growing ΔLys-242–His-253 at pH 7 in the presence of 0.6 m NaCl. The mutation was cloned and identified as P257S in ΔLys-242–His-253 (Δ(Lys-242–His-253) P25

Referência(s)