Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

BARD1 Induces BRCA1 Intranuclear Foci Formation by Increasing RING-dependent BRCA1 Nuclear Import and Inhibiting BRCA1 Nuclear Export

2002; Elsevier BV; Volume: 277; Issue: 24 Linguagem: Inglês

10.1074/jbc.m200769200

ISSN

1083-351X

Autores

Megan Fabbro, Jose A. Rodrı́guez, Richard Baer, Beric R. Henderson,

Tópico(s)

Nuclear Structure and Function

Resumo

BRCA1 is a tumor suppressor with several important nuclear functions. BRCA1 has no known cytoplasmic functions. We show here that the two previously identified nuclear localization signals (NLSs) are insufficient for nuclear localization of BRCA1 due to the opposing action of an NH2-terminal nuclear export signal. In transfected breast cancer cells, BRCA1 nuclear localization requires both the NLSs and NH2-terminal RING domain region; mutating either of these sequences shifts BRCA1 to the cytoplasm. The BRCA1 RING element mediates nuclear import via association with BARD1, and this is not affected by cancer-associated RING mutations. Moreover, BARD1 directly masks the BRCA1 nuclear export signal, and the resulting block to nuclear export is requisite for efficient import and nuclear localization of ectopic and endogenous BRCA1. Our results explain why BRCA1 exon 11 splice variants, which lack the NLSs but retain the RING domain, are frequently detected in the nucleus and in nuclear foci in vivo. In fact, co-expression of BARD1 promoted formation of DNA damage-induced nuclear foci comprising ectopic wild-type or NLS-deficient BRCA1, implicating BARD1 in nuclear targeting of BRCA1 for DNA repair. Our identification of BARD1 as a BRCA1 nuclear chaperone has regulatory implications for its reported effects on BRCA1 protein stability, ubiquitin ligase activity, and DNA repair. BRCA1 is a tumor suppressor with several important nuclear functions. BRCA1 has no known cytoplasmic functions. We show here that the two previously identified nuclear localization signals (NLSs) are insufficient for nuclear localization of BRCA1 due to the opposing action of an NH2-terminal nuclear export signal. In transfected breast cancer cells, BRCA1 nuclear localization requires both the NLSs and NH2-terminal RING domain region; mutating either of these sequences shifts BRCA1 to the cytoplasm. The BRCA1 RING element mediates nuclear import via association with BARD1, and this is not affected by cancer-associated RING mutations. Moreover, BARD1 directly masks the BRCA1 nuclear export signal, and the resulting block to nuclear export is requisite for efficient import and nuclear localization of ectopic and endogenous BRCA1. Our results explain why BRCA1 exon 11 splice variants, which lack the NLSs but retain the RING domain, are frequently detected in the nucleus and in nuclear foci in vivo. In fact, co-expression of BARD1 promoted formation of DNA damage-induced nuclear foci comprising ectopic wild-type or NLS-deficient BRCA1, implicating BARD1 in nuclear targeting of BRCA1 for DNA repair. Our identification of BARD1 as a BRCA1 nuclear chaperone has regulatory implications for its reported effects on BRCA1 protein stability, ubiquitin ligase activity, and DNA repair. nuclear localization signal nuclear export signal methyl methanesulfonate yellow fluorescent protein The tumor suppressor, BRCA1, was the first susceptibility gene linked to breast and ovarian cancer (1Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Ahrshman K. Tavigian S. Liu Q. Cochran C. Bennett L.M. Ding W. Bell R. Rosenthal J. Hussey C. Tran T. McClure M. Frye C. Hattier T. Phelps R. Haugen-Strano A. Katcher H. Yakumo K. Gholmai Z. Shaffer D. Stone S. Bayer S. Wray C. Bogden R. Dayananth P. Ward J. Tonin P. Narod S. Bristow P.K. Norris F.H. Helvering L. Morrison P. Rosteck P. Lai M. Barrett J.C. Lewis C. Neuhausen S. Cannon-Albright L. Goldgar D. Wiseman R. Kamb A. Skolnick M.H. Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar). Germ-line mutations of BRCA1 are found in ∼50% of patients with inherited breast cancer and up to 90% of families with breast and ovarian cancer susceptibility (1Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Ahrshman K. Tavigian S. Liu Q. Cochran C. Bennett L.M. Ding W. Bell R. Rosenthal J. Hussey C. Tran T. McClure M. Frye C. Hattier T. Phelps R. Haugen-Strano A. Katcher H. Yakumo K. Gholmai Z. Shaffer D. Stone S. Bayer S. Wray C. Bogden R. Dayananth P. Ward J. Tonin P. Narod S. Bristow P.K. Norris F.H. Helvering L. Morrison P. Rosteck P. Lai M. Barrett J.C. Lewis C. Neuhausen S. Cannon-Albright L. Goldgar D. Wiseman R. Kamb A. Skolnick M.H. Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar, 2Couch F.J. Weber B.L. Hum. Mutat. 1996; 8: 8-18Crossref PubMed Scopus (269) Google Scholar). The role of BRCA1 as a tumor suppressor is not fully defined, although accumulated evidence suggests that BRCA1 plays a role in transcriptional regulation (3Chapman M.S. Verma I.M. Nature. 1996; 382: 678-679Crossref PubMed Scopus (435) Google Scholar), cell cycle control (4Ruffner H. Verna I.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7138-7143Crossref PubMed Scopus (178) Google Scholar, 5MacLachlan T.K. Somasundaram K. Sgagias M. Shifman Y. Muschel R.J. Cowan K.H. El-Deiry W.S. J. Biol. Chem. 2000; 275: 2777-2785Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar), and cell survival responses to DNA damage (6Scully R. Chen J. Ochs R.L. Keegan K. Hoekstra M. Feunteun J. Livingston D.M. Cell. 1997; 90: 425-435Abstract Full Text Full Text PDF PubMed Scopus (805) Google Scholar, 7Scully R. Chen J. Plug A. Xiao Y. Weaver D. Feunteun J. Ashley T. Livingston D.M. Cell. 1997; 88: 265-275Abstract Full Text Full Text PDF PubMed Scopus (1313) Google Scholar, 8Gowen L.C. Avrutskaya A.V. Latour A.M. Koller B.H. Leadon S.A. Science. 1998; 281: 1009-1012Crossref PubMed Scopus (449) Google Scholar). BRCA1 is a large gene of 24 exons that encodes a 1,863-amino acid protein (1Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Ahrshman K. Tavigian S. Liu Q. Cochran C. Bennett L.M. Ding W. Bell R. Rosenthal J. Hussey C. Tran T. McClure M. Frye C. Hattier T. Phelps R. Haugen-Strano A. Katcher H. Yakumo K. Gholmai Z. Shaffer D. Stone S. Bayer S. Wray C. Bogden R. Dayananth P. Ward J. Tonin P. Narod S. Bristow P.K. Norris F.H. Helvering L. Morrison P. Rosteck P. Lai M. Barrett J.C. Lewis C. Neuhausen S. Cannon-Albright L. Goldgar D. Wiseman R. Kamb A. Skolnick M.H. Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar). The BRCA1 protein contains several protein-interaction domains: an NH2-terminal RING domain common to many regulatory proteins (1Miki Y. Swensen J. Shattuck-Eidens D. Futreal P.A. Ahrshman K. Tavigian S. Liu Q. Cochran C. Bennett L.M. Ding W. Bell R. Rosenthal J. Hussey C. Tran T. McClure M. Frye C. Hattier T. Phelps R. Haugen-Strano A. Katcher H. Yakumo K. Gholmai Z. Shaffer D. Stone S. Bayer S. Wray C. Bogden R. Dayananth P. Ward J. Tonin P. Narod S. Bristow P.K. Norris F.H. Helvering L. Morrison P. Rosteck P. Lai M. Barrett J.C. Lewis C. Neuhausen S. Cannon-Albright L. Goldgar D. Wiseman R. Kamb A. Skolnick M.H. Science. 1994; 266: 66-71Crossref PubMed Scopus (5211) Google Scholar), two tandem copies of the BRCT (BRCA1 carboxyl terminus) motif at the COOH terminus (9Koonin E.V. Altschul S.F. Bork P. Nat. Genet. 1996; 13: 266-267Crossref PubMed Scopus (358) Google Scholar), and both nuclear import (10Chen C.-F., Li, S. Chen Y. Chen P.-L. Sharp Z.D. Lee W.-H. J. Biol. Chem. 1996; 271: 32863-32868Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 11Thakur S. Zhang H.B. Peng Y., Le, H. Carroll B. Ward T. Yao J. Farid L.M. Couch F.J. Wilson R.B. Weber B.L. Mol. Cell. Biol. 1997; 17: 444-452Crossref PubMed Scopus (224) Google Scholar) and export signals (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). The BRCT domain is found in a variety of proteins, including 53BP1, RAD9, RAD4, Crb2, and RAP1, all of which are associated with cell cycle regulation and DNA repair (13Callebaut I. Mornon J.P. FEBS Lett. 1997; 400: 25-30Crossref PubMed Scopus (483) Google Scholar). The BRCT motifs of BRCA1 appear to be critical for its transcription activation function (3Chapman M.S. Verma I.M. Nature. 1996; 382: 678-679Crossref PubMed Scopus (435) Google Scholar, 14Monteiro A.N.A. August A. Hanafusa H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13595-13599Crossref PubMed Scopus (427) Google Scholar), and cancer mutations in this COOH-terminal region impair transcriptional activity (3Chapman M.S. Verma I.M. Nature. 1996; 382: 678-679Crossref PubMed Scopus (435) Google Scholar, 15Welcsh P.L. Owens K.N. King M.-C. Trends Genet. 2000; 16: 69-74Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). This is likely due to altered association with specific proteins, such as the RNA polymerase II holoenzyme, which normally interacts with the COOH terminus of BRCA1 (16Scully R. Anderson S.F. Chao D.M. Wei W., Ye, L. Young R.A. Livingston D.M. Parvin J.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5605-5610Crossref PubMed Scopus (417) Google Scholar). The NH2-terminal RING domain of BRCA1 mediates association with proteins including BARD1 (17Wu L.C. Wang Z.W. Tsan J.T. Spillman M.A. Phung A., Xu, X.L. Yang M.C. Hwang L.Y. Bowcock A.M. Baer R. Nat. Genet. 1996; 14: 430-440Crossref PubMed Scopus (614) Google Scholar) and BAP1 (18Jensen D.E. Proctor M. Marquis S.T. Gardner H.P., Ha, S.I. Chodosh L.A. Ishov A.M. Tommerup N. Vissing H. Sekido Y. Minna J. Borodovsky A. Schultz D.C. Wilkinson K.D. Maul G.G. Barlev N. Berger S.L. Prendergast G.C. Rauscher III, F.J. Oncogene. 1998; 16: 1097-1112Crossref PubMed Scopus (567) Google Scholar). BARD1 is similar in primary structure to BRCA1, in that it also contains an NH2-terminal RING finger and two COOH-terminal BRCT domains (17Wu L.C. Wang Z.W. Tsan J.T. Spillman M.A. Phung A., Xu, X.L. Yang M.C. Hwang L.Y. Bowcock A.M. Baer R. Nat. Genet. 1996; 14: 430-440Crossref PubMed Scopus (614) Google Scholar). BRCA1 and BARD1 interact via their RING domains (19Meza J.E. Brzovic P.S. King M.-C. Klevit R.E. J. Biol. Chem. 1999; 274: 5659-5665Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar), and co-localize in discrete nuclear dots during S-phase of the cell cycle (20Jin Y., Xu, X.L. Yang M.-C.W. Wei F. Ayi T.-C. Bowcock A.M. Baer R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12075-12080Crossref PubMed Scopus (155) Google Scholar), and in DNA damage-inducible nuclear foci thought to be involved in DNA repair/replication (6Scully R. Chen J. Ochs R.L. Keegan K. Hoekstra M. Feunteun J. Livingston D.M. Cell. 1997; 90: 425-435Abstract Full Text Full Text PDF PubMed Scopus (805) Google Scholar). The BRCA1-BARD1 complex has recently been shown to exhibit ubiquitin ligase activity that is disrupted by BRCA1 breast cancer-associated RING finger mutations (21Lorick K.L. Jensen J.P. Fang S. Ong A.M. Hatakeyama S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11354-11369Crossref Scopus (935) Google Scholar, 22Hashizume R. Fukuda M. Maeda I. Nishikawa H. Oyake D. Yabuki Y. Ogata H. Ohta T. J. Biol. Chem. 2001; 276: 14537-14540Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 23Ruffner H. Joazeiro C.A.P. Hemmati D. Hunter T. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 5134-5139Crossref PubMed Scopus (306) Google Scholar), implicating BARD1 as a regulator of BRCA1 function and tumor suppressor activity. In recent years, the subcellular localization of BRCA1 has been controversial (24Chen Y. Chen C.-F. Riley D.J. Allred D.C. Chen P.-L. Hoff D.V. Osborne C.K. Lee W.-H. Science. 1995; 270: 789-791Crossref PubMed Scopus (304) Google Scholar, 25Scully R. Ganesan S. Brown M. Caprio J.A.D. Cannistra S.A. Feunteun J. Schnitt S. Livingston D.M. Science. 1996; 272: 123-125Crossref PubMed Scopus (71) Google Scholar, 26Wilson C.A. Ramos L. Villasenor M.R. Anders K.H. Press M.F. Clarke K. Karlan B. Chen J.-J. Scully R. Livingston D. Zuch R.H. Kanter M.H. Cohen S. Calzone F.J. Slamon D.J. Nat. Genet. 1999; 21: 236-240Crossref PubMed Scopus (366) Google Scholar), due in part to variable specificity of BRCA1 antibodies. BRCA1 is now generally regarded as a nuclear protein (4Ruffner H. Verna I.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7138-7143Crossref PubMed Scopus (178) Google Scholar,26Wilson C.A. Ramos L. Villasenor M.R. Anders K.H. Press M.F. Clarke K. Karlan B. Chen J.-J. Scully R. Livingston D. Zuch R.H. Kanter M.H. Cohen S. Calzone F.J. Slamon D.J. Nat. Genet. 1999; 21: 236-240Crossref PubMed Scopus (366) Google Scholar) that accumulates in discrete nuclear foci in epithelial cell lines (6Scully R. Chen J. Ochs R.L. Keegan K. Hoekstra M. Feunteun J. Livingston D.M. Cell. 1997; 90: 425-435Abstract Full Text Full Text PDF PubMed Scopus (805) Google Scholar, 25Scully R. Ganesan S. Brown M. Caprio J.A.D. Cannistra S.A. Feunteun J. Schnitt S. Livingston D.M. Science. 1996; 272: 123-125Crossref PubMed Scopus (71) Google Scholar, 26Wilson C.A. Ramos L. Villasenor M.R. Anders K.H. Press M.F. Clarke K. Karlan B. Chen J.-J. Scully R. Livingston D. Zuch R.H. Kanter M.H. Cohen S. Calzone F.J. Slamon D.J. Nat. Genet. 1999; 21: 236-240Crossref PubMed Scopus (366) Google Scholar), in particular those derived from breast tumors. The known tumor suppressor functions of BRCA1 also occur most in the nucleus (15Welcsh P.L. Owens K.N. King M.-C. Trends Genet. 2000; 16: 69-74Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar,27Scully R. Livingston D.M. Nature. 2000; 408: 429-432Crossref PubMed Scopus (548) Google Scholar). BRCA1 contains two SV40-like nuclear localization signals (NLSs1;503KRKRRP508 and606PKKNRLRRKS615) that facilitate nuclear import by the importin α/β receptor pathway (10Chen C.-F., Li, S. Chen Y. Chen P.-L. Sharp Z.D. Lee W.-H. J. Biol. Chem. 1996; 271: 32863-32868Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 11Thakur S. Zhang H.B. Peng Y., Le, H. Carroll B. Ward T. Yao J. Farid L.M. Couch F.J. Wilson R.B. Weber B.L. Mol. Cell. Biol. 1997; 17: 444-452Crossref PubMed Scopus (224) Google Scholar). Although BRCA1 locates predominantly to the nucleus, it contains an NH2-terminal nuclear export signal (NES) and can shuttle between nucleus and cytoplasm (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). The BRCA1 splice variants, BRCA1 Δ11b (28Wilson C.A. Payton M.N. Elliot G.S. Buaas F.W. Cajulis E.E. Grosshans D. Ramos L. Reese D.M. Slamon D.J. Clazone F.J. Oncogene. 1997; 14: 1-16Crossref PubMed Scopus (180) Google Scholar) and BRCA1 Δ672–4095 (11Thakur S. Zhang H.B. Peng Y., Le, H. Carroll B. Ward T. Yao J. Farid L.M. Couch F.J. Wilson R.B. Weber B.L. Mol. Cell. Biol. 1997; 17: 444-452Crossref PubMed Scopus (224) Google Scholar), are highly expressed in many cells, and yet even though they lack exon 11 which contains the two nuclear localization signals (28Wilson C.A. Payton M.N. Elliot G.S. Buaas F.W. Cajulis E.E. Grosshans D. Ramos L. Reese D.M. Slamon D.J. Clazone F.J. Oncogene. 1997; 14: 1-16Crossref PubMed Scopus (180) Google Scholar), several groups have detected BRCA1 Δ11b in the nucleus (28Wilson C.A. Payton M.N. Elliot G.S. Buaas F.W. Cajulis E.E. Grosshans D. Ramos L. Reese D.M. Slamon D.J. Clazone F.J. Oncogene. 1997; 14: 1-16Crossref PubMed Scopus (180) Google Scholar, 29Chai Y. Cui J.-Q. Shao N. Reddy E.S.P. Rao V.N. Oncogene. 1999; 18: 263-268Crossref PubMed Scopus (157) Google Scholar, 30Huber L.J. Yang T.W. Sarkisian C.J. Master S.R. Deng C.X. Chodosh L.A. Mol. Cell. Biol. 2001; 21: 4005-4015Crossref PubMed Scopus (94) Google Scholar). In particular, Huber et al.(30Huber L.J. Yang T.W. Sarkisian C.J. Master S.R. Deng C.X. Chodosh L.A. Mol. Cell. Biol. 2001; 21: 4005-4015Crossref PubMed Scopus (94) Google Scholar) examined localization of the endogenous BRCA1 exon 11 splice variant expressed in mouse embryo fibroblasts, and showed that this NLS-deficient protein enters the nucleus and assembles into DNA damage-inducible nuclear foci almost identical to that of full-length BRCA1. Given the importance of nuclear targeting for BRCA1 function, we have searched for alternative BRCA1 nuclear import pathways that act independent of its nuclear import signals. In this study, we show that transiently expressed BRCA1 splice variant and full-length forms of BRCA1 that lack an NLS can enter the nucleus. This novel NLS-independent import process is dependent on the NH2-terminal RING domain region of BRCA1, a sequence well conserved in all BRCA1 splice variants. The RING-mediated import pathway is facilitated by the BRCA1-binding partner, BARD1. BARD1 not only translocates BRCA1 into the nucleus, but retains it there by masking its nuclear export signal, which lies buried within the BRCA1-BARD1 binding interface (31Brzovic P.S. Rajagopal P. Hoyt D.W. King M.C. Klevit R.E. Nat. Struct. Biol. 2001; 8: 833-837Crossref PubMed Scopus (383) Google Scholar). Our findings identify a key “chaperone” role for BARD1 in promoting BRCA1 nuclear entry and formation of DNA damage-inducible BRCA1 nuclear foci, and provide an explanation for the DNA damage response observed for cellular BRCA1 splice variants (30Huber L.J. Yang T.W. Sarkisian C.J. Master S.R. Deng C.X. Chodosh L.A. Mol. Cell. Biol. 2001; 21: 4005-4015Crossref PubMed Scopus (94) Google Scholar), which contains a RING domain but no NLS sequence. Our results also help resolve much of the controversy concerning BRCA1 subcellular localization, and shed light on a new and unexpected regulatory role of BARD1. MCF-7 and T47D human breast cancer cells, and HBL100 immortalized human breast epithelial cells, were maintained in Dulbecco's modified Eagle's media supplemented with 10% fetal calf serum. All cells were grown at 37 °C in a humidified 5% CO2 atmosphere. Cells were seeded onto sterile glass coverslips and transfected at 50–60% confluency with 1 to 2 μg of plasmid DNA using LipofectAMINE Reagent (Invitrogen) according to the manufacturer's instructions. At 6 h post-transfection, the transfection mixture was removed and replaced with Dulbecco's modified Eagle's media containing 10% fetal calf serum. Cells were fixed and processed 30 h post-transfection for fluorescence microscopy. When required, transfected cells were treated with leptomycin B at a final concentration of 6 ng/ml for 4 h prior to fixation. Construction of the expression vectors pF-BRCA1, pYFP-BRCA1, pYFP-BRCA1(Δ306–1312), pBRCA1-NESm, pBRCA1(Δ1–70), and pYFP-CRM1 were described previously (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). The YFP cDNA was excised as aNotI fragment from the above YFP-fusion constructs to create untagged pBRCA1(Δ306–1312), pBRCA1(Δ1–70), and pBRCA1-NESm plasmids. To create pF-CRM1, the CRM1 cDNA was excised from the CRM1.pET16b plasmid (provided by Dr. M. Yoshida, Tokyo) and inserted into the pFlag-CMV2 vector (Eastman Kodak Co.) as aKpnI/BamHI fragment. We used a PCR strategy to introduce site-directed mutations into the two nuclear localization signals of BRCA1 cDNA. The first PCR introduced mutations into NLS1 in wild-type BRCA1 using primers MF1 (forward) and MF2 (reverse; codons in bold represent the amino acids Lys503, Arg504, Lys505, and Arg506 that were mutated to alanine). The primer sequences are shown in Table I. A second overlapping PCR product was generated using primers MF6 (forward) and MF7 (reverse). The two DNA products (MF1/2 and MF6/7) were then annealed and amplified with primers MF1 and MF7, and the resulting PCR fragment was gel purified and inserted into wild-type BRCA1 as anAflII/KpnI fragment, to generate pBRCA1-NLSm1.Table ISequence of the oligonucleotides used in plasmid constructionPlasmidOligonucleotide5′→3′ sequenceBRCA1-NLSmMF1CACTCCAAATCAGTAGAGMF2GCCTGATGTAGGTCTCGCTGCAGCCGCTAATTTATTTGTGAGGGGMF3AAGCACCTAAAGCGAATGCGCTGGCGGCGAAGTCTTCTACCAGGCMF5TATCAATTTGCAATTCAGMF6ATCGGAAGAAGGCAAGCCMF7CTAGAGTGCTAACTTCCCBRCA1(C61G)BH986TCTGCAGCGGCCGCCTCGAGAATGGATTTATCTGCTCTTBH9865GGGCCTTCACAGGGTCCTTTATGTAAGBH9849TTGACTAAAACGCGTACTTTCTTGTAGBH9832AACGGTATCTTCAGABRCA1-(1–304)MF17AATTCGACTACAAAGACGATGACGACAAGTGACATMF18CGATGTCACTTGTCGTCATCGTCTTTGTAGTCGBRCA1(NESmC)MF14CTAGCCTTGTTGAAGAGCTATTGAAAATCATTTGTGCTTTTCAGCTTGACACAGGTTTGCMF15TAGCCCAACCTGTGTCAAGCTGAAAAGCACAAATGATTTTCAATAGCTCTTCAACAAGCBARD1(Δ1–95)JR35TACTAAGCGGCCGCCTTGAAGATAAATAGACBH9882GTGGGCACTGGAGTGGCA Open table in a new tab BRCA1-NLSm1 was used as template for two PCR reactions using primers MF3 (forward) and MF7 (reverse), where the codons in bold in the MF3 sequence represent amino acids Lys608, Arg610, Arg612, and Arg613 changed to alanine. A second PCR (primers MF1 and MF5) was annealed with the first and amplified with primers MF1 and MF7. This large PCR fragment was inserted into wild-type BRCA1 as anAflII/KpnI fragment. This finally generated the plasmid pBRCA1-NLSm, which contains mutations in the two BRCA1 NLSs. A PCR-based strategy was also used to introduce the C61G mutation into the RING domain of BRCA1. Two PCR fragments were generated. First, we PCR amplified a fragment at the NH2 terminus of wild-type BRCA1, using primers BH986 (forward) and BH9849 (reverse, see Table I). A second PCR product was amplified with primers BH9865 (forward) and BH9832 (reverse). In the BH9865 sequence, the codon in bold represents the C61G amino acid mutation. The two PCR products were annealed and amplified with BH986 and BH9832 to generate a fragment that was inserted into pCR-SCRIPT-BRCA1 (provided by Dr. J. Holt, Nashville) as a NotI/AatII fragment. The NotI restriction site is underlined in the BH986 sequence (see Table I). ANotI/EcoRI fragment containing the C61G mutation was then subcloned into pF-BRCA1 to produce pBRCA1(C61G). pBRCA1-(1–304) was made by replacing theEcoRI/ClaI fragment of BRCA1 cDNA with a 27-bp linker sequence, generated by annealing the two oligonucleotides MF17 and MF18. The EcoRI and ClaI restriction sites are underlined in the oligonucleotide sequences (see Table I). pBRCA1(NESmC) is a mutant in which the BRCA1 NES (two annealed complimentary oligonucleotides MF14 and MF15) was inserted in-frame into the NheI site (underlined in MF14 and MF15) of pBRCA1-NESm (see Table I). To inactivate the nuclear export signal in pBRCA1-NLSm, pBRCA1(Δ306–1312), and pBRCA1-(1–304), a BRCA1 mutated NES sequence (L86A,I90A) was subcloned as aNotI/EcoRI fragment into these constructs (see Fig. 1A). Full-length BARD1 cDNA and CtIP cDNA were subcloned into the mammalian expression vector, pFlag-CMV2, asNotI/XbaI and NotI/NheI fragments, respectively. An NH2-terminal deletion mutant of BARD1-(Δ1–95) was created by replacing aNotI/NheI DNA fragment from the BARD1 cDNA with a PCR fragment generated with the oligonucleotides, JR35 (forward primer) and BH9882 (reverse primer). The NotI restriction site is underlined in the JR35 sequence (Table I). YFP-tagged BRCA1-NLSm and CtIP expression vectors were generated by inserting the YFP cDNA as a NotI fragment (in-frame) at the 5′ end of the cDNA. The YFP gene was also inserted into the pFlag-CMV2 vector as a NotI fragment to generate the expression plasmid referred to as “YFP” in Fig. 3D. All plasmid mutations were confirmed by DNA sequencing. Immunostaining was carried out as described (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). Cells expressing YFP-tagged proteins were fixed in 3.7% formalin/phosphate-buffered saline for 15 min at room temperature, washed, and then mounted for direct detection of the autofluorescent protein. Untagged ectopic BRCA1 was detected by immunofluorescence using monoclonal antibodies Ab-1 and Ab-4 (Oncogene Research), which recognize an epitope in the amino terminus and the central portion of BRCA1, respectively. BRCA1-bound antibody was detected with fluorescein isothiocyanate-conjugated goat anti-mouse secondary antibody (Sigma). BARD1, HA-c-Myc, p53, and HA-Rad51 were detected with polyclonal antibodies 699D (20Jin Y., Xu, X.L. Yang M.-C.W. Wei F. Ayi T.-C. Bowcock A.M. Baer R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12075-12080Crossref PubMed Scopus (155) Google Scholar) diluted 1:800, HA-probe Y-11 (Santa Cruz) was diluted 1:500, p53 FL-393 (Santa Cruz) was diluted 1:200, and HA-probe Y-11 (Santa Cruz) was diluted 1:500 in blocking solution, respectively. Rb was detected with the monoclonal antibody anti-Rb 14001A (Pharminogen) diluted 1:300 in blocking solution, respectively. Antibody bound to BARD1, c-Myc, p53, Rb, or Rad51 was detected with biotin-conjugated secondary antibodies (Santa Cruz) and Texas Red-avidin D (Vector Laboratories). Cell nuclei were counterstained with the chromosome dye Hoechst 33285 (Sigma). The subcellular localization of each ectopic protein was determined by scoring cells using an Olympus BX40 epifluorescence microscope. Confocal cross-sections were captured using an Optiscan confocal microscope, and image processing and quantification of nuclear fluorescence using the NIH Image software was carried out as previously described (32Henderson B.R. Nat. Cell Biol. 2000; 2: 653-660Crossref PubMed Scopus (406) Google Scholar). Cells expressing YFP-BRCA1 and BARD1 proteins were detected by immunostaining as described above. One hour before fixation the appropriate samples were treated with 0.01% methyl methanesulfonate (MMS). YFP-BRCA1 transfected cells were assessed by immunofluorescence microscopy and scored as containing either no nuclear foci, 50 BRCA1 nuclear foci. At least 90 YFP-BRCA1 transfected cells were scored. HBL100, MCF-7, and T47D cells were separated into nuclear and cytoplasmic fractions by using the NE-PER extraction kit (Pierce) according to the manufacturer's instructions. Protein concentrations in nuclear and cytoplasmic fractions were determined using the Bio-Rad dye binding assay. Cell extracts were denatured, separated by 8% SDS-polyacrylamide gel electrophoresis, and transferred to polyvinylidene difluoride membranes. The Western blot filters were blocked in blocking buffer (1% fetal calf serum, 5% dried milk in phosphate-buffered saline containing 0.1% Tween 20) and probed with the primary antibody. BRCA1 was detected with either the monoclonal antibody Ab-1 diluted 1:200 or Ab-4 diluted 1:200, followed by incubation with the horseradish peroxidase-conjugated secondary antibody (1:1000). BARD1 was detected with either the monoclonal antibody EE#6 (Baer Lab) diluted 1:800 or the polyclonal antibody 42C (17Wu L.C. Wang Z.W. Tsan J.T. Spillman M.A. Phung A., Xu, X.L. Yang M.C. Hwang L.Y. Bowcock A.M. Baer R. Nat. Genet. 1996; 14: 430-440Crossref PubMed Scopus (614) Google Scholar) diluted 1:800. Blotted proteins were visualized using the ECL detection system (Amersham Biosciences). Rainbow color markers (Amersham Biosciences) were used as molecular size standards. Several groups have recently detected the NLS-deficient BRCA1 splice variant, BRCA1 Δ11b, in the nucleus of cells (26Wilson C.A. Ramos L. Villasenor M.R. Anders K.H. Press M.F. Clarke K. Karlan B. Chen J.-J. Scully R. Livingston D. Zuch R.H. Kanter M.H. Cohen S. Calzone F.J. Slamon D.J. Nat. Genet. 1999; 21: 236-240Crossref PubMed Scopus (366) Google Scholar, 28Wilson C.A. Payton M.N. Elliot G.S. Buaas F.W. Cajulis E.E. Grosshans D. Ramos L. Reese D.M. Slamon D.J. Clazone F.J. Oncogene. 1997; 14: 1-16Crossref PubMed Scopus (180) Google Scholar, 29Chai Y. Cui J.-Q. Shao N. Reddy E.S.P. Rao V.N. Oncogene. 1999; 18: 263-268Crossref PubMed Scopus (157) Google Scholar, 30Huber L.J. Yang T.W. Sarkisian C.J. Master S.R. Deng C.X. Chodosh L.A. Mol. Cell. Biol. 2001; 21: 4005-4015Crossref PubMed Scopus (94) Google Scholar). We confirmed by Western blot analysis that endogenous BRCA1 Δ11b is present in the nuclear fraction of HBL100 cells (see Fig.1A). This prompted us to re-investigate the contribution of the BRCA1 NLS sequences in nuclear import. We first examined the subcellular localization of two NLS-deficient forms of BRCA1: a deletion mutant (Δ306–1312) that lacks exon 11 and full-length BRCA1 carrying site-directed mutations that inactivate both NLSs (BRCA1-NLSm) (see Fig. 1B). In transfected breast epithelial cells, the localization of ectopic BRCA1 was scored as nuclear (N), nuclear/cytoplasmic (NC), or cytoplasmic (C). Wild-type BRCA1 consistently displayed a mixed nuclear/cytoplasmic distribution (>80% NC) in different cell lines (see Table II and Fig. 1C). In contrast, BRCA1(Δ306–1312) was exclusively cytoplasmic in >90% of MCF-7 and HBL100 cells, but displayed partial nuclear staining in >40% of T47D cells (Table II). BRCA1-NLSm showed a similar distribution pattern to Δ306–1312, confirming that BRCA1 can enter the nucleus, albeit less efficiently, in the absence of an NLS.Table IISubcellular localization of wild-type and mutant forms of BRCA1 in breast epithelial cell linesBRCA1HBL100MCF-7T47D%N%NC%C%N%NC%C%N%NC%CWild type12.283.34.58.285.56.314.882.52.7NESm64.535.5076.123.00.919.577.92.4NLSm03.596.504.695.44.633.562.0NLSm/NESm1.293.35.50.292.96.91.694.63.8Δ306–131204.595.507.792.30.841.457.8Δ306–1312/NESm043.856.2043.556.5065.834.2 Open table in a new tab To test for nuclear import of BRCA1 in the absence of opposing nuclear export activity, we introduced a site-directed NES mutation (L86A and I90A) (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar) into each BRCA1 construct, and compared its effect on BRCA1 localization (see Fig. 1, B and C). Introduction of the NES mutation shifted wild-type BRCA1 to the nucleus in transfected MCF-7 cells (Fig. 1C), as previously reported (12Rodriguez J.A. Henderson B.R. J. Biol. Chem. 2000; 275: 38589-38596Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). More dramatic was the effect of the NES mutation on BRCA1-NLSm, which was no longer restricted to the cytoplasm, but displayed at least some nuclear stai

Referência(s)