Dynamic O-GlcNAc Modification of Nucleocytoplasmic Proteins in Response to Stress
2004; Elsevier BV; Volume: 279; Issue: 29 Linguagem: Inglês
10.1074/jbc.m403773200
ISSN1083-351X
AutoresNatasha E. Zachara, Niall O'Donnell, Win D. Cheung, Jessica J. Mercer, Jamey D. Marth, Gerald W. Hart,
Tópico(s)RNA and protein synthesis mechanisms
ResumoCellular response to environmental, physiological, or chemical stress is key to survival following injury or disease. Here we describe a unique signaling mechanism by which cells detect and respond to stress in order to survive. A wide variety of stress stimuli rapidly increase nucleocytoplasmic protein modification by O-linked β-N-acetylglucosamine (O-GlcNAc), an essential post-translational modification of Ser and Thr residues of metazoans. Blocking this post-translational modification, or reducing it, renders cells more sensitive to stress and results in decreased cell survival; and increasing O-GlcNAc levels protects cells. O-GlcNAc regulates both the rates and extent of the stress-induced induction of heat shock proteins, providing a molecular basis for these findings. Cellular response to environmental, physiological, or chemical stress is key to survival following injury or disease. Here we describe a unique signaling mechanism by which cells detect and respond to stress in order to survive. A wide variety of stress stimuli rapidly increase nucleocytoplasmic protein modification by O-linked β-N-acetylglucosamine (O-GlcNAc), an essential post-translational modification of Ser and Thr residues of metazoans. Blocking this post-translational modification, or reducing it, renders cells more sensitive to stress and results in decreased cell survival; and increasing O-GlcNAc levels protects cells. O-GlcNAc regulates both the rates and extent of the stress-induced induction of heat shock proteins, providing a molecular basis for these findings. Key metabolic proteins in the nucleus and cytoplasm of metazoans are dynamically modified by monosaccharides of O-linked β-N-acetylglucosamine (O-GlcNAc) 1The abbreviations used are: O-GlcNAc, monosaccharides of O-linked β-N-acetylglucosamine; CHO, Chinese hamster ovary; Me2SO, dimethyl sulfoxide; DON, 6-diazo-5-oxonorleucine; HEK293, human embryonic kidney 293; FBS, fetal bovine serum; HCAEC, human coronary artery endothelial cells; HSF1, heat shock factor 1; HSP, heat shock protein; Neuro-2A, neuroblastoma 2A cells; MEFs, mouse embryonic fibroblasts; O-GlcNAcase, O-GlcNAc hexosaminidase (EC 3.2.1.52); OGT, UDP-GlcNAc, polypeptide O-β-N-acetylglucosaminyltransferase (EC 2.4.1.94); PBS, phosphate-buffered saline; PUGNAc, O-(2-acetamido-2-deoxy-d-glucopyranosylidene) amino-N-phenylcarbamate; RNAi, RNA interference; DMEM, Dulbecco's modified Eagle's medium; HSP, heat shock protein; OGT, O-β-N-acetylglucosaminyltransferase; ALLN, N-acetyl-l-leucyl-l-leucyl-l-norleucinal. (1Wells L. Vosseller K. Hart G.W. Science. 2001; 291: 2376-2378Crossref PubMed Scopus (805) Google Scholar). O-GlcNAc is thought to act as a modulator of protein function, in a manner analogous to protein phosphorylation; the addition of O-GlcNAc to the protein backbone is dynamic and responds to morphogens, the cell cycle, and changes in glucose metabolism (1Wells L. Vosseller K. Hart G.W. Science. 2001; 291: 2376-2378Crossref PubMed Scopus (805) Google Scholar). The mechanisms by which O-GlcNAc act are complex, and changes in O-GlcNAc levels have been shown to alter the behavior of specific proteins by modulating the following: 1) the half-life and proteolytic processing of proteins (2Chakraborty A. Saha D. Bose A. Hileman R.E. Chatterjee M. Gupta N.K. Indian J. Biochem. Biophys. 1994; 31: 236-242PubMed Google Scholar, 3Datta B. Ray M.K. Chakrabarti D. Wylie D.E. Gupta N.K. J. Biol. Chem. 1989; 264: 20620-20624Abstract Full Text PDF PubMed Google Scholar, 4Ray M.K. Datta B. Chakraborty A. Chattopadhyay A. Meza-Keuthen S. Gupta N.K. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 539-543Crossref PubMed Scopus (87) Google Scholar, 5Han I. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 2550-2558Crossref PubMed Scopus (377) Google Scholar, 6Han I. Roos M.D. Kudlow J.E. J. Cell. Biochem. 1998; 68: 50-61Crossref PubMed Scopus (35) Google Scholar, 7Cheng X. Cole R.N. Zaia J. Hart G.W. Biochemistry. 2000; 39: 11609-11620Crossref PubMed Scopus (152) Google Scholar); 2) subcellular localization (8Duverger E. Carpentier V. Roche A.C. Monsigny M. Exp. Cell Res. 1993; 207: 197-201Crossref PubMed Scopus (63) Google Scholar, 9Duverger E. Pellerin-Mendes C. Mayer R. Roche A.C. Monsigny M. J. Cell Sci. 1995; 108: 1325-1332Crossref PubMed Google Scholar, 10Duverger E. Roche A.C. Monsigny M. Glycobiology. 1996; 6: 381-386Crossref PubMed Scopus (49) Google Scholar, 11Monsigny M. Midoux P. Mayer R. Roche A.C. Biosci. Rep. 1999; 19: 125-132Crossref PubMed Scopus (46) Google Scholar, 12Soulard M. Della Valle V. Siomi M.C. Pinol-Roma S. Codogno P. Bauvy C. Bellini M. Lacroix J.C. Monod G. Dreyfuss G. Larsen C.J. Nucleic Acids Res. 1993; 21: 4210-4217Crossref PubMed Scopus (132) Google Scholar, 13Bachmann M. Pfeifer K. Schroder H.C. Muller W.E. Mol. Cell. Biochem. 1989; 85: 103-114Crossref PubMed Scopus (70) Google Scholar, 14Juang Y.T. Solomou E.E. Rellahan B. Tsokos G.C. J. Immunol. 2002; 168: 2865-2871Crossref PubMed Scopus (72) Google Scholar); 3) protein-protein interactions (6Han I. Roos M.D. Kudlow J.E. J. Cell. Biochem. 1998; 68: 50-61Crossref PubMed Scopus (35) Google Scholar, 15Roos M.D. Su K. Baker J.R. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 6472-6480Crossref PubMed Scopus (198) Google Scholar, 16Yang X. Su K. Roos M.D. Chang Q. Paterson A.J. Kudlow J.E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6611-6616Crossref PubMed Scopus (235) Google Scholar); 4) DNA binding (17Gao Y. Miyazaki J. Hart G.W. Arch. Biochem. Biophys. 2003; 415: 155-163Crossref PubMed Scopus (136) Google Scholar); and 5) enzyme activity or regulation (18Du X.L. Edelstein D. Dimmeler S. Ju Q. Sui C. Brownlee M. J. Clin. Investig. 2001; 108: 1341-1348Crossref PubMed Scopus (723) Google Scholar, 19Federici M. Menghini R. Mauriello A. Hribal M.L. Ferrelli F. Lauro D. Sbraccia P. Spagnoli L.G. Sesti G. Lauro R. Circulation. 2002; 106: 466-472Crossref PubMed Scopus (290) Google Scholar, 20Parker G.J. Lund K.C. Taylor R.P. McClain D.A. J. Biol. Chem. 2003; 278: 10022-10027Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). One mechanism by which O-GlcNAc may mediate these events is by altering protein phosphorylation. Notably, phosphorylation and O-GlcNAc are reciprocal on some well studied proteins, which include the C-terminal domain of the large subunit of RNA polymerase (21Kelly W.G. Dahmus M.E. Hart G.W. J. Biol. Chem. 1993; 268: 10416-10424Abstract Full Text PDF PubMed Google Scholar, 22Comer F.I. Hart G.W. Biochemistry. 2001; 40: 7845-7852Crossref PubMed Scopus (237) Google Scholar), the c-myc protooncogene (23Chou T.Y. Dang C.V. Hart G.W. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4417-4421Crossref PubMed Scopus (184) Google Scholar, 24Chou T.Y. Hart G.W. Dang C.V. J. Biol. Chem. 1995; 270: 18961-18965Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 25Kamemura K. Hayes B.K. Comer F.I. Hart G.W. J. Biol. Chem. 2002; 277: 19229-19235Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar), SV40 large T-antigen (26Medina L. Grove K. Haltiwanger R.S. Glycobiology. 1998; 8: 383-391Crossref PubMed Scopus (64) Google Scholar), estrogen receptor-β (7Cheng X. Cole R.N. Zaia J. Hart G.W. Biochemistry. 2000; 39: 11609-11620Crossref PubMed Scopus (152) Google Scholar), and endothelial nitric-oxide synthase (18Du X.L. Edelstein D. Dimmeler S. Ju Q. Sui C. Brownlee M. J. Clin. Investig. 2001; 108: 1341-1348Crossref PubMed Scopus (723) Google Scholar). These observations suggest that O-GlcNAc and phosphorylation may modulate each other (27Hart G.W. Greis K.D. Dong L.Y. Blomberg M.A. Chou T.Y. Jiang M.S. Roquemore E.P. Snow D.M. Kreppel L.K. Cole R.N. Comer F.I. Arnold S.I. Hayes B.K. Adv. Exp. Med. Biol. 1995; 376: 115-123Crossref PubMed Scopus (121) Google Scholar, 28Hart G.W. Kreppel L.K. Comer F.I. Arnold C.S. Snow D.M. Ye Z. Cheng X. DellaManna D. Caine D.S. Earles B.J. Akimoto Y. Cole R.N. Hayes B.K. Glycobiology. 1996; 6: 711-716Crossref PubMed Scopus (126) Google Scholar, 29Comer F.I. Hart G.W. J. Biol. Chem. 2000; 275: 29179-29182Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar). Increasing extracellular glucose concentrations affects the functioning of key cellular proteins in an O-GlcNAc-dependent manner, including endothelial nitric-oxide synthase (18Du X.L. Edelstein D. Dimmeler S. Ju Q. Sui C. Brownlee M. J. Clin. Investig. 2001; 108: 1341-1348Crossref PubMed Scopus (723) Google Scholar), mSin3a (30Yang X. Zhang F. Kudlow J.E. Cell. 2002; 110: 69-80Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar), the transcription factors, YY1 (31Hiromura M. Choi C.H. Sabourin N.A. Jones H. Bachvarov D. Usheva A. J. Biol. Chem. 2003; 278: 14046-14052Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), Sp1 (5Han I. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 2550-2558Crossref PubMed Scopus (377) Google Scholar, 32Goldberg H.J. Whiteside C.I. Fantus I.G. J. Biol. Chem. 2002; 277: 33833-33841Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 33Jackson S.P. Tjian R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1781-1785Crossref PubMed Scopus (141) Google Scholar, 34Jackson S.P. Tjian R. Cell. 1988; 55: 125-133Abstract Full Text PDF PubMed Scopus (649) Google Scholar), CREB (35Lamarre-Vincent N. Hsieh-Wilson L.C. J. Am. Chem. Soc. 2003; 125: 6612-6613Crossref PubMed Scopus (92) Google Scholar), and the 26 S proteosomal complex (36Sumegi M. Hunyadi-Gulyas E. Medzihradszky K.F. Udvardy A. Biochem. Biophys. Res. Commun. 2003; 312: 1284-1289Crossref PubMed Scopus (76) Google Scholar, 37Zhang F. Su K. Yang X. Bowe D.B. Paterson A.J. Kudlow J.E. Cell. 2003; 115: 715-725Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar). UDP-GlcNAc:polypeptide O-β-N-acetylglucosaminyltransferase (OGT; EC 2.4.1.94), the enzyme that adds O-GlcNAc, is responsive across the physiological range of UDP-GlcNAc. Moreover, the substrate specificity of OGT changes at different UDP-GlcNAc concentrations (38Kreppel L.K. Hart G.W. J. Biol. Chem. 1999; 274: 32015-32022Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar). Both in vitro and in vivo data support a model where increased UDP-GlcNAc levels, due to hyperglycemia, result in increased O-GlcNAc levels, leading to insulin resistance, a hallmark of type II diabetes (1Wells L. Vosseller K. Hart G.W. Science. 2001; 291: 2376-2378Crossref PubMed Scopus (805) Google Scholar, 39McClain D.A. Lubas W.A. Cooksey R.C. Hazel M. Parker G.J. Love D.C. Hanover J.A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 10695-10699Crossref PubMed Scopus (274) Google Scholar). These data and others have led researchers to propose that O-GlcNAc is a nutritional sensor (1Wells L. Vosseller K. Hart G.W. Science. 2001; 291: 2376-2378Crossref PubMed Scopus (805) Google Scholar, 39McClain D.A. Lubas W.A. Cooksey R.C. Hazel M. Parker G.J. Love D.C. Hanover J.A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 10695-10699Crossref PubMed Scopus (274) Google Scholar, 40Vosseller K. Wells L. Lane M.D. Hart G.W. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5313-5318Crossref PubMed Scopus (393) Google Scholar, 41Buse M.G. Robinson K.A. Marshall B.A. Hresko R.C. Mueckler M.M. Am. J. Physiol. 2002; 283: E241-E250Crossref PubMed Scopus (90) Google Scholar). In response to multiple forms of stress, cells rapidly increase glucose uptake. The ability of cells to transport glucose has been linked to the capacity of cells to respond and survive deleterious cellular conditions (42Pasternak C.A. Aiyathurai J.E. Makinde V. Davies A. Baldwin S.A. Konieczko E.M. Widnell C.C. J. Cell. Physiol. 1991; 149: 324-331Crossref PubMed Scopus (54) Google Scholar, 43Sviderskaya E.V. Jazrawi E. Baldwin S.A. Widnell C.C. Pasternak C.A. J. Membr. Biol. 1996; 149: 133-140Crossref PubMed Scopus (34) Google Scholar, 44Warren A.P. James M.H. Menzies D.E. Widnell C.C. Whitaker-Dowling P.A. Pasternak C.A. J. Cell. Physiol. 1986; 128: 383-388Crossref PubMed Scopus (30) Google Scholar, 45Widnell C.C. Baldwin S.A. Davies A. Martin S. Pasternak C.A. FASEB J. 1990; 4: 1634-1637Crossref PubMed Scopus (71) Google Scholar, 46Ikari A. Nakano M. Kawano K. Suketa Y. J. Biol. Chem. 2002; 277: 33338-33343Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar, 47Barnes K. Ingram J.C. Porras O.H. Barros L.F. Hudson E.R. Fryer L.G. Foufelle F. Carling D. Hardie D.G. Baldwin S.A. J. Cell Sci. 2002; 115: 2433-2442Crossref PubMed Google Scholar, 48Moley K.H. Mueckler M.M. Apoptosis. 2000; 5: 99-105Crossref PubMed Scopus (138) Google Scholar, 49Hall J.L. Matter C.M. Wang X. Gibbons G.H. Circ. Res. 2000; 87: 574-580Crossref PubMed Scopus (80) Google Scholar, 50Lin Z. Weinberg J.M. Malhotra R. Merritt S.E. Holzman L.B. Brosius III, F.C. Am. J. Physiol. 2000; 278: E958-E966Crossref PubMed Google Scholar, 51Malhotra R. Brosius III, F.C. J. Biol. Chem. 1999; 274: 12567-12575Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 52Dwyer D.S. Liu Y. Bradley R.J. J. Cell. Physiol. 1999; 178: 93-101Crossref PubMed Scopus (25) Google Scholar, 53Fiorentini D. Hakim G. Bonsi L. Bagnara G.P. Maraldi T. Landi L. Free Radic. Biol. Med. 2001; 31: 923-931Crossref PubMed Scopus (28) Google Scholar, 54Kozlovsky N. Rudich A. Potashnik R. Ebina Y. Murakami T. Bashan N. J. Biol. Chem. 1997; 272: 33367-33372Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 55Barros L.F. Barnes K. Ingram J.C. Castro J. Porras O.H. Baldwin S.A. Pfluegers Arch. 2001; 442: 614-621Crossref PubMed Scopus (49) Google Scholar, 56Zhang J.Z. Behrooz A. Ismail-Beigi F. Am. J. Kidney Dis. 1999; 34: 189-202Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). In many studies, blocking both glycolysis (48Moley K.H. Mueckler M.M. Apoptosis. 2000; 5: 99-105Crossref PubMed Scopus (138) Google Scholar, 51Malhotra R. Brosius III, F.C. J. Biol. Chem. 1999; 274: 12567-12575Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 57Kan O. Baldwin S.A. Whetton A.D. J. Exp. Med. 1994; 180: 917-923Crossref PubMed Scopus (112) Google Scholar) and the hexosamine biosynthetic pathway (58Liu W. Schoenkerman A. Lowe Jr., W.L. Am. J. Physiol. 2000; 279: E782-E790Crossref PubMed Google Scholar, 59Pang Y. Hunton D.L. Bounelis P. Marchase R.B. Diabetes. 2002; 51: 3461-3467Crossref PubMed Scopus (105) Google Scholar, 60Rivera A.A. White C.R. Guest L.L. Elton T.S. Marchase R.B. Am. J. Physiol. 1995; 269: C1482-C1488Crossref PubMed Google Scholar, 61Vemuri S. Marchase R.B. J. Biol. Chem. 1999; 274: 20165-20170Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar) results in decreased survival of cells. In some instances, alternative energy sources have been provided suggesting that depletion of ATP levels does NOT explain the decrease in survival (48Moley K.H. Mueckler M.M. Apoptosis. 2000; 5: 99-105Crossref PubMed Scopus (138) Google Scholar, 51Malhotra R. Brosius III, F.C. J. Biol. Chem. 1999; 274: 12567-12575Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 57Kan O. Baldwin S.A. Whetton A.D. J. Exp. Med. 1994; 180: 917-923Crossref PubMed Scopus (112) Google Scholar). Several insulin-resistant models, including the long lived Caenorhabditis elegans Daf-2 knockout, have an increased stress tolerance to a variety of agents (62Gual P. Gonzalez T. Gremeaux T. Barres R. March Le -Brustel Y. Tanti J.F. J. Biol. Chem. 2003; 278: 26550-26557Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 63Holzenberger M. Dupont J. Ducos B. Leneuve P. Geloen A. Even P.C. Cervera P. Le Bouc Y. Nature. 2003; 421: 182-187Crossref PubMed Scopus (1627) Google Scholar, 64Pereira C. Moreira P. Seica R. Santos M.S. Oliveira C.R. Exp. Neurol. 2000; 161: 383-391Crossref PubMed Scopus (16) Google Scholar). Based upon these data, and recent observations suggesting that heat shock protein (HSP) 70 may act as an O-GlcNAc lectin (65Lefebvre T. Cieniewski C. Lemoine J. Guerardel Y. Leroy Y. Zanetta J.P. Michalski J.C. Biochem. J. 2001; 360: 179-188Crossref PubMed Scopus (60) Google Scholar), we investigated the possible link between stress tolerance and O-GlcNAc. We demonstrate that in response to all forms of cellular stress tested, multiple cell lines rapidly and dynamically increase O-GlcNAc levels on a myriad of nuclear and cytoplasmic proteins. Moreover, modulation of O-GlcNAc levels alters thermotolerance. Increasing O-GlcNAc levels result in cells that are more thermotolerant, whereas decreasing levels of O-GlcNAc protein modification led to cells that are more sensitive to thermal stress. The extent of O-GlcNAc protein modification appears to affect the levels of the heat shock proteins, HSP70 and HSP40, suggesting a molecular mechanism for these findings. This study provides a molecular link, O-GlcNAc, between glucose metabolism and stress tolerance and suggests a new paradigm in the regulation of stress-mediated signal transduction pathways. Cell lines and Culture Conditions—All cells (unless indicated) were from the ATCC and were maintained in DMEM (1 g/liter; Mediatech) supplemented with 10% (v/v) fetal bovine serum (FBS) and penicillin/streptomycin at 37 °C in a humidified incubator at 5% CO2. Cells were seeded ∼48 h prior to the beginning of stress treatments as follows: COS-7 (green monkey kidney cells), HeLa (human), Chinese hamster ovary cells (CHO), and mouse neuroblastoma cells (Neuro-2A) cells were seeded at 4 × 105 cells in 100-mm plates or 5 × 104 in 6-well plates, whereas human embryonic kidney 293 (HEK293) cells were seeded at 8 × 105 cells in 100-mm plates. Mouse embryonic fibroblasts (MEFs) were maintained in DMEM (4.5g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin (66O'Donnell N. Zachara N.E. Hart G.W. Marth J.D. Mol. Cell. Biol. 2004; : 1680-1690Crossref PubMed Scopus (340) Google Scholar). Cells were seeded at 1 × 106 in 100-mm plates or 2 × 105 in 6-well plates. Primary human coronary artery endothelial cells (HCAEC, Clonetics) were cultured according to the manufacturer's instructions. Cells were treated with 100 μm O-(2-acetamido-2-deoxy-d-glucopyranosylidene) amino-N-phenylcarbamate (PUGNAc; in phosphate-buffered saline (PBS); Carbogen, Switzerland) or 20 μm 6-diazo-5-oxonorleucine (DON; in Me2SO; Sigma) for 18 h prior to the beginning of experiments. 20 μg/ml cycloheximide (in ethanol; Sigma), 100 μm chloroquine (in PBS; Sigma), and 20 μm ALLN (in Me2SO; Sigma) were incubated with cells for 1 h prior to the initiation of experiments. Stress Treatments—Cell culture media were changed 1 h prior to stress treatments. Thermal treatments were performed in a humidified incubator (5% CO2), and at the end of the heat treatment cells were returned to 37 °C. COS-7, CHO, HeLa, and Neuro-2A cells were placed at 45 °C for 1 h, whereas HEK293, HCAEC, and MEF cells were placed at 42 °C for 1 h. The different temperatures are representative of different basal levels of thermotolerance. Treatments were optimized and resulted in less than 10% cell death. Experiments were performed in duplicate a minimum of four times. For multiple stress experiments, cells were serum-starved for 18 h prior to stress treatments. Cells were treated for 8 h as follows: 1 mm H2O2, 50 μm CoCl2, 4% (v/v) ethanol, 100 mm NaCl (in addition to physiological saline), 75 μm sodium arsenite. In other treatments, cells were thermally stressed as above or treated with UVB light for 90 s and recovered at 37 °C for 8 h. Treatment levels were chosen that resulted in <10% cell death and are similar to those reported by others. Experiments were performed in duplicate a minimum of four times. In densitometry derived from these experiments, error bars represent 1 S.D. p values are the result of a paired Student's t test (two-tailed). For densitometry O-GlcNAc levels were normalized to actin to control for protein load Analysis of Proteins—Cells were washed with ice-cold PBS, harvested, and extracted with 1% (v/v) Nonidet P-40 in Tris-HCl, pH 7.4, 0.1 mm phenylmethylsulfonyl fluoride, 1 mm dithiothreitol, 2 μm PUGNAc, 5 mm KF, 0.5 mm orthovanadate, 5 mm β-glycerophosphate, 2 mm EDTA, PIC1, and PIC2. Extracts were separated by noncontinuous reducing SDS-PAGE on Tris-glycine gels (Criterion, Bio-Rad). Proteins transferred to nitrocellulose and blocked with 3% (w/v) bovine serum albumin were detected with anti-HSP110, HSP90, HSP/HSC70, HSP70, HSP40, and HSP27 antibodies (Stressgen), anti-O-GlcNAc antibody (CTD 110.6; Covance, PA) (67Comer F.I. Vosseller K. Wells L. Accavitti M.A. Hart G.W. Anal. Biochem. 2001; 293: 169-177Crossref PubMed Scopus (234) Google Scholar), anti-OGT (AL28) (68Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (607) Google Scholar), anti-heat shock factor 1 (HSF1; Stressgen), anti-tubulin (Sigma), or anti-actin (Sigma). Densitometry was performed by using nonsaturated chemiluminescent exposed films and quantitated using MacBAS bio-imaging analyzer (version 2.5, Fuji Photo Film Co). Typically, multiple exposures from the same experiment were used to confirm that the signal was within the linear range. Levels of O-GlcNAc in the entire lane were normalized to the appropriate control (actin or tubulin) and then expressed as a percentage of control (set at 100%). In all instances, data are averaged from independent experiments. O-GlcNAcase and OGT Assays—Total cell extracts (40 μg), either Nonidet P-40 (described above) or nuclear/cytoplasmic extracts (69Wells L. Vosseller K. Cole R.N. Cronshaw J.M. Matunis M.J. Hart G.W. Mol. Cell. Proteomics. 2002; 1: 791-804Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar), were assayed for O-GlcNAcase (EC 3.2.1.52) activity, the enzyme that removes O-GlcNAc, by using p-nitrophenyl phosphate-GlcNAc as described earlier (70Gao Y. Wells L. Comer F.I. Parker G.J. Hart G.W. J. Biol. Chem. 2001; 276: 9838-9845Abstract Full Text Full Text PDF PubMed Scopus (520) Google Scholar, 71Wells L. Gao Y. Mahoney J.A. Vosseller K. Chen C. Rosen A. Hart G.W. J. Biol. Chem. 2002; 277: 1755-1761Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar). Activity is reported as micromoles of cleavage per min per mg of cell extract. To determine OGT activity, OGT was immunoprecipitated from Nonidet P-40 extracts (described above) of heat-stressed cells as follows. Nonidet P-40 extracts (500 μg) were diluted to 0.5 mg/ml and 0.2% Nonidet P-40 and were pre-cleared with preimmune antibody (100 μl) covalently coupled to CNBr-activated agarose (6 mg/ml) for 2 h at 4 °C. Extracts were then precipitated with anti-OGT antibody (AL28; 100 μl) covalently coupled to CNBr-activated agarose (6 mg/ml) for 2 h at 4 °C. Resin was washed with 1 ml each of Tris-HCl-buffered saline, pH 7.4 (Tris-buffered saline), 0.2% (v/v) Nonidet P-40, Tris-buffered saline, and OGT desalting buffer (20 mm Tris-HCl, pH 7.8, 20% glycerol, 0.02% azide). OGT was assayed on beads against the casein kinase II acceptor peptide as reported previously (38Kreppel L.K. Hart G.W. J. Biol. Chem. 1999; 274: 32015-32022Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar). Activity is reported as micromoles of GlcNAc transferred to casein kinase II per min per mg of cell extract immunoprecipitated. Activity was normalized to levels of OGT in cell precipitates by densitometry. Cre-Lox Recombination—Viral infections using adenovirus carrying either a control vector (Neo) and Cre-recombinase vector (Cre) were carried out as reported previously (66O'Donnell N. Zachara N.E. Hart G.W. Marth J.D. Mol. Cell. Biol. 2004; : 1680-1690Crossref PubMed Scopus (340) Google Scholar), except that 1 × 106 cells were seeded in 100-mm plates. Infected cells were selected in G418 (final 1 mg/ml). Prior to stress and thermal kill experiments, G418 was washed out, and cells were allowed to recover for 2 h. Thermal Survival—Media were changed 1 h prior to the initiation of thermal survival experiments. Cells were stressed at the indicated temperatures (45–48 °C depending on cell type) in a humidified incubator (5% CO2) for 0–80 min and then placed at 37 °C for 24 h. Cell viability was assessed using the crystal violet method (72Andreoni G. Angeretti N. Lucca E. Forloni G. Exp. Neurol. 1997; 148: 281-287Crossref PubMed Scopus (17) Google Scholar). To allow for differences in growth rates derived from modulating O-GlcNAc levels, viability is expressed as a percentage of unstressed cells. All experiments were performed a minimum of three times, and numbers are derived from at least four replicates. Error bars represent 1 S.D.; p values are the result of a paired Student's t test (two-tailed). RNA Interference (RNAi)—Neuro-2A cells were seeded at 1 × 105 in 6-well plates in DMEM (1g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin. At 24 h media were changed to Opti-MEM (Invitrogen), and cells were transfected with duplex (5 nm) using siPORTamine (Ambion, TX) according to the manufacturer's instructions. Media were changed after 24 h, and experiments were initiated at 36 h post-transfection. RNAi duplexes were designed against the murine OGT sequence. Note an equal mixture of OGT1 and OGT2 was used. Duplexes were created using the Silencer™ siRNA construction kit (Ambion, TX) according to the manufacturer's instructions. The oligonucleotides used are as follows: OGT1, AAGCAATCGAGCATTATCGAC; OGT2, AAGTTTGAGCCCAAATCATGC; scrambled, CAGTCGCGTTTGCGACTGGTT. Plasmids and Transfections—OGT was subcloned from pCiteOGT (SalI/NotI; gift of S. Iyer, The Johns Hopkins University) into pShuttle (NheI/NotI). COS-7 cells were seeded at 1 × 105 in 6-well plates in DMEM (1g/liter glucose) supplemented with 10% (v/v) FBS and penicillin/streptomycin, and the latter was removed ∼24 h prior to transfection. Cells were transfected with 2–3 μg of DNA (pShuttle or pShuttle-OGT) using FuGENE 6 (Roche Applied Science) according to the manufacturer's instructions. Transfection reagent was replaced with media after 8 h. After 24 h, media were again replaced, and thermotolerance was determined. O-GlcNAc Levels Increase in Response to Multiple Forms of Cellular Stress—To investigate the possible role of the O-GlcNAc protein modification in stress response pathways, levels of O-GlcNAc were determined after cells were subjected to different forms of cellular stress. Remarkably, in response to all stress-inducing agents tested, levels of O-GlcNAc became elevated (Fig. 1, A and E) as follows: lane 1, control; lane 2, H2O2 (144 ± 12%); lane 3, CoCl2 (151 ± 13%); lane 4, UVB light (145 ± 18%); lane 5, ethanol (142 ± 21%); lane 6, NaCl (195 ± 18%); lane 7, heat shock (172 ± 24%); and lane 8, sodium arsenite (230 ± 27%). Similar data were observed in cells with and without serum (data not shown). The level of OGT, the enzyme that catalyzes the addition of O-GlcNAc to the protein backbone, was also examined. All forms of stress, except hyperthermia, induced higher levels of OGT protein expression (Fig. 1C). Notably, increased O-GlcNAc protein modification in response to stress is dose-dependent (Fig. 2).Fig. 2Increased O-GlcNAc protein modification of nucleocytoplasmic proteins is dose-dependent. A, COS-7 cells were treated with iodoacetamide (25–75 μm, as indicated) for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (30 μg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. C, control; WB, Western blot. B, COS-7 cells were treated with UVB light (30–90 s, as indicated) and recovered at 37 °C for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (30 μg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. C, COS-7 cells were treated with heat shock (HS) 45 °C for 1 h (recovery for 6 h at 37 °C) or were treated with 1% v/v or 4% v/v ethanol for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (20 μg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. D, COS-7 cells were treated with heat shock (HS) at 45 °C for 1 h (recovery for 6hat37 °C) or were treated with 25 or 75 μm sodium arsenite for 7 h. Levels of O-GlcNAc (upper panel) and actin (middle panel) in total cell extract (20 μg/lane) were determined in duplicate by immunoblot. Densitometry of O-GlcNAc normalized to actin is shown in the lower panel. In all figures, error bars represent 1 S.D. p values are the result of a Student's t test (two-tailed).View Large Image Figure ViewerDownload (PPT) Increased O-GlcNAc protein modification induced by cellular stress is a widespread response. Elevated O-GlcNAc in response to thermal and osmotic stress was observed in several different cell types including MEFs, CHO cells, HEK293 cells, Neuro-2a cells, HeLa cells, and primary HCAECs (data not shown). These data suggest that increased O-GlcNAc is a target and effector of stress response pathways. O-GlcNAc Is Added Rapidly and Dynamically in Response to Thermal Stress—To determine whether O-GlcNAc was added to proteins in a dynamic fashion, consistent with a role in stress-associated signal transduction pathways, the rate of addition of O-GlcNAc in response to hyperthermia was studied. O-GlcNAc levels were appreciably elevated at the termination of thermal stress (Fig. 3A, time post-heat stress, 0 min), suggesting that O-GlcNAc addition is rapidly induced soon after the initiation of hyperthermia. This addition is dynamic, as levels of O-GlcNAc continued to increase for 9 h but are reduced by 24 h and return to normal by 48 h (Fig. 3B). Notably, O-GlcNAc induction occurs prior to elevation of HSP70 protein levels (Fig. 3B
Referência(s)