Portal de Periódicos da CAPES

Mast Cell-/Basophil-specific Transcriptional Regulation of Human l-Histidine Decarboxylase Gene by CpG Methylation in the Promoter Region

1998; Elsevier BV; Volume: 273; Issue: 47 Linguagem: Inglês

10.1074/jbc.273.47.31607

1083-351X

Atsuo Kuramasu, Hirohisa Saito, Satsuki Suzuki, Takehiko Watanabe, Hiroshi Ohtsu,

Epigenetics and DNA Methylation

l-Histidine decarboxylase (HDC) catalyzes the formation of histamine from l-histidine, and in hematopoietic cell lineages the gene is expressed only in mast cells and basophils. We attempted here to discover how HDC gene expression is restricted in these cells. In the cultured cell lines tested, only the mast cells and basophils strongly transcribed the HDC gene. However, in transient transfection analysis, the reporter constructs with the HDC promoter were active not only in expressing cells but also in nonexpressing cells. Detailed analyses of the HDC promoter region revealed that the GC box is essential for transactivation. Also, the promoter region of the HDC gene proved to be sensitive to DNase I and restriction endonucleases exclusively in HDC-expressing cells, suggesting that the promoter region is readily accessible totrans-acting factor(s). Furthermore, the promoter region in HDC-expressing cell lines was found to be selectively unmethylated. The correlation between HDC expression and hypomethylation was also found in primary human mast cells. Methylation of the HDC promoter in vitro reduced the luciferase reporter activity in transient expression analysis, suggesting that methylation of the promoter region is functionally important for HDC gene expression. These results imply that alteration of DNA methylation is one of the mechanisms regulating cell-specific expression of the HDC gene. l-Histidine decarboxylase (HDC) catalyzes the formation of histamine from l-histidine, and in hematopoietic cell lineages the gene is expressed only in mast cells and basophils. We attempted here to discover how HDC gene expression is restricted in these cells. In the cultured cell lines tested, only the mast cells and basophils strongly transcribed the HDC gene. However, in transient transfection analysis, the reporter constructs with the HDC promoter were active not only in expressing cells but also in nonexpressing cells. Detailed analyses of the HDC promoter region revealed that the GC box is essential for transactivation. Also, the promoter region of the HDC gene proved to be sensitive to DNase I and restriction endonucleases exclusively in HDC-expressing cells, suggesting that the promoter region is readily accessible totrans-acting factor(s). Furthermore, the promoter region in HDC-expressing cell lines was found to be selectively unmethylated. The correlation between HDC expression and hypomethylation was also found in primary human mast cells. Methylation of the HDC promoter in vitro reduced the luciferase reporter activity in transient expression analysis, suggesting that methylation of the promoter region is functionally important for HDC gene expression. These results imply that alteration of DNA methylation is one of the mechanisms regulating cell-specific expression of the HDC gene. l-histidine decarboxylase Dulbecco's modified Eagle's medium polymerase chain reaction multiple cloning site electrophoretic mobility shift assay methyl-CpG-binding protein base pair(s) kilobase pair(s). l-Histidine decarboxylase (HDC1; EC 4.1.1.22) catalyzes the formation of histamine, a bioactive amine known to play various roles in physiological and pathological conditions, such as smooth muscle contraction, gastric acid secretion, cell growth, neurotransmission, and inflammation (1Burland W.L. Mills J.C. Ganellin C.R. Parson M.E. Pharmacology in Histamine Receptors. Wright PSG Publishing Co., Inc., Littleton, MA1982: 436-481Google Scholar). The expression of HDC mRNA is detected only in a limited number of tissues and cells, showing a good correlation with the distribution of histamine-mediated functions (2Watanabe T. Taguchi Y. Maeyama K. Wada H. Uvnäs B. Histamine and Histamine Antagonists. Springer-Verlag, Berlin1991: 145-163Google Scholar). We earlier cloned the human HDC gene, analyzing its structure and sequencing entirety, including the 5′-flanking region (3Yatsunami K. Ohtsu H. Tsuchikawa M. Higuchi T. Ishibashi K. Shida A. Shima Y. Nakagawa S. Yamauchi K. Yamamoto M. Hayashi N. Watanabe T. Ichikawa A. J. Biol. Chem. 1994; 269: 1554-1559Abstract Full Text PDF PubMed Google Scholar). In hematopoietic lineages, the human HDC gene is expressed in mast cells and basophils, and we have been interested in the mechanism underlying this cell specificity. Mast cells and basophils are responsible for many pathologic conditions such as systemic anaphylaxis, cutaneous allergic reactions, bronchial asthma, and parasitic infections (4Schwartz L. Huff T. Middleton E.M. Reed M.D. Allergy. Mosby-Year Book, St. Louis, MO1993: 135-168Google Scholar). It is known that mast cells leave the bone marrow as progenitors and complete their differentiation in peripheral tissues, while basophils complete their differentiation in the bone marrow (4Schwartz L. Huff T. Middleton E.M. Reed M.D. Allergy. Mosby-Year Book, St. Louis, MO1993: 135-168Google Scholar). Human mast cells can be obtained in vitro by long term culture of CD34-positive cells with stem cell factor (5Saito H. Ebisawa M. Tachimoto H. Shichijo M. Fukagawa K. Matsumoto K. Iikura Y. Awaji T. Tsujimoto G. Yanagida M. Uzumaki H. Takahashi G. Tsuji K. Nakahata T. J. Immunol. 1996; 157: 343-350PubMed Google Scholar). But little is known about the molecular mechanisms underlying the differentiation of mast cells. One of the approaches to this problem is to elucidate how the expression of mast cell-specific genes are regulated. The presence of several lineage-specific transcription factors is reported in mast cells. For example, cell-specific expression of the mast cell-carboxypeptidase A gene is regulated through GATA site (6Zon L.I. Gurish M.F. Stevens R.L. Mather C. Reynolds D.S. Austen K.F. Orkin S.H. J. Biol. Chem. 1991; 266: 22948-22953Abstract Full Text PDF PubMed Google Scholar). Transcription factors GATA-1, GATA-2, and PU.1 play a critical role in mast cell-specific expression of interleukin-4 through binding to an enhancer in the second intron (7Henkel G. Brown M.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7737-7741Crossref PubMed Scopus (117) Google Scholar,8Henkel G. Weiss D.L. McCoy R. Deloughery T. Tara D. Brown M.A. J. Immunol. 1992; 149: 3239-3246PubMed Google Scholar). We reported that the transcription factor NF-E2 transactivated the mouse HDC gene (9Ohtsu H. Kuramasu A. Suzuki S. Igarashi K. Ohuchi Y. Sato M. Tanaka S. Nakagawa S. Shirato K. Yamamoto M. Ichikawa A. Watanabe T. J. Biol. Chem. 1996; 271: 28439-28444Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). It is well known, however, thattrans-acting factors are not the only regulators of cell-specific transcription. For example, the CpG methylation or packed chromatin structure exerts negative effects on gene expression and also must be considered to understand the precise mechanisms of specific gene transcription. We show here that cell-specific expression of HDC mRNA is regulated at the transcriptional level. It is revealed that a region including the GC box sequence in the promoter is essential for transactivation and that Sp1 binds to this GC box. However, lines of evidence that even cell lines that do not transcribe the HDC gene show some transactivation and that there is little difference in binding of nuclear extracts to the GC box between HDC-expressing and -nonexpressing cell lines point to the presence of an additional regulatory mechanism(s). In this study, we observed that the promoter region in HDC-expressing cell lines is more sensitive to nucleases and has unmethylated CpG sites around the transcription initiation site. Moreover, in vitro methylation of reporter plasmids was shown to have inhibitory effects on the HDC gene promoter. These results indicate that chromosomal configuration and methylation of the HDC gene would be critical for the cell-specific transcription of this gene. HeLa and HMC-1 (10Butterfield J.H. Weiler D. Dewald G. Gleich G.J. Leuk. Res. 1988; 12: 345-355Crossref PubMed Scopus (633) Google Scholar) cells were maintained in Dulbecco's modified Eagle's medium (DMEM) and Iscove's modified Dulbecco's medium with 1.2 mm of monothioglycerol, respectively. K562 (11Lozzio C.B. Lozzio B.B. Blood. 1975; 45: 321-334Crossref PubMed Google Scholar) and KU-812-F (12Fukuda T. Kishi K. Ohnishi Y. Shibata A. Blood. 1987; 70: 612-619Crossref PubMed Google Scholar) cells were maintained in RPMI 1640 medium. All media were supplemented with 10% fetal bovine serum, 100 IU/ml penicillin, and 100 μg/ml streptomycin. To prepare primary human mast cells, umbilical cord blood samples were obtained from normal full-term deliveries according to the hospital's legal guidelines (National Children's Hospital, Tokyo, Japan). Mononuclear cells were separated by density gradient centrifugation using lymphocyte separation medium (Organon Teknika Corp., Durham, NC). CD34-positive cells were isolated from mononuclear cells using a magnetic separation column according to the manufacturer's instruction (Miltenyi Biotec, Bergisch Gladbach, Germany). The cells were cultured in media I (IBL, Gunma, Japan) containing 5% fetal bovine serum, human recombinant stem cell factor (Kirin Brewery, Maebashi, Japan) at 100 ng/ml and interleukin-6 (Kirin Brewery) at 50 ng/ml for 20 weeks (5Saito H. Ebisawa M. Tachimoto H. Shichijo M. Fukagawa K. Matsumoto K. Iikura Y. Awaji T. Tsujimoto G. Yanagida M. Uzumaki H. Takahashi G. Tsuji K. Nakahata T. J. Immunol. 1996; 157: 343-350PubMed Google Scholar). Genomic DNA was isolated by digesting cells with proteinase K in the presence of EDTA and SDS followed by phenol extraction (13Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Total cellular RNA was isolated by the acid guanidinium thiocyanate/phenol/chloroform procedure (14Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63082) Google Scholar). HDC mRNA was analyzed by RNA blot hybridization. Twenty-μg aliquots of total cellular RNA were electrophoresed in 1% agarose gels under denaturing conditions, transferred to a nylon membrane (Hybond N+, Amersham Pharmacia Biotech), and hybridized with [α-32P]dCTP-labeled cDNA probes at 42 °C overnight in hybridization buffer comprising 50% formamide, 5× SSPE, 5× Denhardt's solution, 0.5% SDS, and 200 μg/ml salmon sperm DNA. The blots were washed in 2× SSPE, 0.1% SDS; 1 × SSPE, 0.1% SDS; and then 0.1× SSPE, 0.1% SDS at 42 °C. DNA blots were hybridized at 65 °C overnight in hybridization buffer comprising 5× SSPE, 5× Denhardt's solution, 0.5% SDS, and 20 μg/ml salmon sperm DNA. The blots were washed at 65 °C in the same buffers as used for RNA blots. The human HDC cDNA probe used was a 1.8-kbPvuII–PvuII (positions 265–2063) restriction fragment from the human HDC cDNA clone, pTN-2 (15Mamune-Sato R. Yamauchi K. Tanno Y. Ohkawara Y. Ohtsu H. Katayose D. Maeyama K. Watanabe T. Shibahara S. Takishima T. Eur. J. Biochem. 1992; 209: 533-539Crossref PubMed Scopus (32) Google Scholar). The human β-actin probe was a 0.9-kb ScaI–SmaI (positions 121–1048) restriction fragment from a human β-actin cDNA clone (provided by Dr. T. Yamamoto at the Tohoku University Gene Research Center). The HDC probes for genomic Southern analysis were 409-bp PstI–PstI (positions −612 to −203) (probe 1 in Fig. 4) and 387-bp PstI–PstI (positions −203 to +184) restriction fragments (probe 2 in Fig. 5) and the 238-bp PCR product (probe 3 in Fig. 5) amplified with two primers: Pr.1iDS1Eco (5′-CCTGATTTCTCTATGTCACTTCTAG-3′ (+2298 to +2322)) and Pr.2iUS1Eco (5′-CCTGAATTCCAGAACTGCCCTTG-3′ (+2535 to +2513)). These fragments were labeled with [α-32P]dCTP by random priming (16Feinberg A.P. Vogelstein B. Anal. Biochem. 1983; 132: 6-13Crossref PubMed Scopus (16645) Google Scholar).Figure 5Methylation pattern of the human HDC gene. A, 10-μg aliquots of genomic DNA isolated from HeLa (lanes 1 and 5), K562 (lanes 2 and 6), HMC-1 (lanes 3 and 7) and KU-812-F (lanes 4 and 8) were first treated with EcoRI and then with MspI (lanes 1–4) or HpaII (lanes 5–8). The samples were separated, blotted, and hybridized with probe 2. B, each slot was loaded with 5 μg of genomic DNA from HeLa (lanes 1 and 2), K562 (lanes 3 and 4), HMC-1 (lanes 5 and 6), and KU-812-F (lanes 7 and 8) digested withEcoRI and HpaII (lanes 1, 3, 5, and 7) or EcoRI and MspI (lanes 2, 4, 6, and 8). The blot was hybridized with probe 3.C, restriction map of the human HDC gene. Exons I and II are represented by thick vertical lines.MspI/HpaII recognition sites (CCGG) and CpG dinucleotides are also indicated. Closed and open circles represent methylated and unmethylated sites, respectively. Two MspI sites in the first intron just 5′ of the second exon are too close to be discriminated from each other by Southern blot analysis (*). Therefore, at least one of them could be recognized to be unmethylated from the results in B. Thelines at the bottom of C represent the expected size of fragments produced by restriction endonuclease digestion.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The nuclear run-on transcription assay was performed basically as described previously (17Celano P. Berchtold C. Casero R.A. BioTechniques. 1989; 7: 942-944PubMed Google Scholar, 18Greenberg M.E. Ziff E.B. Nature. 1984; 311: 433-438Crossref PubMed Scopus (2008) Google Scholar, 19O'Conner J.L. Wade M.F. BioTechniques. 1992; 12: 238-243PubMed Google Scholar). About 2 x 107 nuclei were isolated and incubated with [α-32P]UTP and unlabeled ATP, CTP, and GTP. The radiolabeled nascent RNA transcripts were treated with 20 units/ml of DNase I at 30 °C for 10 min and 1 mg/ml of proteinase K at 42 °C for 30 min. RNA was then isolated by the acid guanidinium thiocyanate/phenol/chloroform procedure (14Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63082) Google Scholar). Unincorporated [α-32P]UTP was removed by two rounds of ammonium acetate/ethanol precipitation. To prepare cDNA blots, pBluescript KS(+) inserted with human HDC cDNA (positions 236–2060) or human β-actin cDNA (full-length) or without any insert was linearized, alkaline-denatured, and slot-blotted to Hybond N+. Hybridization and washing were performed as described previously (18Greenberg M.E. Ziff E.B. Nature. 1984; 311: 433-438Crossref PubMed Scopus (2008) Google Scholar). The signal intensity was quantified using a MacBAS bioimaging analyzer (Fuji Film, Tokyo, Japan). A BamHI/HindIII restriction fragment containing the −5947 to +97 region just upstream of the first codon of human HDC gene was isolated from pUCHDC(−5.8k) (kindly provided by Prof. A. Ichikawa, Kyoto University), inserted between BglII and HindIII sites in the 5′ multiple cloning site (MCS) of the pGL2 basic vector (Promega) to construct pGL−5947. To construct pGL−4687 and pGL−2435,SmaI (MCS)/BglII (−4687) and SmaI (MCS)/NdeI (−2435) fragments, respectively, were removed from pGL−5947, treated with T4 DNA polymerase to make blunt ends, and self-ligated. pGL−278 was constructed from pGL−5947 by removing theSacI (MCS)/SacI (−278) fragment for self-ligation. PCR products amplified with Pr.-1 (5′-TGGCTCTCTTGACCAGTCAA-3′ (−155 to −135))/GL primer 2 (Promega) and Pr.-0.5 (5′-GGAGCTAAGGTCAAAGAAAG-3′ (−53 to −33))/GL primer 2 using pGL−5947 as a template were digested with HindIII, and larger fragments were isolated and cloned into SmaI and HindIII sites of the pGL2 basic vector to produce pGL−153 and pGL−52, respectively. Because pGL−153 does not contain suitable restriction sites for a deletion reaction with exonuclease III, theHindIII-digested PCR fragment used to produce pGL−153 was cloned into SmaI and HindIII sites of pBluescript KS(+) to produce pBS−153. The BamHI (MCS)/HindIII (MCS) restriction fragment from pBS−153 was recloned into BglII and HindIII sites of pGL basic vector to produce pGLBH−153. Then pGLBH−153 linearized withSacI and XhoI was treated with exonuclease III and mung bean nuclease to make unidirectional deletions and self-ligated to produce pGL−123, pGL−100, pGL−84, and pGL−64. Constructs pGL−153 GC mut and pGL−123 GC mut were generated using the Transformer site-directed mutagenesis kit (CLONTECH) according to the manufacturer's instruction using Pr.Sp1Smut (5′-GGACTTTGAAGaatacAGCTAAGGTCAAAG-3′ (−67 to −38; lowercase letters indicate mutations)) as a mutagenic primer. Constructs produced using PCR products were sequenced by dideoxy chain termination method (20Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52494) Google Scholar) to exclude plasmids with PCR mutation(s). DNA transfection was carried out by the electroporation method (21Showe M.K. Williams D.L. Showe L.C. Nucleic Acids Res. 1992; 20: 3153-3157Crossref PubMed Scopus (16) Google Scholar). Cells were harvested, washed, and resuspended in PBS at a density of 107 cells/ml. A mixture of 320 μl of cell suspension and 30 μl of DNA solution was incubated in 4-mm-wide cuvettes (Bio-Rad) on ice for 10 min before electroporation. The DNA solutions contained 5 pmol of reporter plasmid, 50 μg of pBluescript KS(+) as carrier, and 10 μg (for HMC-1 and HeLa) or 2 μg (for K562) of pENL β-galactosidase expression vector as an internal control per cuvette. Cell suspensions were exposed to an electric pulse of 360 V/960 microfarads (for HeLa), 320 V/960 microfarads (for K562) or 380V/960 microfarads (for HMC-1), provided by a Gene Pulser electroporation device (Bio-Rad). After electroporation, the cuvettes were incubated on ice for 10 min again, and the transfected cells were cultured with 6 ml of medium for 48 h at 37 °C under 5% of CO2 until harvesting. Preparation of cell lysates and luciferase assays was carried out using a Luciferase Assay Kit (Toyo-Inki, Tokyo, Japan). β-Galactosidase activities in cell lysates were assayed as described earlier (13Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The luciferase activity was standardized by the β-galactosidase activity and was expressed as a relative value to that obtained with the pGL2 basic. Nuclear extracts were prepared from four cell lines by hypotonic lysis followed by high salt extraction of nuclei as described previously (22Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2210) Google Scholar). Double-stranded oligonucleotide DNAs were end-labeled with [γ-32P]ATP in the presence of T4 DNA polynucleotide kinase. Five μg of nuclear extracts were incubated with 104 cpm of the labeled probe at room temperature for 30 min in 22 μl of the reaction mixture comprising 25 mm HEPES (pH 7.9), 0.5 mm EDTA (pH 8.0), 50 mm KCl, 10% glycerol, 0.5 mm dithiothreitol, 0.5 mmphenylmethylsulfonyl fluoride, and 2 μg of poly(dI-dC), and electrophoresed in 4% polyacrylamide gels at 4 °C in 50 mm Tris-HCl, 400 mm glycine, and 2 mm EDTA (pH 8.5). Dried gels were subjected to autoradiography. Synthetic oligonucleotides were added to the reaction mixtures as competitors at a 100-fold molar excess over the input probe concentration. For the supershift analysis, 1 μg of anti-Sp1 antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was added to the reaction mixture. Nuclei were isolated as described previously with minor modifications (23Siebenlist U. Hennighausen L. Battey J. Leder P. Cell. 1984; 37: 381-391Abstract Full Text PDF PubMed Scopus (247) Google Scholar). About 3 × 108 cells were harvested, washed in PBS, and resuspended in ice-cold nuclear isolation buffer (60 mm KCl, 15 mm NaCl, 5 mm MgCl2, 15 mm Tris-HCl (pH 7.4), 0.1 mm EGTA (pH 7.8), 0.5 mm dithiothreitol, and 0.1 mmphenylmethylsulfonyl fluoride) containing 0.3 m sucrose at a concentration of 107 cells/ml. Cells were lysed by adding Nonidet P-40 (0.5% final concentration) and kept for 5 min on ice. This solution was layered onto the same volume of sucrose solution (1.5m in nuclear isolation buffer) and centrifuged at 1,000 × g for 10 min at 4 °C. The precipitated nuclei were resuspended in glycerol storage buffer (40% glycerol and 0.3 m sucrose in nuclear isolation buffer without phenylmethylsulfonyl fluoride), frozen after aliquoting, and stored at −70 °C until use. Aliquots of nuclei (4 A 260units in 400 μl) were treated with serial 2-fold increasing concentrations of DNase I (28–448 units/ml) at 37 °C for 10 min or with ApaI (200 units/ml) at 37 °C for 60 min. The reaction was stopped by the addition of SDS and EDTA to final concentrations of 0.5% and 10 mm, respectively, and followed by digestion at 55 °C overnight with proteinase K at a final concentration of 400 μg/ml. The reaction mixtures were then extracted with phenol and phenol/chloroform, ethanol precipitation, and treated with 100 μg/ml RNase A for 30 min at 37 °C. The same extraction and precipitation protocol was then repeated, and these samples were electrophoresed, blotted, and hybridized as stated under “RNA and DNA Blot Hybridization Analysis.” Bisulfite genomic sequencing was performed basically as described previously (24Clark S.J. Harrison J. Paul C.L. Frommer M. Nucleic Acids Res. 1994; 22: 2990-2997Crossref PubMed Scopus (1609) Google Scholar, 25Frommer M. McDonald L.E. Millar D.S. Collis C.M. Watt F. Grigg G.W. Molloy P.L. Paul C.L. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1827-1831Crossref PubMed Scopus (2491) Google Scholar, 26Raizis A.M. Schmitt F. Jost J.P. Anal. Biochem. 1995; 226: 161-166Crossref PubMed Scopus (166) Google Scholar). Ten-μg aliquots of EcoRI-digested genomic DNA from cell lines were denatured in 0.3 m of NaOH at 37 °C for 15 min in a total volume of 50 μl. Next, sulfonation and hydrolytic deamination reactions were carried out by adding 450 μl of 2.5m sodium metabisulfite (Na2S2O5)/10 mmhydroquinone solution (pH 5.0) to the digested genomic DNA and incubating at 50 °C for 4 h in the dark. DNA was purified by absorbing to Glassmilk (Bio101) silica matrix and eluted with TE, according to the manufacturer's protocol. Desulfonation reaction were then performed in 0.3 m of NaOH at 37 °C for 15 min, and DNA was precipitated with 3 m ammonium acetate/ethanol and resuspended in 100 μl of water. PCR amplification was performed in 100 μl of reaction mixture containing 5 μl of bisulfite-treated genomic DNA, 0.5 μm primers, 200 μm dNTPs, 2 mm MgCl2, 50 mm KCl, 10 mm Tris-HCl (pH 8.3), and 2.5 units of ExTaq polymerase (Takara, Shiga, Japan) under the following conditions: 94 °C for 30 s, 65 °C for 1 min, 72 °C for 1 min for 35 cycles. Modified primers used in this experiment were as follows: hHDCa1 (5′-TTTGAATTCAGGGGTAGAAAGAATTGAGGG-3′ (modified sequences from −267 to −238)) and hHDCa2 (5′-CCATCATCTCCCTTAAACTCTAACTCCTTC-3′ (+113 to +84)) to amplify the sense strand, with hHDCb1 (5′-CCTACAAACTTGAATTCCTAAATACACTAC-3′ (−209 to −180)) and hHDCb2 (5′-TTTTATAGATGGATATGTAGGAGGTGGAAG-3′ (+85 to +56)) to amplify the antisense strand. Amplified DNA was sequenced directly or after subcloning in Bluescript KS(+) by the cycle sequencing method using an ABI PRISM 377 DNA sequencer (Perkin-Elmer). The reporter plasmid pGL−278 was digested with KpnI and HindIII, and the promoter region was gel-isolated. The promoter region was methylated in vitro with 3 units of SssI methylase (New England Biolabs)/μg of DNA in the presence of 160 μm S-adenosylmethionine at 37 °C for 3 h. For the unmethylated control, the same fragment was incubated in the same condition without SssI methylase. Complete methylation of the fragment was confirmed by HpaII and HhaI restriction enzyme digestion. The pGL basic vector digested withKpnI and HindIII was ligated with an equimolar concentration of methylated or unmethylated promoter fragment at 16 °C for 30 min at a DNA concentration of 10 μg/ml. The DNA was ethanol-precipitated, and 4 μg of ligated DNA was transfected using SuperFect transfection reagent (QIAGEN) according to the manufacturer's protocol. Five hundred ng of total RNA was primed with random hexamer and reverse-transcribed using Superscript II reverse transcriptase (Life Technologies, Inc.) in a total volume of 10 μl. The cDNA pool was then diluted 10-fold. PCR was carried out in a total volume of 20 μl containing 5 μl of cDNA, 0.2 mm dNTP mixture, 100 mm specific sets of primers, and 0.5 unit of ExTaq polymerase. The PCR conditions were as follows: 94 °C for 30 s, 65 °C for 30 s, 72 °C for 1 min for 30 or 35 cycles for HDC; 94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min for 28 cycles for β-actin. Primers used in reverse transcriptase-PCR were as follows (5′ to 3′): Pr.hHDCS, GCATCCAGCCCTGCGTGTAC (positions 425–444), Pr.hHDCAS, GAAGTCGGTGGCCACGCCTG (complementary to positions 1125–1144); β-actin S, CCACACCTTCTACAATGAGC (positions 302–321); β-actin AS, ACAGCACTGTGTTGGCGTAC (complementary to positions 919–938). The GenBankTM accession number for the humanl-histidine decarboxylase genomic sequence is D16583. RNA blot analysis of four human cell lines demonstrated HDC mRNA expression in HMC-1 human mast cells and KU-812-F human basophilic leukemia cells but not in HeLa human cervical cancer cells and K562 human erythroleukemia cells (Fig. 1 A). The amount of HDC mRNA in the HMC-1 cells appeared slightly greater than that in KU-812-F cells. Two HDC mRNA species were observed in HMC-1 cells as in KU-812-F cells, which were supposed to be generated by alternative splicing (15Mamune-Sato R. Yamauchi K. Tanno Y. Ohkawara Y. Ohtsu H. Katayose D. Maeyama K. Watanabe T. Shibahara S. Takishima T. Eur. J. Biochem. 1992; 209: 533-539Crossref PubMed Scopus (32) Google Scholar). In order to ascertain whether mast cell-/basophil-specific expression of HDC mRNA is transcriptionally regulated, we performed a nuclear run-on assay. The signal intensities for the HDC gene in HMC-1 and KU-812-F were 57 and 37%, respectively, of those for the β-actin gene (Fig. 1 B). In contrast, HDC signals in HeLa and K562 were as weak as those for control pBluescript KS(+) vector signals. These results suggest that the cell-specific expression of HDC mRNA in mast cells and basophils is dependent on transcription. To locate thecis-acting sequence that regulates HDC gene transcription, a series of 5′-deleted promoter fragments, including a 97-bp fragment downstream from the transcription initiation site, were fused to the luciferase gene in the pGL−2 basic vector and transfected into HMC-1, K562, and HeLa cell lines. Since the efficiency of transfection into KU-812-F was very low, we did not include this cell line. Construct pGL−5947, containing 5947 bp upstream from the transcription initiation site, produced a relative luciferase activity of about 75 in HMC-1 cells (Fig. 2 A). This activity was equivalent to that produced by pGL2 control vector, which possesses the SV40 early promoter and enhancer (data not shown). When the promoter region was deleted to −4687, the relative luciferase activity was reduced by 40% only in HMC-1, suggesting mast cell-specific positive regulatory elements in this region. The deletion to −52 decreased the luciferase activity to the basal level in all cell lines. Further analysis was made in order to identify the regulatory elements between −153 and −52. The removal of sequences between −153 and −123 increased the luciferase activity by 64% in HMC-1, indicating the existence of a negative element in this region. Removal of sequences from −64 to −52 abolished the reporter activity, suggesting that the GC box in this region was important for promoter activity. The requirement of the GC box was confirmed by the fact that pGL−153 GC mut or pGL−123 GC mut containing point mutations in the GC box showed significant loss of reporter activity (Fig. 2 B). To examine whether nuclear extracts from different cell lines bind to the GC box in different fashions, we performed electrophoretic mobility shift assays using a synthetic oligonucleotide probe (Fig. 3 A). Two major shift bands were observed for all four cell lines, and this shift was specifically inhibited by the addition of a 100-fold molar excess of the cold oligonucleotide (Fig. 3 B). When the mutated probe was used instead of the wild type probe, these two bands were not observed (Fig. 3 C). Furthermore, the addition of anti-Sp1 antibody resulted in retardation of these bands (Fig. 3 D). Bindings of Sp1 were not affected by methylation of GC box, and there was no difference in binding capacity among four cell lines (Fig. 3 E). These results confirm that Sp1 binds to the GC box, whether it is methylated or not, in all four cell lines and that the complexes are not specific to mast cells or basophils. The sensitivity of the promoter region of the HDC gene to DNase I was compared among the four cell lines. Smaller fragments of about 1.8–1.9 kb after DNase I digestion were found to hybridize with the probe in the HMC-1 and KU-812-F but not in HeLa and K562 cells (Fig. 4 A). These fragments specific to the two cell lines indicate the presence of DNase I-sensitive sites that map to regions just 5′ of exon I (Fig. 4 C). The absence of the 1.8–1.9-kb fragments in HeLa and K562 was not found to be due to ineffectiveness of DNase I digestion, because with a higher DNase I concentration, the 6.3-kbEcoRI–EcoRI fragment signal became weaker in all cell lines. We next used restriction endonuclease ApaI, which recognizes a site (−18 bp relative to the transcription initiation site) in the promoter region (Fig. 4 C, asterisk). The digestion of nuclei with ApaI again produced a strong 1.9-kb fragment in the HMC-1 and KU-812-F, but not in HeLa and K562 cells (Fig. 4 B). OtherApaI-sensitive sites were also found in the