Portal de Periódicos da CAPES

Somatic Mutation Analysis in NF1 Café au lait Spots Reveals Two NF1 Hits in the Melanocytes

2007; Elsevier BV; Volume: 128; Issue: 4 Linguagem: Inglês

10.1038/sj.jid.5701095

1523-1747

Sofie De Schepper, Ophélia Maertens, Tom Callens, J.M. Naeyaert, Jo Lambert, Ludwine Messiaen,

Ocular Oncology and Treatments

Café au lait macule loss of heterozygosity long range neurofibromatosis type 1 TO THE EDITOR Neurofibromatosis type 1 (NF1), a common autosomal dominant disorder caused by mutations in the NF1 gene, is characterized by presence of neurofibromas, skin-fold freckling, café au lait macules (CALMs) and iris Lisch nodules. So far, little is known about the etiopathogenesis of NF1-related CALMs. The NF1 gene, like other tumor suppressor genes, follows the Knudson two-hit hypothesis of tumor formation, implying that, apart from the germline NF1 mutation, an additional somatic inactivation of the remaining wild-type NF1 allele is needed to initiate tumor formation (Knudson, 1971Knudson Jr, A.G. Mutation and cancer: statistical study of retinoblastoma.Proc Natl Acad Sci USA. 1971; 68: 820-823Crossref PubMed Scopus (5203) Google Scholar). In general, somatic inactivation of a tumor suppressor gene can occur via three major mechanisms: loss of heterozygosity (LOH), somatic intragenic mutations, and promoter hypermethylation. One study addressed somatic NF1 inactivation in 11 CALM melanocyte cultures and found both NF1 alleles to be present (Eisenbarth et al., 1997Eisenbarth I. Assum G. Kaufmann D. Krone W. Evidence for the presence of the second allele of the neurofibromatosis type 1 gene in melanocytes derived from café au lait macules of NF1 patients.Biochem Biophys Res Commun. 1997; 237: 138-141Crossref PubMed Scopus (19) Google Scholar). However, this study only searched for LOH, and not for minor lesion somatic mutations. Therefore, we now performed a comprehensive search for NF1 somatic alterations in melanocytes, keratinocytes, and fibroblasts obtained from NF1 CALMs, allowing identification of LOH, copy-number changes of one to multiple exons, and minor lesion mutations. Three keratinocyte, 11 fibroblast and five melanocyte CALM-derived primary cell cultures of 13 patients with a known germline NF1 mutation were examined, in addition to six melanocyte cultures from neonatal foreskin of healthy control persons. Patients were diagnosed according to the NIH diagnostic criteria. Skin biopsies from NF1 CALMs were taken after written informed consent, and guided by the institutional ethics committee and the Declaration of Helsinki Principles. Skin biopsies and cell cultures were performed essentially as described in De Schepper et al., 2006De Schepper S. Boucneau J. Vander Haeghen Y. Messiaen L. Naeyaert J.M. Lambert J. Café au lait spots in neurofibromatosis type 1 and in healthy control individuals: hyperpigmentation of a different kind?.Arch Dermatol Res. 2006; 297: 439-449Crossref PubMed Scopus (46) Google Scholar. For genomic DNA (gDNA) extraction (QiaAmp, Belelux, Spoorstraat, Venlo, The Netherlands) or Gentra Puregene (Qiagen, Venlo, The Netherlands), RNA isolation (Rneasy; Qiagen), and cDNA synthesis (iScript; BioRad) the manufacturer's instructions were followed. LOH in the NF1 gene region was evaluated by genotyping two telomeric microsatellite markers and four within the NF1 gene as described previously (Wimmer et al., 2006Wimmer K. Yao S. Claes K. Kehrer-Sawatzki H. Tinschert S. De Raedt T. et al.Spectrum of single and multiexon NF1 copy number changes in a cohort of 1100 unselected NF1 patients.Genes Chromosomes Cancer. 2006; 45: 265-276Crossref PubMed Scopus (110) Google Scholar). Primer sequences can be found in Table 1. Fragments for all loci were compared between DNA extracted from peripheral blood leukocytes from each patient and the CALM derived cell cultures.Table 1Primers for microsatellite markers used in LOH analysisSequenceMarkersCAAGAAAAGCTAATATCGGCAluIGGAACCTTAAGTTCACTTAGCTCCTAACATTTATTAACCTTAIVS38 GT53.0CAGAGCAAGACCCTGTCTCCCATACCTAGTTCTTAAAGTCTGTIVS27 AC33.1TAACAATTGTGGAACTGCAGCAATTATTCTGAAGCAGGAGAATTGCIVS27 TG24.8CTAAAGATGTCTATAACAGGTCTTCCATGGCTGCTAACATC3′ NF1-1CCCTGTGGTGTAGTTCAACAGGTGTGTGTATATGTGCGTG3′ NF1-3GGTACAGCATATCCACAAGGLOH, loss of heterozygosity; NF1, neurofibromatosis type 1. Open table in a new tab LOH, loss of heterozygosity; NF1, neurofibromatosis type 1. NF1 gene somatic mutation analysis was performed essentially as described in Vandenbroucke et al., 2004Vandenbroucke I. Van Doorn R. Callens T. Cobben J.M. Starink T.M. Messiaen L. Genetic and clinical mosaicism in a patient with neurofibromatosis type 1.Hum Mutat. 2004; 114: 284-290Google Scholar. All mutations found at the cDNA level were confirmed on gDNA. If no somatic hit was detected after sequencing of the entire coding region, multiplex ligation probe assay analysis using the P081/P082 assay (MRC Holland) was performed as described (Wimmer et al., 2006Wimmer K. Yao S. Claes K. Kehrer-Sawatzki H. Tinschert S. De Raedt T. et al.Spectrum of single and multiexon NF1 copy number changes in a cohort of 1100 unselected NF1 patients.Genes Chromosomes Cancer. 2006; 45: 265-276Crossref PubMed Scopus (110) Google Scholar). In order to determine whether both NF1 mutations detected in melanocyte cultures derived from the CALM of patient NF-008 resided on different alleles, cloning experiments were performed using the pCR2.1-TOPO Vector (Invitrogen, Merelbeke, Belgium). LOH analysis could not detect a somatic event in any of the investigated samples. All patients displaying heterozygosity for at least one microsatellite marker in blood lymphocytes did not show LOH in the CALM-derived cells (fibroblasts, keratinocytes, and melanocytes) (Table 2). Since the six polymorphic markers span the NF1 gene, this analysis excludes loss of the wild-type NF1 allele in NF1-related CALMs.Table 2Summary of demographic patient data and resultsNF1 patientsSex and age (years)Cell types culturedResults LOHResults LR RT–PCR/direct sequencingAluIVS 38GT 53.0IVS 27 TG 24.8IVS 27 AC 33.13′NF1-13′NF1-3Germline mutationSecond hit mutationNF-002Male (53)FBNIHHHNIHc.1721+1G>A (skipping exon 11)NoneNF-003Male (48)FBNIHHHHNIc.3709-??_3974+?? del (Deletion E22 &23.1)NoneNF-004Female (37)FBNIHNINIHNIc.2851-2A>G (skipping exon 17)NoneNF-006Female (25)KCNIHNIHHNIc.4368-2A>G (skipping first 115 bp from E26)NoneNF-007Male (19)FBHHHHHNIc.3113+1G>A (skipping E18)NoneNF-001Female (36)KCNININIHHNIc.2887C>T (p.Q963X)NoneNF-012Female (49)MCNIHHHHHc.1541_1542delAGc.3721C>T (p.R1241X)KCNIHHHHHc.1541_1542delAGNoneFBNIHHHHHc.1541_1542delAGNoneNF-005Female (46)FBNIHHHNIHc.5122_5123 insGNoneNF-008Female (49)FBc.3525_3526delAANoneMCc.3525_3526delAAc.2269A>T (p.K757X)NF-010Female (35)FBNIHNINIHNIc.2681T>C (p.F894S)NoneNF-011Male (62)MCNIHNINIHNIc.2681T>C (p.F894S)Loss of expression of the WT allele; WT allele is present at the gDNA levelFBNIHNINIHNIc.2681T>C (p.F894S)NoneNF-013Female (22)MCHHHHHHc.4537C>T (p.R1513X)c.1721+542 A>G (splice mutation, leads to insertion of 176 bp from intron 11 in the transcript)FBHHHHHHc.4537C>T (p.R1513X)NoneNF-014Female (39)MCNINININININIc.2492_2493delCAc.4537C>T (p.R1513X)FBNINININiNiNic.2492_2493delCANoneFB, fibroblasts; H, heterozygous; KC, keratinocytes; LR, long range; MC, melanocytes; NF1, neurofibromatosis type 1; NI, not informative; RT–PCR, reverse transcription–PCR. Open table in a new tab FB, fibroblasts; H, heterozygous; KC, keratinocytes; LR, long range; MC, melanocytes; NF1, neurofibromatosis type 1; NI, not informative; RT–PCR, reverse transcription–PCR. Six normal skin melanocyte cultures obtained from healthy controls and cultured in exactly the same way as the NF1 CALM melanocyte samples were subjected to microsatellite marker and multiplex ligation probe assay analysis. Two NF1 copies were present in all melanocyte cultures and no copy-number changes were detected. The germline NF1 mutation was confirmed to be present in the 11 CALM-derived fibroblast cultures, the three keratinocyte cultures, and five melanocyte cultures. In addition, an additional NF1 mutation was identified in all CALM-derived melanocyte cultures. Three were nonsense mutations: c.2269 A>T (p.K757X), c.4537 C>T (p.R1513X), and c.3721C>T (p.R1241X). One was a splice mutation (c.1721+542A>G), increasing the strength of a cryptic splice donor site in intron 11, that gets used in conjunction with a cryptic intronic splice acceptor site, leading to insertion of 176 bp from intron 11 in the mature transcript. Finally, one culture showed loss of expression of the wild-type NF1 allele at the transcript level, however, no second hit mutation could be identified. The cause of the loss of expression of the wild-type allele and/or allelic drop-out is currently under further investigation. Two of the identified somatic mutations (p.R1241X and p.R1513X) have been reported previously as a germline mutation (Fahsold et al., 2000Fahsold R. Hoffmeyer S. Mischung C. Gille C. Ehlers C. Kücükceylan N. et al.Minor lesion mutational spectrum of the entire NF1 gene does not explain its high mutability but points to a functional domain upstream of the GAP-related domain.Am J Hum Genet. 2000; 66: 790-818Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar; Messiaen et al., 2000Messiaen L. Callens T. Mortier G. Beysen D. Vandenbroucke I. Van Roy N. et al.Exhaustive mutation analysis of the NF1 gene allows identification of 95% of mutations and reveals a high frequency of unusual splicing defects.Hum Mutat. 2000; 15: 541-555Crossref PubMed Scopus (382) Google Scholar, Origone et al., 2003Origone P. Bellini C. Sambarino D. Banelli B. Morcaldi G. La Rosa C. et al.Neurofibromatosis type 1 (NF1): identification of eight unreported mutations in NF1 gene in Italian patients.Hum Mutat. 2003; 22: 179-180Crossref PubMed Google Scholar; Upadhyaya et al., 2003Upadhyaya M. Majounie E. Thompson P. Han S. Consoli C. Krawczak M. et al.Three different pathological lesions in the NF1 gene originating de novo in a family with neurofibromatosis type 1.Hum Genet. 2003; 112: 12-17Crossref PubMed Scopus (22) Google Scholar). Cloning experiments demonstrated that for the CALM of patient NF-008 (c.3525_3526delAA and c.2269A>T), both NF1 mutations resided on different alleles. No NF1 gene mutations were detected in the six melanocyte cultures obtained from neonatal foreskin from healthy controls using comprehensive mutation analysis, and microsatellite analysis showed presence of two NF1 copies. The etiopathogenesis of neurofibroma formation in NF1 mouse models was recently ascribed to neurofibromin-deficient Schwann cells (NF1−/−) secreting a potent migratory stimulus (stem cell factor or Kit ligand) for NF1+/− mast cells (Ingram et al., 2000Ingram D.A. Yang F.C. Travers J.B. Wenning M.J. Hiatt K. New S. et al.Genetic and biochemical evidence that haploinsufficiency of the Nf1 tumor suppressor gene modulates melanocyte and mast cell fates in vivo.J Exp Med. 2000; 191: 181-188Crossref PubMed Scopus (147) Google Scholar; Yang et al., 2003Yang F.C. Ingram D.A. Chen S. Hingtgen C.M. Ratner N. Monk K.R. et al.Neurofibromin-deficient Schwann cells secrete a potent migratory stimulus for NF1+/− mast cells.J Clin Invest. 2003; 112: 1851-1861Crossref PubMed Google Scholar), implying a somatic second hit mutation of the NF1 gene in heterozygous Schwann cells as the initiating event for the development of a benign (plexiform) neurofibroma. This study wants to address whether a similar mechanism, based on neurofibromin deficiency due to a second hit mutation, is also applicable for the NF1 CALMs. Several researchers have tried to characterize CALMs histologically, but with conflicting results (Kawamura, 1956Kawamura V.T. Über die herkunft der naevuscellen and die genetische verwandtschaft zwischen pigmentzellnaevus, blauem naevus und Recklinghauser phakomatose.Hautartzt. 1956; 7: 7-14PubMed Google Scholar; Benedict et al., 1968Benedict P.H. Szabo G. Fitzpatrick T.B. Sinesi S.J. Melanotic macules in Albright's syndrome and neurofibromatosis.JAMA. 1968; 205: 618-626Crossref PubMed Scopus (122) Google Scholar; Johnson and Charneco, 1970Johnson B.L. Charneco D.L. Café au lait spot in Neurofibromatosis and in normal individuals.Arch Dermatol. 1970; 102: 442-446Crossref PubMed Scopus (61) Google Scholar; Takahashi, 1976Takahashi M. Studies on café au lait spots in neurofibromatosis and pigmented macules of nevus spilus.Tohoku J Exp Med. 1976; 118: 255-273Crossref PubMed Scopus (28) Google Scholar; Frenck and Marazzi, 1984Frenck E. Marazzi A. Neurofibromatosis of von recklinghausen: a quantitative study of the epidermal keratinocyte and melanocyte populations.J Invest Dermatol. 1984; 83: 23-25Crossref PubMed Scopus (26) Google Scholar; Ishida and Jimbow, 1987Ishida O. Jimbow K. A computed image analyzing system for quantitation of melanocyte morphology in café au lait macules of neurofibromatosis.J Invest Dermatol. 1987; 88: 287-291Abstract Full Text PDF PubMed Google Scholar; Grossman et al., 1995Grossman M.C. Anderson R.R. Farinelli W. Flotte T.J. Grevelink J.M. Treatment of café au lait macules with lasers: a clinicopathologic correlation.Arch Dermatol. 1995; 131: 1416-1420Crossref PubMed Scopus (68) Google Scholar). We recently demonstrated that the melanocyte density is increased in NF1 CALM skin compared with NF1 normal skin and healthy control CALM, and normal skin (De Schepper et al., 2006De Schepper S. Boucneau J. Vander Haeghen Y. Messiaen L. Naeyaert J.M. Lambert J. Café au lait spots in neurofibromatosis type 1 and in healthy control individuals: hyperpigmentation of a different kind?.Arch Dermatol Res. 2006; 297: 439-449Crossref PubMed Scopus (46) Google Scholar). In line with this study, an NF1 second hit in NF1 CALM melanocytes was found in 5/5 available melanocyte cultures, but not in the keratinocytes or fibroblasts from these café au lait spots. No NF1 mutations were found in the melanocyte cultures from neonatal foreskin from healthy control persons. This study confirms and extends the findings of a second hit mutation in melanocyte cultures from a segmental and mosaic NF patient (Maertens et al., 2007Maertens O. De Schepper S. Vandesompele J. Heyns I. Janssens S. Speleman F. et al.Molecular dissection of isolated disease features in neurofibromatosis type 1.Am J Hum Genet. 2007; 81: 243-251Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). We conclude from our study that there is a statistically significant difference (P<0.05) in the frequency of second hit mutations in CALM melanocytes (5/5) compared with CALM fibroblasts (0/11) (P=0.000, Fisher's Exact Test), and with CALM keratinocytes (0/3) (P=0.018, Fisher's Exact Test). So far no evidence points to a significant contribution of LOH to CALM formation. Six healthy control normal skin melanocyte cultures, which were analyzed as negative controls did not show any somatic NF1 alterations. The finding of second hit mutations in NF1 CALM melanocytes improves our understanding of the etiopathogenic mechanisms underlying the formation of this hyperpigmentary disorder, and will boost further research aiming to understand the phenotypes associated with somatic mutations in melanocytes. The authors state no conflict of interest. We thank Martine De Mil for assisting with the cell culture and Marie-Chantal Herteleer and Joachim Boucneau for technical assistance. SDS is a research fellow of the Fund for Scientific research-Flanders (grant number G.0292.02). We thank the Wilderman family for their support (to LM) of research on CALMs in NF1 patients. This work is supported by an Interuniversitary Attraction Poles grant from the Federal Office for Scientific, Technical and Cultural Affairs, Belgium (2002–2006; P5/25), and by a Concerted Action Grant from the UGent (OM). This work was a collaboration between the Ghent University (Belgium) and the University of Alabama at Birmingham (USA).