Portal de Periódicos da CAPES

OC-2, a Novel Mammalian Member of the ONECUT Class of Homeodomain Transcription Factors Whose Function in Liver Partially Overlaps with That of Hepatocyte Nuclear Factor-6

1999; Elsevier BV; Volume: 274; Issue: 5 Linguagem: Inglês

10.1074/jbc.274.5.2665

1083-351X

Patrick Jacquemin, Vincent Lannoy, Guy Rousseau, Frédéric P. Lemaigre,

Pluripotent Stem Cells Research

Transcription factors of the ONECUT class, whose prototype is hepatocyte nuclear factor (HNF)-6, are characterized by the presence of a single cut domain and by a peculiar homeodomain (Lannoy, V. J., Bürglin, T. R., Rousseau, G. G., and Lemaigre, F. P. (1998) J. Biol. Chem. 273, 13552–13562). We report here the identification and characterization of human OC-2, the second mammalian member of this class. TheOC-2 gene is located on human chromosome 18. The distribution of OC-2 mRNA in humans is tissue-restricted, the strongest expression being detected in the liver and skin. The amino acid sequence of OC-2 contains several regions of high similarity to HNF-6. The recognition properties of OC-2 for binding sites present in regulatory regions of liver-expressed genes differ from, but overlap with, those of HNF-6. Like HNF-6, OC-2 stimulates transcription of the hnf-3βgene in transient transfection experiments, suggesting that OC-2 participates in the network of transcription factors required for liver differentiation and metabolism. Transcription factors of the ONECUT class, whose prototype is hepatocyte nuclear factor (HNF)-6, are characterized by the presence of a single cut domain and by a peculiar homeodomain (Lannoy, V. J., Bürglin, T. R., Rousseau, G. G., and Lemaigre, F. P. (1998) J. Biol. Chem. 273, 13552–13562). We report here the identification and characterization of human OC-2, the second mammalian member of this class. TheOC-2 gene is located on human chromosome 18. The distribution of OC-2 mRNA in humans is tissue-restricted, the strongest expression being detected in the liver and skin. The amino acid sequence of OC-2 contains several regions of high similarity to HNF-6. The recognition properties of OC-2 for binding sites present in regulatory regions of liver-expressed genes differ from, but overlap with, those of HNF-6. Like HNF-6, OC-2 stimulates transcription of the hnf-3βgene in transient transfection experiments, suggesting that OC-2 participates in the network of transcription factors required for liver differentiation and metabolism. The identification of transcription factors has provided insight into the mechanisms of the control of gene expression. Some of these factors contain a DNA-binding region called the homeodomain. The homeodomain proteins are evolutionarily conserved and play an important role in cell differentiation and in morphogenesis (1Kenyon C. Cell. 1994; 78: 175-180Abstract Full Text PDF PubMed Scopus (101) Google Scholar, 2Lawrence P.A. Morata G. Cell. 1994; 78: 181-189Abstract Full Text PDF PubMed Scopus (250) Google Scholar, 3Krumlauf R. Cell. 1994; 78: 191-201Abstract Full Text PDF PubMed Scopus (1771) Google Scholar, 4$$Google Scholar). Several homeodomain proteins contain a second type of DNA-binding domain. This is the case for the proteins of the CUT superclass, in which the second DNA-binding domain is called cut because it was initially described in the Drosophila CUT protein (5Blochlinger K. Bodmer R. Jack J. Jan L.Y. Jan Y.N. Nature. 1988; 333: 629-634Crossref PubMed Scopus (228) Google Scholar, 6Harada R. Dufort D. Denis-Larose C. Nepveu A. J. Biol. Chem. 1994; 269: 2062-2067Abstract Full Text PDF PubMed Google Scholar, 7Andrés V. Chiara M.D. Mahdavi V. Genes Dev. 1994; 8: 245-257Crossref PubMed Scopus (97) Google Scholar). The CUT superclass comprises three classes (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). The CUX class, whose members have three cut domains, includes the Drosophila CUT protein and its mammalian homologs, namely human CDP, rat CDP-2, dog CLOX, and mouse CUX and CUX-2. The SATB class, whose members have two cut domains, includes the human homeodomain proteins called matrix attachment region-binding proteins or SATB (specialAT-rich binding) proteins. A third class, called ONECUT because its members have a single cut domain, was identified (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) thanks to the cloning of rat hepatocyte nuclear factor-6 (HNF-6) 1The abbreviations used are: HNF, hepatocyte nuclear factor; ORF, open reading frame; RT-PCR, reverse transcription-polymerase chain reaction; TTR, transthyretin; PEPCK, phosphoenolpyruvate carboxykinase; GRU, glucocorticoid-responsive unit; bp, base pair(s); CORD, cone-rod dystrophy. (9Lemaigre F.P. Durviaux S.M. Truong O. Lannoy V.J. Hsuan J.J. Rousseau G.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9460-9464Crossref PubMed Scopus (133) Google Scholar). The ONECUT class includes mammalian HNF-6 and four Caenorhabditis elegans cDNAs or open reading frames (ORFs) (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). The proteins of the ONECUT class are characterized not only by their single cut domain, but also by a homeodomain with a peculiar amino acid composition. Homeodomains, which are 60 residues long, are organized in three α-helices (for a review on homeodomain-DNA interactions, see Refs. 10Kornberg T.B. J. Biol. Chem. 1993; 268: 26813-26816Abstract Full Text PDF PubMed Google Scholar, 11Gehring W.J. Qian Y.Q. Billeter M. Furukubo-Tokunaga K. Schier A.F. Resendez-Perez D. Affolter M. Otting G. Wüthrich K. Cell. 1994; 78: 211-223Abstract Full Text PDF PubMed Scopus (705) Google Scholar, 12Wolberger C. Cur. Opin. Struct. Biol. 1996; 6: 62-68Crossref PubMed Scopus (118) Google Scholar). The third helix, called the recognition helix, contacts the DNA and is crucial for sequence-specific binding. Within this helix, residue 48 is part of a hydrophobic core. Whereas residue 48 is a tryptophan in all known homeodomains, it is a phenylalanine in the ONECUT proteins. Residue 50 is also located in the recognition helix. Mutations at this position often lead to changes in the sequence specificity of DNA binding (13Hanes S.D. Brent R. Cell. 1989; 57: 1275-1283Abstract Full Text PDF PubMed Scopus (380) Google Scholar, 14Ades S.E. Sauer R.T. Biochemistry. 1994; 33: 9187-9194Crossref PubMed Scopus (113) Google Scholar, 15Stepchenko A.G. Luchina N.N. Pankratova E.V. Nucleic Acids Res. 1997; 25: 2847-2853Crossref PubMed Scopus (30) Google Scholar). This is consistent with the crystallization data that demonstrate that the amino acid at position 50 is in contact with bases (for a review, see Ref. 16Treisman J. Harris E. Wilson D. Desplan C. Bioessays. 1992; 14: 145-150Crossref PubMed Scopus (102) Google Scholar). In the ONECUT proteins, a methionine is found at position 50. This amino acid is never found at this position in other homeodomains. Our previous experiments showed that HNF-6 can bind to a number of DNA sites, which differ slightly in terms of sequence, and that the cut domain is required for binding of HNF-6 to all the sites tested (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). These experiments ascribed a dual role to the peculiar homeodomain of HNF-6. They showed that this domain is involved in DNA binding, but only for a subset of the sites recognized by HNF-6. They also showed that the homeodomain is involved in transcriptional activation, but only of those genes for which the binding of HNF-6 does not require its homeodomain. By mutational analysis, we demonstrated that phenylalanine 48 and methionine 50 play a role in this transcriptional activating function of the HNF-6 homeodomain (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). This work indicated that the linker region between the cut domain and homeodomain of HNF-6 is important for DNA binding (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). We identified two rat isoforms (HNF-6α and HNF-6β) that originate from the same gene by alternative splicing (17Rastegar M. Szpirer C. Rousseau G.G. Lemaigre F.P. Biochem. J. 1998; 334: 565-569Crossref PubMed Scopus (24) Google Scholar). HNF-6β (491 residues) is identical to HNF-6α (465 residues), except that it contains an insert of 26 amino acids in the linker region. These two isoforms differ in DNA binding specificity and kinetics (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). As mentioned above, the ONECUT class contains several C. elegans members, but only one mammalian member, namely HNF-6. The DNA-binding domains of these C. elegans proteins display DNA binding properties similar to those of HNF-6 (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). This indicates that these properties have been evolutionarily conserved and are therefore important for basic regulatory processes that are common to nematodes and mammals. The existence of several members of the ONECUT class inC. elegans prompted us to search for mammalian members of this class that are distinct from HNF-6. We describe here a new member, which we call OC-2, of the ONECUT class. The polymerase chain reaction (PCR) primers were as follows: bACT5, 5′-GGCATCGTGATGGACTCCG-3′; bACT3, 5′-GCTGGAAGGTGGACAGCGA-3′; FM2.1, 5′-ATTTCCCAGCAGCTGGG-3′; FM2.2, 5′-TATCTGTTGTCCTCATTTGG-3′; FM2.2A, 5′-CAGCTAGGAATCCGGTGTC-3′; FM2.9, 5′-TGGGGCTGGCCAGCAGCT-3′; FM2.10, 5′-AAAGTCTGGGCACTTTGC-3′; HNF6.6, 5′-GCTAGACGAGCAAAATCACACTCC-3′; HNF6.5, 5′-AAACCAAAGACTTAGCTCACCTGCA-3′; VLIIA, 5′-CCCAAGCTTACCATGGCAATCAATACCAAAGAGGTGGCTC-3′; and VLIIB, 5′-CGGGATCCTCACAGCCACTTCCACATCCTCCG-3′. The primers used as probes in Southern blotting experiments were as follows: HOM2, 5′-CCYMGRYTSGYSTTYAC-3′; HOM1, 5′-CKNSYRTTCATRAARAA-3′; HNF6.3, 5′-AGGAAAGAGCAAGAACATGGGAAGG-3′; and HNF6.4, 5′-CTGCTCATCATTTGTCTTGCCAAG-3′. The double-stranded oligonucleotide probes used in electrophoretic mobility shift assays were as follows: HNF-4, 5′-AGGATAGAAGTCAATGATCTGGGA-3′ (−394 to −371 of the mousehnf-4 promoter); HNF-3β, 5′-AGCTTAAGGCCCGATATTGATTTTTTTTTCTCC-3′ (−150 to −118 of the rathnf-3β promoter); TTR, 5′-GTCTGCTAAGTCAATAATCAGAAT-3′ (−110 to −87 of the mouse transthyretin promoter); PEPCK, 5′-CAAAGTTTAGTCAATCAAACGTTG-3′ (−263 to −240 of the rat phosphoenolpyruvate carboxykinase (pepck) gene promoter); and GRU, 5′-AAAAAAATCCATAACTTTCA-3′ (sequence in the GRU of the first intron of rat 6-phosphofructo-2-kinase (pfk-2) gene A). A 193-base pair (bp)-long OC-2 probe was synthesized using the PCR primers FM2.1 and FM2.2 and the IMAGE clone 566080 as template. This clone contains an expressed sequence tag (GenBankTM accession number AA121823) derived from a human fetal retina cDNA library. The OC-2 probe was used to screen a HeLa cell cDNA library (kindly provided by J.-M. Garnier) prepared in λZap II (Stratagene) by hybridization at 42 °C in 6× SSC and 50% formamide. Filters were washed at 55 °C in 3× SSC, and positive clones were isolated according to the supplier's instructions. Clones lacking the 5′-end of the cDNA were obtained. To find this 5′-end, a human genomic λEMBL3 library was screened with a probe containing the OC-2 cut domain. This probe was obtained by PCR using primers VLIIA and VLIIB and a HeLa cellOC-2 cDNA clone as template. A 4.5-kilobase pair-longEcoRI-EcoRI fragment was obtained from a purified genomic clone and subcloned in pBluescript KS+(Stratagene). A cDNA containing a full-length coding sequence was constructed by fusing 585 bp of the genomic subclone (nucleotides 1–585 in Fig. 1 A) to 1069 bp of a HeLa cell OC-2cDNA clone (nucleotides 586–1654 in Fig. 1 A). The genomic portion used to construct the fully coding cDNA is expressed as mRNA as confirmed by RT-PCR with liver or skin RNA. These RT-PCR experiments were performed with the Titan RT-PCR system (Boehringer Mannheim) in the presence of 2 m betaine using primers FM2.9 and FM2.10. The sequence of the two DNA strands was determined by automated DNA sequencing using the dideoxy chain termination method. DNA and protein sequence analysis was performed using the GCG software package (Genetics Computer Group, Inc., University of Wisconsin, Madison, WI). To identify predicted structurally conserved regions, multiple sequence alignments were performed using the Match-Box algorithm with matrix blosum62 (18Depiereux E. Feytmans E. Comput. Appl. Biosci. 1992; 8: 501-509PubMed Google Scholar,19Depiereux E. Baudoux G. Briffeuil P. Reginster I. De Bolle X. Vinals C. Feytmans E. Comput. Appl. Biosci. 1997; 13: 249-256PubMed Google Scholar). 2http://www.fundp.ac.be/sciences/biologie/bms/matchbox_submit.html. Figure 1OC-2 is a novel mammalian member of the ONECUT class of homeodomain proteins. A, nucleotide sequence of OC-2 cDNA and deduced amino acid sequence. The cut domain and homeodomain are boxed. B, alignment of the amino acid sequences of human (h) OC-2, human HNF-6, C. elegans (ce) ORF R07D10.x, and human ORFs found in cosmid F21967 and fosmid F37502. Residues identical to those in OC-2 are on a black background; similar residues are indicated by gray shading. Boxed sequences correspond to regions whose structures predicted by the Match-Box algorithm are similar among all the sequences listed.Asterisks point to Phe-48 and Met-50 of the homeodomain.View Large Image Figure ViewerDownload (PPT) The chromosomal location of the human OC-2 gene was characterized by radiation hybrid mapping using the GeneBridge 4 Radiation Hybrid panel (Research Genetics). This panel of 93 human × hamster somatic cell hybrids was screened by PCR (35 cycles at 94 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min) with primers FM2.1 and FM2.2A in 50-μl incubations and visualized on an ethidium bromide-stained agarose gel. The data were analyzed using the Whitehead Institute/Massachusetts Institute of Technology Center for Genome Research radiation hybrid map. 3http://www-genome.wi.mit.edu/cgi-bin/contig/rhmapper.pl. To determine the tissue distribution ofOC-2 mRNA, RT-PCR was performed (GeneAmp kit, Perkin-Elmer) with 500 ng of total RNA isolated from human tissues. The integrity of the RNA preparations was tested by amplification of a 610-bp-long β-actin cDNA fragment with primers bACT5 and bACT3.OC-2 cDNA (193-bp-long fragment) was amplified with primers FM2.1 and FM2.2. HNF-6 cDNA (387-bp-long fragment) was amplified with primers HNF6.5 and HNF6.6. Primers FM2.2 and HNF6.6 were used in the reverse transcription step. The specificity of the amplified products was verified in Southern blotting experiments as described (20Jacquemin P. Martial J.A. Davidson I. J. Biol. Chem. 1997; 272: 12928-12937Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) using, as 32P-labeled probes, PCR fragments obtained with primers HOM1 and HOM2 for the identification ofOC-2 products and with primers HNF6.3 and HNF6.4 for the identification of HNF-6 products. The expression vector pCMV-HNF6α contains anAccI-EcoRI fragment of the HNF-6αcDNA, derived from pSP-HNF6α (9Lemaigre F.P. Durviaux S.M. Truong O. Lannoy V.J. Hsuan J.J. Rousseau G.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9460-9464Crossref PubMed Scopus (133) Google Scholar), cloned downstream of a cytomegalovirus promoter. pECE-HNF6α has been described (9Lemaigre F.P. Durviaux S.M. Truong O. Lannoy V.J. Hsuan J.J. Rousseau G.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9460-9464Crossref PubMed Scopus (133) Google Scholar). pXJ42-OC2 contains a fully coding human OC-2 cDNA cloned in the XhoI and EcoRI sites of pXJ42 (21Xiao J.H. Davidson I. Matthes H. Garnier J.-M. Chambon P. Cell. 1991; 65: 551-568Abstract Full Text PDF PubMed Scopus (306) Google Scholar). The pHNF6/HNF3β(6×)-TATA-luc, pHNF3β-luc, pHNF3βmut-luc, and pHNF4-0.7-luc reporter vectors have been described (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 22Landry C. Clotman F. Hioki T. Oda H. Picard J.J. Lemaigre F.P. Rousseau G.G. Dev. Biol. 1997; 15: 247-257Crossref Scopus (141) Google Scholar, 23Rausa F. Samadani U. Ye H. Lim L. Fletcher C.F. Jenkins N.A. Copeland N.G. Costa R.H. Dev. Biol. 1997; 192: 228-246Crossref PubMed Scopus (160) Google Scholar). The internal control vector pRL138 contains the pfk-2 promoter (−138 to +86) cloned in pRLnull (Promega). Rat hepatoma FTO-2B cells were grown in Dulbecco's modified Eagle's medium/Ham's F-12 medium supplemented with 10% fetal calf serum. Cells (1 × 105 cells/well on 24-well plates) were transfected in medium without fetal calf serum by lipofection using LipofectAMINE PLUS (Life Technologies, Inc.), 400 ng of reporter construct (pHNF6/HNF3β(6×)-TATA-luc, pHNF3β-luc, pHNF3βmut-luc, or pHNF4-0.7-luc), 15 ng of pCMV-HNF6α or 15 ng of pXJ42-OC2; and 15 ng of pRL138 as internal control. After 6 h, the cells were washed with phosphate-buffered saline and further incubated for 45 h in Dulbecco's modified Eagle's medium/Ham's F-12 medium plus 10% fetal calf serum before measuring luciferase activities with the Dual-Luciferase kit (Promega). Luciferase activities were measured with a Lumac luminometer and expressed as the ratio of reporter activity (firefly luciferase) to internal control activity (Renillaluciferase). COS-7 cells (1.5 × 105 cells/6-cm dish) were transfected in Dulbecco's modified Eagle's medium without fetal calf serum by lipofection usingN-[1-(2,3-dioleoyloxy)propyl]-N,N,N-triethylammonium methyl sulfate (Boehringer Mannheim) and 5 μg of expression vector (pECE-HNF6α or pXJ42-OC2). Forty-eight h after transfection, the cells were washed with phosphate-buffered saline and harvested in 1 ml of 40 mm Tris-Cl (pH 7.5), 1 mm EDTA, and 150 mm NaCl. The cells were pelleted and resuspended in 60 μl of 50 mm Tris-Cl (pH 7.9), 500 mm KCl, 0.5 mm EDTA, 2.5 μg/ml leupeptin, 1 mmdithiothreitol, 0.1% (v/v) Nonidet P-40, 1 mmphenylmethylsulfonyl fluoride, and 20% (v/v) glycerol. After three freeze-thaw cycles, the lysates were centrifuged, and the supernatants were collected. COS-7 cell lysates (5 μl) were incubated on ice for 20 min in a final volume of 20 μl containing 10 mm HEPES (pH 7.6), 1 mmdithiothreitol, 1 mm MgCl2, 0.5 mmEGTA, 50 mm KCl, 10% (v/v) glycerol, 4 μg of poly(dI-dC), and the 32P-labeled probe (30,000 cpm). The samples were loaded on a 7% acrylamide gel (29:1 acrylamide/bisacrylamide ratio) in 0.25× Tris borate/EDTA buffer and electrophoresed at 200 V. During a search for HNF-6-related proteins in GenBankTM using the Basic Local Alignment Search Tool (BLAST) (24Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (73298) Google Scholar), we found an expressed sequence tag (GenBankTM accession number AA121823) from a fetal human retina cDNA library that contains a partial cDNA showing significant similarity to the HNF-6 homeobox. Two primers (FM2.1 and FM2.2; see "Experimental Procedures") whose sequences were based on the expressed sequence tag were used to screen, by PCR, two cDNA libraries, one from adult human retina and one from HeLa cells. Identical 193-bp-long bands were seen with the two libraries, yielding a probe that was used to screen the HeLa cell cDNA library by phage plaque hybridization. Six independent clones were obtained. All these clones lacked the 5′-end of the coding sequence, but contained nearly identical 5′-extremities. This probably reflects the presence of secondary structures in the mRNA that blocked reverse transcription during the preparation of the library. Rapid amplification of cDNA ends/PCR failed to amplify the missing portion, which turned out to be GC-rich (see below and Fig.1 A). To clone the 5′-end, we therefore screened a human genomic DNA library with a probe encompassing nucleotides 1027–1214 (Fig. 1 A). An additional 5′-sequence was obtained (nucleotides 1–585 in Fig. 1 A), and RT-PCR with high processivity polymerase on total RNA from human liver and skin confirmed that this sequence is expressed as mRNA. The fully coding cDNA and the derived 485-amino acid-long sequence are shown in Fig. 1 A. The ATG codon at nucleotides 88–90 lies within a perfect Kozak consensus sequence, strongly suggesting that it codes for the initiator methionine. Sequence comparisons showed the presence of a single cut domain (residues 314–379) and a homeodomain (residues 407–466). The homeodomain was typical of the ONECUT class, with a phenylalanine at position 48 and a methionine at position 50. We therefore named the novel protein OC-2 (forONECUT-2). Fig. 1 B shows an alignment of the amino acid sequences of OC-2 and HNF-6. This alignment shows that the sequences of the cut domain and homeodomain of OC-2 are 97 and 87% identical to those of HNF-6, respectively, and that HNF-6 and OC-2 display 92% amino acid sequence identity over the 157 residues (boxed in Fig.1 B) that encompass the entire DNA-binding region. There are additional regions of similarity between OC-2 and HNF-6 (Fig.1 B), such as a serine-rich tail of 19 residues in OC-2 and of 21 residues in HNF-6. The linker between the cut domain and homeodomain has the same length (27 residues) in OC-2 and HNF-6α, and the amino acid sequence of this linker is quasi-identical (83%) in both proteins. A search by RT-PCR with RNA from tissues expressingOC-2 (see below) and primers located in the cut domain and homeodomain failed to provide evidence for an OC-2 isoform containing an alternatively spliced insert between these domains, as is the case for HNF-6β (data not shown). As in HNF-6, a polyhistidine tract occurs in OC-2 at about the same distance upstream of the cut domain. A sequence of 14 consecutive glycines (residues 22–35) is present in OC-2. Such stretches of identical amino acids have been found in many homeodomain proteins (25Bürglin T.R. Duboule D. Guidebook to the Homeobox Genes. Oxford University Press, Oxford1994: 25-71Google Scholar) and may be functionally important. Indeed, alterations of a polyalanine stretch in the HOXD13 protein causes polydactyly (26Muragaki Y. Mundlos S. Upton J. Olsen B.R. Science. 1996; 272: 548-551Crossref PubMed Scopus (493) Google Scholar). Yet another conserved region (92% identity between OC-2 and HNF-6) is a serine/threonine- and proline-rich sequence (STP box) of 24 residues located just upstream of the polyhistidine tract. Our experiments on HNF-6α suggest that this STP box plays a role in transcriptional activation. 4V. J. Lannoy, G. G. Rousseau, and F. P. Lemaigre, manuscript in preparation. Fig. 1 B also shows an alignment of the amino acid sequences of OC-2 and HNF-6α with that of the C. elegans ONECUT gene product closest to these mammalian proteins, namely R07D10.x (an ORF found on cosmid C17H12). One sees that not only the homeodomain and the cut domain, but also the STP box, have been conserved in the ONECUT class since the nematodes. Recent data bank searches showed that the human genome contains sequences that code for additional putative ONECUT proteins very similar to HNF-6 and OC-2. The amino acid sequences of two ORFs, one present in fosmid F37502 (GenBankTM accession numberAC004755) and one present in cosmid F21967 (GenBankTMaccession number AC005256), are shown in Fig. 1 B. Fosmid F37502 and cosmid F21967 contain sequences present on the same chromosome (human chromosome 19) and separated by a 1-kilobase pair gap. The distance between the two ORFs shown in Fig. 1 B is 19 kilobase pairs. The ORF of fosmid F37502 contains a typical ONECUT homeodomain with a phenylalanine at position 48 and a methionine at position 50. The ORF of cosmid F21967 contains a cut domain that is quasi-identical to those of the bona fide ONECUT proteins. It also contains an STP box and a polyglycine stretch. It could be that cosmid F21967 and fosmid F37502 each contain one-half of a singleONECUT gene whose organization resembles that of thehnf-6 gene, namely with a very long intronic region between the cut domain and homeodomain (17Rastegar M. Szpirer C. Rousseau G.G. Lemaigre F.P. Biochem. J. 1998; 334: 565-569Crossref PubMed Scopus (24) Google Scholar). In this case, the two corresponding ORFs shown in Fig. 1 B would belong to two parts of the same OC-3 protein. If these ORFs do not correspond to pseudogenes and if these ORFs are expressed as peptides, these peptides very likely correspond to ONECUT protein(s) different from HNF-6 and OC-2. The chromosomal localization of OC-2 in humans was determined by radiation hybrid mapping. PCR amplifications were performed, and the data were analyzed as indicated under "Experimental Procedures." This showed that theOC-2 gene is located on chromosome 18, 10.31 cR3000 telomeric from marker WI-8740 and 9.2 cR3000 centromeric from marker CHLC.GATA30B03 (lod score > 3.0). Human HNF-6 is located on chromosome 15q21.1-21.2 (27Vaisse C. Kim J. Espinosa III., R. Le Beau M.M. Stoffel M. Diabetes. 1997; 46: 1364-1367Crossref PubMed Scopus (31) Google Scholar), 5A. M. Møller, J. Ek, S. M. Durviaux, S. A. Urhammer, J. O. Clausen, H. Eiberg, T. Hansen, G. G. Rousseau, F. P. Lemaigre, and O. Pedersen, submitted for publication. and, as said above, the putative human OC-3 gene is located on chromosome 19. These data show that in humans, the genes coding for the homeodomain proteins of the ONECUT class are not located in a cluster. Like OC-2, marker D18S69 is located between markers WI-8740 and CHLC.GATA30B03. Since D18S69 is cytogenetically located at 18q21.1-18q21.2 (28Papadimitrakopoulou V.A. Oh Y. El-Naggar A. Izzo J. Clayman G. Mao L. Clin. Cancer Res. 1998; 4: 539-544PubMed Google Scholar), we conclude that OC-2 is most probably also located cytogenetically at 18q21.1-18q21.2. Deletions encompassing 18q21.1-21.3 are associated with retinal cone-rod dystrophy (CORD)-1 (29Warburg M. Sjö O. Tranebjaerg L. Fledelius H. Am. J. Med. Genet. 1991; 39: 288-293Crossref PubMed Scopus (52) Google Scholar). Considering that OC-2 is expressed in the retina (see "Cloning of OC-2 cDNA," above) and that the loss of the homeodomain-containing transcription factor CRX causes the related syndrome CORD2 (30Furukawa T. Morrow E.M. Cepko C.L. Cell. 1997; 91: 531-541Abstract Full Text Full Text PDF PubMed Scopus (734) Google Scholar, 31Freund C.L. Gregory-Evans C.Y. Furukawa T. Papaioannou M. Looser J. Ploder L. Bellingham J. Ng D. Herbrick J.-A.S. Duncan A. Scherer S.W. Tsui L.-C. Loutradis-Anagnostou A. Jacobson S.G. Cepko C.L. Bhattacharya S.S. McInnes R.R. Cell. 1997; 91: 543-553Abstract Full Text Full Text PDF PubMed Scopus (468) Google Scholar), further work should identify the retinal cell types expressing OC-2 and the possible association between CORD1 and OC-2 dysfunctions. To determine the tissue distribution of OC-2, we screened, by RT-PCR, 12 human tissues for expression of its mRNA. The tissue distribution ofHNF-6 mRNA, not yet studied in humans, was analyzed in parallel. The PCR products were subjected to Southern blot analysis using overlapping radioactive PCR probes. As a control, β-actin mRNA was amplified from the same RNA preparations. The data (Fig.2) show that OC-2 mRNA is abundant in the liver and skin. Lower amounts were found in the testis, brain (occipital cortex), and urinary bladder. The kidney yielded a very weak signal. The expression of HNF-6 mRNA was strongest in the liver and clearly detectable in the testis and skin. We conclude that OC-2 has a tissue-restricted pattern of expression that differs from, but overlaps with, that of HNF-6. The remarkable amino acid sequence similarity of the two DNA-binding domains of OC-2 and HNF-6α and of the linker region between these domains suggested that the two proteins display similar DNA binding specificities. HNF-6 binds to two types of sequences. Binding to the first type, exemplified by a probe derived from the transthyretin gene (TTR probe), requires both the cut domain and homeodomain of HNF-6. Binding to the second type of sequence, exemplified by a probe derived from the hnf-3βgene (HNF-3β probe), requires only the cut domain of HNF-6 (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). We therefore tested, by electrophoretic mobility shift assay, whether OC-2 binds to these two probes. This was the case (Fig.3, lanes 3 and8 versus lanes 1 and 6). Binding of OC-2 was specific as shown in incubations containing an excess of unlabeled probe (Fig. 3, lanes 4 and9). Cross-competitions suggested that OC-2 binds with higher affinity to the HNF-3β probe than to the TTR probe (Fig. 3,lanes 5 and 10). In contrast, HNF-6α bound equally well to the two probes, as shown in Fig. 3(lanes 2 and 7) and by our earlier results (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). HNF-6 regulates the transcription of genes involved in glucose metabolism (9Lemaigre F.P. Durviaux S.M. Truong O. Lannoy V.J. Hsuan J.J. Rousseau G.G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9460-9464Crossref PubMed Scopus (133) Google Scholar, 32Samadani U. Costa R.H. Mol. Cell. Biol. 1996; 16: 6273-6284Crossref PubMed Scopus (132) Google Scholar). 6C. Pierreux, J. Stafford, D. Demonte, D. K. Scott, J. Vandenhaute, R .M. O'Brien, D. K. Granner, G. G. Rousseau, and F. P. Lemaigre, submitted for publication. As shown in Fig. 3 (lanes 14–19), we found that OC-2 and HNF-6α bind to the same cis-acting sequences in thepepck (PEPCK probe) and pfk-2 (GRU probe) genes. Like HNF-6, OC-2 is therefore expected to play a role in the regulation of liver gluconeogenesis and glycolysis. Experiments on dedifferentiated hepatoma lines and on embryoid bodies provided evidence for a network of liver-enriched transcription factors that is required for hepatocyte differentiation and morphogenesis (33Kuo C.J. Conley P.B. Chen L. Sladek F.M. Darnell Jr., J.E. Crabtree G.R. Nature. 1992; 355: 457-461Crossref PubMed Scopus (371) Google Scholar, 34Bulla G.A. Fournier R.E. Mol. Cell. Biol. 1994; 14: 7086-7094Crossref PubMed Scopus (36) Google Scholar, 35Cereghini S. FASEB J. 1996; 10: 267-282Crossref PubMed Scopus (479) Google Scholar, 36Späth G.F. Weiss M.C. Mol. Cell. Biol. 1997; 17: 1913-1922Crossref PubMed Scopus (105) Google Scholar, 37Späth G. Weiss M.C. J. Cell Biol. 1998; 140: 935-946Crossref PubMed Scopus (134) Google Scholar, 38Duncan S.A. Navas A.M. Dufort D. Rossant J. Stoffel M. Science. 1998; 281: 692-695Crossref PubMed Scopus (300) Google Scholar). HNF-3β is an essential component of this network. It stimulates expression of hnf-4. On the other hand, HNF-4 activates transcription of the hnf-1 gene. Our earlier experiments indicated that HNF-6 binds to, and controls the expression of, the hnf-3β and hnf-4 genes (22Landry C. Clotman F. Hioki T. Oda H. Picard J.J. Lemaigre F.P. Rousseau G.G. Dev. Biol. 1997; 15: 247-257Crossref Scopus (141) Google Scholar). We therefore determined whether OC-2 binds to the same sites as HNF-6 in these two genes. While OC-2 bound to the same HNF-3β probe as HNF-6 (see above), OC-2 did not bind to the HNF-6-binding site derived from the hnf-4 gene promoter (HNF-4 probe) (Fig. 3,lanes 11–13). The discrimination of OC-2 between the HNF-3β and HNF-4 probes is similar to that described earlier for HNF-6β (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). However, OC-2 binds to a probe (PEPCK) to which HNF-6β binds very poorly. Therefore, OC-2 has a DNA binding specificity that differs from, but overlaps with, that of HNF-6α and HNF-6β (TableI).Table IDNA binding specificity of OC-2, HNF-6α, and HNF-6βTarget geneSite sequenceTranscription factor bindingOC-2HNF-6αHNF-6βhnf-3β−121GAAAAAAAAATCAATATCGGGCCT−144+++++++hnf-4−394AGGATAGAAGTCAATGATCTGGGA−371−++/−Transthyretin−110GTCTGCTAAGTCAATAATCAGAAT−87+++++pepck−263CAAAGTTTAGTCAATCAAACGTTG−240+++/−pfk-2GRU(1st intron) AACAAAAAAAATCCATAACTTTCA++++++The underlined sequences correspond to the HNF-6-binding site consensus sequence (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Open table in a new tab The underlined sequences correspond to the HNF-6-binding site consensus sequence (8Lannoy V.J. Bürglin T.R. Rousseau G.G. Lemaigre F.P. J. Biol. Chem. 1998; 273: 13552-13562Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). To study if OC-2 may be involved in the network of liver transcription factors by controlling transcription of the hnf-3β gene, rat hepatoma FTO-2B cells were cotransfected with an OC-2 expression vector and a construct containing the luciferase reporter under the control of six copies of the HNF-6/OC-2 site found in thehnf-3β gene. Cells similarly transfected, but with HNF-6α instead of OC-2, were examined in parallel. As shown in Fig.4 A, OC-2 stimulated the reporter construct 50-fold and was as effective as HNF-6α. To compare the activities of HNF-6α and OC-2 on the wild-typehnf-3β promoter, we cotransfected, in FTO-2B cells, their expression vectors with a reporter construct containing thehnf-3β gene promoter (pHNF3β-luc) or the same promoter in which the HNF-6/OC-2 site has been destroyed by mutation (pHNF3βmut-luc). Fig. 4 B shows that overexpression of OC-2 or HNF-6α stimulated transcription from the wild-type promoter 2–3-fold, but was without effect on the mutated promoter. Consistent with earlier results (22Landry C. Clotman F. Hioki T. Oda H. Picard J.J. Lemaigre F.P. Rousseau G.G. Dev. Biol. 1997; 15: 247-257Crossref Scopus (141) Google Scholar), the mutated promoter displayed a 50% reduction in basal activity compared with the wild-type promoter, probably as a result of the loss of action of endogenous ONECUT transcription factors. Finally, as expected from the lack of binding of OC-2 to the probe derived from the hnf-4 gene (Fig. 3), overexpression of OC-2 did not activate the hnf-4 promoter (pHNF4-0.7-luc) (Fig. 4 B) in transfection experiments, whereas HNF-6α did. We conclude from these transfection experiments that OC-2 stimulates transcription of the hnf-3β gene. Both HNF-6 and OC-2 might therefore be key players in the network of liver transcription factors by controlling a different set of genes. Human OC-2 is a mammalian member of the ONECUT class of homeodomain transcription factors whose sequence is very similar to that of HNF-6. On the basis of their respective tissue distribution, DNA binding specificities, and transcriptional activation properties, HNF-6 and OC-2 have different but overlapping functions. The expression of OC-2 in the retina and its chromosomal localization raise the question of the involvement of OC-2 in CORD1. In liver, OC-2 is expected to participate in the network of transcription factors that regulates differentiation and morphogenesis.