Biosynthesis and Recycling of Nicotinamide Cofactors in Mycobacterium tuberculosis
2008; Elsevier BV; Volume: 283; Issue: 28 Linguagem: Inglês
10.1074/jbc.m800694200
ISSN1083-351X
AutoresHelena I. Boshoff, Xia Xu, Kapil Tahlan, Cynthia S. Dowd, Kévin Pethe, Luis R. Camacho, Tae‐Ho Park, Chang‐Soo Yun, Dirk Schnappinger, Sabine Ehrt, Kerstin J. Williams, Clifton E. Barry,
Tópico(s)Calcium signaling and nucleotide metabolism
ResumoDespite the presence of genes that apparently encode NAD salvage-specific enzymes in its genome, it has been previously thought that Mycobacterium tuberculosis can only synthesize NAD de novo. Transcriptional analysis of the de novo synthesis and putative salvage pathway genes revealed an up-regulation of the salvage pathway genes in vivo and in vitro under conditions of hypoxia. [14C]Nicotinamide incorporation assays in M. tuberculosis isolated directly from the lungs of infected mice or from infected macrophages revealed that incorporation of exogenous nicotinamide was very efficient in in vivo-adapted cells, in contrast to cells grown aerobically in vitro. Two putative nicotinic acid phosphoribosyltransferases, PncB1 (Rv1330c) and PncB2 (Rv0573c), were examined by a combination of in vitro enzymatic activity assays and allelic exchange studies. These studies revealed that both play a role in cofactor salvage. Mutants in the de novo pathway died upon removal of exogenous nicotinamide during active replication in vitro. Cell death is induced by both cofactor starvation and disruption of cellular redox homeostasis as electron transport is impaired by limiting NAD. Inhibitors of NAD synthetase, an essential enzyme common to both recycling and de novo synthesis pathways, displayed the same bactericidal effect as sudden NAD starvation of the de novo pathway mutant in both actively growing and nonreplicating M. tuberculosis. These studies demonstrate the plasticity of the organism in maintaining NAD levels and establish that the two enzymes of the universal pathway are attractive chemotherapeutic targets for active as well as latent tuberculosis. Despite the presence of genes that apparently encode NAD salvage-specific enzymes in its genome, it has been previously thought that Mycobacterium tuberculosis can only synthesize NAD de novo. Transcriptional analysis of the de novo synthesis and putative salvage pathway genes revealed an up-regulation of the salvage pathway genes in vivo and in vitro under conditions of hypoxia. [14C]Nicotinamide incorporation assays in M. tuberculosis isolated directly from the lungs of infected mice or from infected macrophages revealed that incorporation of exogenous nicotinamide was very efficient in in vivo-adapted cells, in contrast to cells grown aerobically in vitro. Two putative nicotinic acid phosphoribosyltransferases, PncB1 (Rv1330c) and PncB2 (Rv0573c), were examined by a combination of in vitro enzymatic activity assays and allelic exchange studies. These studies revealed that both play a role in cofactor salvage. Mutants in the de novo pathway died upon removal of exogenous nicotinamide during active replication in vitro. Cell death is induced by both cofactor starvation and disruption of cellular redox homeostasis as electron transport is impaired by limiting NAD. Inhibitors of NAD synthetase, an essential enzyme common to both recycling and de novo synthesis pathways, displayed the same bactericidal effect as sudden NAD starvation of the de novo pathway mutant in both actively growing and nonreplicating M. tuberculosis. These studies demonstrate the plasticity of the organism in maintaining NAD levels and establish that the two enzymes of the universal pathway are attractive chemotherapeutic targets for active as well as latent tuberculosis. Tuberculosis remains the leading killer in the world because of a single infectious pathogen. With a third of the world population estimated to be latently infected with Mycobacterium tuberculosis, new drugs are urgently required to shorten the duration of therapy, eradicate multiple drug-resistant strains, and target latent, nonreplicating bacilli (1Duncan K. Barry III, C.E. Curr. Opin. Microbiol. 2004; 7: 460-465Crossref PubMed Scopus (121) Google Scholar). Current therapeutic regimens require 6–9 months of chemotherapy and target aspects of cell wall biosynthesis, translation, transcription, or DNA topology. Current antitubercular drugs have diminished or even minimal effect against nonreplicating bacilli (2Gomez J.E. McKinney J.D. Tuberculosis (Edinb.). 2004; 84: 29-44Crossref PubMed Scopus (424) Google Scholar). This diminished effect may reflect the decreased activity of the various target enzymes under in vivo or nonreplicating conditions. Although some metabolic pathways are presumed to be important for maintenance of viability under all conditions, even when the bacilli are nonreplicating, little is known about adaptation of M. tuberculosis metabolism to in vivo conditions (3Boshoff H.I. Barry III, C.E. Nat. Rev. Microbiol. 2005; 3: 70-80Crossref PubMed Scopus (378) Google Scholar). Cofactor biosynthesis is a rich source of potential drug targets because of the essential nature of these coenzymes throughout metabolism (4Gerdes S.Y. Scholle M.D. D'Souza M. Bernal A. Baev M.V. Farrell M. Kurnasov O.V. Daugherty M.D. Mseeh F. Polanuyer B.M. Campbell J.W. Anantha S. Shatalin K.Y. Chowdhury S.A. Fonstein M.Y. Osterman A.L. J. Bacteriol. 2002; 184: 4555-4572Crossref PubMed Scopus (243) Google Scholar). NAD is an essential cofactor that is required for redox balance (5You K.S. CRC Crit. Rev. Biochem. 1985; 17: 313-451Crossref PubMed Scopus (108) Google Scholar) and energy metabolism, as well as for the activity of the NAD-dependent DNA ligase in prokaryotes (6Wilkinson A. Day J. Bowater R. Mol. Microbiol. 2001; 40: 1241-1248Crossref PubMed Scopus (181) Google Scholar), protein ADP-ribosylases (7Dolan K.M. Lindenmayer G. Olson J.C. Biochemistry. 2000; 39: 8266-8275Crossref PubMed Scopus (15) Google Scholar, 8Ziegler M. Oei S.L. BioEssays. 2001; 23: 543-548Crossref PubMed Scopus (113) Google Scholar), protein deacetylation (9Denu J.M. Curr. Opin. Chem. Biol. 2005; 9: 431-440Crossref PubMed Scopus (230) Google Scholar), and as a substrate in cobalamin biosynthesis (10Maggio-Hall L.A. Escalante-Semerena J.C. Microbiology. 2003; 149: 983-990Crossref PubMed Scopus (24) Google Scholar) and for calcium homeostasis (11Vu C.Q. Coyle D.L. Tai H.H. Jacobson E.L. Jacobson M.K. Adv. Exp. Med. Biol. 1997; 419: 381-388Crossref PubMed Scopus (14) Google Scholar). NAD can be synthesized de novo in prokaryotes from aspartate and dihydroxyacetone phosphate in an oxygen-dependent pathway or it can be scavenged or recycled by a variety of pathways (12Begley T.P. Kinsland C. Mehl R.A. Osterman A. Dorrestein P. Vitam. Horm. 2001; 61: 103-119Crossref PubMed Google Scholar, 13Foster J.W. Moat A.G. Microbiol. Rev. 1980; 44: 83-105Crossref PubMed Google Scholar). For pathogens, this recycling pathway offers the possibility of obtaining this cofactor directly from their host. Recently it was also discovered that some prokaryotes synthesized NAD de novo from tryptophan (14Kurnasov O. Goral V. Colabroy K. Gerdes S. Anantha S. Osterman A. Begley T.P. Chem. Biol. 2003; 10: 1195-1204Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar), a pathway that had previously been considered unique to eukaryotes. The Preiss-Handler pathway (15Preiss J. Handler P. J. Biol. Chem. 1958; 233: 488-492Abstract Full Text PDF PubMed Google Scholar) is a recycling pathway that occurs in many microorganisms and consists of nicotinate phosphoribosyltransferase (EC 2.4.2.11 or PncB) as well as the two enzymes of the universal pathway, nicotinic acid mononucleotide adenylyltransferase (EC 2.7.7.18 or NaMNAT, encoded by nadD) and NAD synthetase (EC 6.3.5.1, encoded by nadE) (Fig. 1A). Some microbes depend on nicotinic acid for NAD synthesis because of the absence of some or all of the de novo pathway genes (16Katoh A. Hashimoto T. Front. Biosci. 2004; 9: 1577-1586Crossref PubMed Scopus (86) Google Scholar). Nicotinic acid is formed by the activity of nicotinamidase (EC 3.5.1.19 or PncA) on nicotinamide. Nicotinamide and nicotinic acid can be scavenged from the environment but are also generated through the intracellular breakdown of NAD. NAD can be degraded by a variety of enzymes, including NAD glycohydrolase, DNA ligase, NAD pyrophosphatase, NAD(P)+ nucleosidase, poly(ADP-ribose) polymerase, mono-ADP-ribosyltransferase, and NAD pyrophosphatase (13Foster J.W. Moat A.G. Microbiol. Rev. 1980; 44: 83-105Crossref PubMed Google Scholar). In an alternative nondeamidating salvage pathway, nicotinamide phosphoribosyltransferase (encoded by nadV) salvages nicotinamide directly with the resulting NMN subsequently converted to NAD by the NMN adenylyltransferase activity of NadR (17Merdanovic M. Sauer E. Reidl J. J. Bacteriol. 2005; 187: 4410-4420Crossref PubMed Scopus (23) Google Scholar). A third recycling pathway includes the conversion of exogenously scavenged pyridine nucleotides to NAD (17Merdanovic M. Sauer E. Reidl J. J. Bacteriol. 2005; 187: 4410-4420Crossref PubMed Scopus (23) Google Scholar, 18Singh S.K. Kurnasov O.V. Chen B. Robinson H. Grishin N.V. Osterman A.L. Zhang H. J. Biol. Chem. 2002; 277: 33291-33299Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). In M. tuberculosis, the enzymatic machinery of the NAD de novo biosynthetic pathway has been identified (19Cole S.T. Brosch R. Parkhill J. Garnier T. Churcher C. Harris D. Gordon S.V. Eiglmeier K. Gas S. Barry III, C.E. Tekaia F. Badcock K. Basham D. Brown D. Chillingworth T. Connor R. Davies R. Devlin K. Feltwell T. Gentles S. Hamlin N. Holroyd S. Hornsby T. Jagels K. Krogh A. McLean J. Moule S. Murphy L. Oliver K. Osborne J. Quail M.A. Rajandream M.A. Rogers J. Rutter S. Seeger K. Skelton J. Squares R. Squares S. Sulston J.E. Taylor K. Whitehead S. Barrell B.G. Nature. 1998; 393: 537-544Crossref PubMed Scopus (6522) Google Scholar) and is likely to be essential in vitro based on Himar-transposon mutagenesis studies (20Sassetti C.M. Boyd D.H. Rubin E.J. Mol. Microbiol. 2003; 48: 77-84Crossref PubMed Scopus (2007) Google Scholar). M. tuberculosis is biochemically identified, in part, by a characteristic accumulation of nicotinic acid (21Kilburn J.O. Stottmeier K.D. Kubica G.P. Am. J. Clin. Pathol. 1968; 50: 582-586Crossref PubMed Scopus (1) Google Scholar, 22Konno K. Kurzmann R. Bird K.T. Am. Rev. Tuberc. 1957; 75: 529-537PubMed Google Scholar, 23Konno K. Kurzmann R. Bird K.T. Sbarra A. Am. Rev. Tuberc. 1958; 77: 669-674PubMed Google Scholar) and by the presence of a nicotinamidase (encoded by pncA) that has been implicated in the hydrolysis of the nicotinamide analog pyrazinamide, an important component of front-line M. tuberculosis chemotherapy (24Scorpio A. Zhang Y. Nat. Med. 1996; 2: 662-667Crossref PubMed Scopus (608) Google Scholar). Thus far there is no direct evidence that pyrazinoic acid acts as a metabolic poison of any aspect of NAD metabolism (25Zhang Y. Scorpio A. Nikaido H. Sun Z. J. Bacteriol. 1999; 181: 2044-2049Crossref PubMed Google Scholar). However, despite the expression of this potent nicotinamidase, previous studies have indicated that the Preiss-Handler recycling pathway was not functional in this organism based on the apparent lack of nicotinate incorporation into NAD (13Foster J.W. Moat A.G. Microbiol. Rev. 1980; 44: 83-105Crossref PubMed Google Scholar, 26Kasarov L.B. Moat A.G. J. Bacteriol. 1972; 110: 600-603Crossref PubMed Google Scholar). In addition, pncA can readily be inactivated in clinical strains that acquire pyrazinamide resistance without the apparent loss of fitness (27O'Sullivan D.M. McHugh T.D. Gillespie S.H. J. Antimicrob. Chemother. 2005; 55: 674-679Crossref PubMed Scopus (49) Google Scholar). NAD glycohydrolase activity has also been reported in M. tuberculosis cultures (26Kasarov L.B. Moat A.G. J. Bacteriol. 1972; 110: 600-603Crossref PubMed Google Scholar, 28Gopinathan K.P. Ramakrishnan T. Vaidyanathan C.S. Arch. Biochem. Biophys. 1966; 113: 376-382Crossref PubMed Scopus (7) Google Scholar), but the corresponding gene has not yet been identified. The NAD biosynthetic pathway is thought to be an ideal drug target (4Gerdes S.Y. Scholle M.D. D'Souza M. Bernal A. Baev M.V. Farrell M. Kurnasov O.V. Daugherty M.D. Mseeh F. Polanuyer B.M. Campbell J.W. Anantha S. Shatalin K.Y. Chowdhury S.A. Fonstein M.Y. Osterman A.L. J. Bacteriol. 2002; 184: 4555-4572Crossref PubMed Scopus (243) Google Scholar) with the steps shared by the de novo and recycling pathway posing candidate enzymes for therapeutic intervention. NAD, like most other phosphorylated compounds, cannot be transported across most bacterial cell envelopes, although there are notable exceptions (18Singh S.K. Kurnasov O.V. Chen B. Robinson H. Grishin N.V. Osterman A.L. Zhang H. J. Biol. Chem. 2002; 277: 33291-33299Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 29Haferkamp I. Schmitz-Esser S. Linka N. Urbany C. Collingro A. Wagner M. Horn M. Neuhaus H.E. Nature. 2004; 432: 622-625Crossref PubMed Scopus (89) Google Scholar). However, in most bacteria, NAD is synthesized either de novo or is salvaged through the Preiss-Handler pathway. In this study we sought to determine the relative importance of de novo synthesis and nicotinamide scavenging from the host in M. tuberculosis under conditions similar to those likely to be encountered by the bacterium during disease in humans. Overall, the data show clearly that recycling of exogenously acquired nicotinamide is an important and functional pathway in M. tuberculosis; however, the organism shows considerable flexibility in switching between recycling and de novo synthesis of NAD suggesting that interrupting either one alone would be nonlethal. Therefore, only the two common enzymes shared by both pathways (NadD and NadE) are viable drug targets. Growth of Strains—Escherichia coli strains were grown in Luria broth. Cloning and plasmid preparation were performed in E. coli DH5α, whereas proteins were expressed in E. coli BL21(DE3)pLysS cells. M. tuberculosis strains were cultured in Middlebrook 7H9 broth, which consisted of Middlebrook 7H9 broth base/albumin/dextrose/NaCl (ADC) enrichment, 0.2% glycerol, 0.05% Tween 80. Middlebrook 7H11 agar consisted of Middlebrook 7H11 medium supplemented with oleic acid/ADC (OADC) enrichment and 0.4% glycerol. Antibiotics were used at the following concentrations (Mycobacterium/E. coli): hygromycin 50 μg/ml/200 μg/ml, kanamycin 25 μg/ml/50 μg/ml, and gentamycin 10 μg/ml/10 μg/ml. Anaerobic and microaerophilic cultures of M. tuberculosis were set up as described by Wayne (30Wayne L.G. Parish T. Stoker N.G. Mycobacterium tuberculosis Protocols. Humana Press Inc., Totowa, NJ2001: 247-270Google Scholar) in Dubos medium, which consisted of Dubos broth base supplemented with Dubos ADC enrichment and 0.05% Tween 80. Synthesis of Inhibitors and Inhibition Assays—NAD synthetase inhibitors (Table 1) were synthesized as described previously, and analytical data consistent with the published data were obtained for the final purified products (31Velu S.E. Cristofoli W.A. Garcia G.J. Brouillette C.G. Pierson M.C. Luan C.H. DeLucas L.J. Brouillette W.J. J. Med. Chem. 2003; 46: 3371-3381Crossref PubMed Scopus (20) Google Scholar). For IC50 determination, the NAD synthetase reaction was conducted as described (32Bembenek M.E. Kuhn E. Mallender W.D. Pullen L. Li P. Parsons T. Assay Drug Dev. Technol. 2005; 3: 533-541Crossref PubMed Scopus (12) Google Scholar) with a total volume of 50 μl in a 96-well white flat bottom ½-area plate. For the assay, 1 μl of compound (or solvent control) in 90% DMSO was incubated with 1 μm M. tuberculosis NadE enzyme in the assay buffer (50 mm Tris-HCl, pH 8.5, 10 mm MgCl2, 0.1 mg/ml bovine serum albumin, 50 mm KCl, 10 mm ATP, 10 mm l-glutamine) for 30 min at 37 °C. The reaction was initiated by adding 10 μl of 20 mm nicotinic acid adenine dinucleotide and incubated for 60 min at 37 °C. The reaction was terminated with the addition of 10 μl of stop buffer (0.3 m EDTA, 1.25 m NaCl). Resorufin fluorescence was generated with addition of 10 μl of detection mixture (5 mm resazurin, 10 units/ml diaphorase, 0.1 m lactic acid, 100 units/ml lactate dehydrogenase, 50 mm Tris-HCl, pH 8.5) and incubated for 30 min at 37 °C. Fluorescence was detected using excitation and emission filters of 560 and 590 nm, respectively.TABLE 1Activities of NadE inhibitors Open table in a new tab MIC 3The abbreviations used are: MIC, minimal inhibitory concentration; CFU, colony-forming unit; qRT, quantitative reverse transcription; WT, wild type. determinations were performed by the broth microdilution method (33Domenech P. Reed M.B. Barry III, C.E. Infect. Immun. 2005; 73: 3492-3501Crossref PubMed Scopus (276) Google Scholar) and the MIC was taken as the lowest concentration at which no growth was observed. Minimum bactericidal concentration was determined as the concentration that caused a >90% reduction in colony-forming units (CFU). To measure anaerobic bactericidal activity of the inhibitors, M. tuberculosis H37Rv was cultured in the self-generated oxygen-depletion model described in Ref. 30Wayne L.G. Parish T. Stoker N.G. Mycobacterium tuberculosis Protocols. Humana Press Inc., Totowa, NJ2001: 247-270Google Scholar using 19.5 × 145-mm tubes with a magnetic stirrer. Tubes were sealed with Teflon-lined caps and subsequently with paraplast and incubated for 3 weeks at 37 °C on a magnetic stirrer. The tubes were opened in an anaerobic chamber, diluted 10-fold into anaerobic Dubos medium, and 1-ml volumes treated with various concentrations of the NAD synthetase inhibitors in 24-well plates. Control cultures were treated with DMSO. The plates were sealed in anaerobic bags and incubated for 7 days at 37 °C. Serial dilutions were subsequently plated on 7H11 Middlebrook agar to monitor bacterial survival. To measure bactericidal activity of the inhibitors against starved cultures of M. tuberculosis, cells were washed and resuspended at 107 CFU/ml in PBST in roller bottles at 37 °C. After 3 weeks of incubation, cells were treated with various concentrations of the inhibitors or DMSO vehicle control for 28 days after which serial dilutions were plated for CFU enumeration. Whole Cell Labeling with [14C]Nicotinamide—Mid-logarithmic phase cells were harvested by centrifugation and resuspended in 10 ml of 0.05 mm palmitate in minimal medium (0.5 g of casitone (Difco), 2 g of asparagine, 1 g of KH2PO4, 2.5 g of Na2HPO4, 10 mg of MgSO4·7H2O, 50 mg of ferric ammonium citrate, 0.5 mg of CaCl2, 0.1 mg of ZnSO4, 0.1 mg of CuSO4, and 0.05% Tween 80) containing 20 μCi of [14C]nicotinamide (American Radiolabeled Chemicals) to an A650 nm of 0.6. Cells were labeled for 2 days, harvested by centrifugation, and washed three times with 0.05% Tween 80 in phosphate-buffered saline (PBST). Cell pellets were extracted with 50 μl of water and 300 μl of chloroform. For labeling of M. tuberculosis derived from infected macrophages, 108 J774 macrophages that had been infected at a multiplicity of infection of 10:1 were lysed after 2 days of infection with 0.05% SDS. Eukaryotic genomic DNA was sheared by vortexing (30 s) and M. tuberculosis was harvested by centrifugation. Cells were resuspended in minimal medium and labeled as above. For labeling of M. tuberculosis derived from infected mouse lungs, 4-week infected mice (see below) were euthanized by cervical dislocation, and lungs were homogenized in phosphate-buffered saline (PBST) (5 ml per mouse lung) and filtered through a 40-μm filter to remove particulate material. The final volume was adjusted to 45 ml with PBST, and cells were harvested by centrifugation (2500 × g, 5 min). The pellet was resuspended in 20 ml of PBST and SDS added to 0.05% final concentration to lyse eukaryotic cells. Genomic DNA was sheared by vortexing (three times for 30 s). M. tuberculosis cells were harvested by centrifugation (2500 × g, 10 min), washed once in 50 ml of PBST followed by a wash in 0.05 mm palmitate in minimal medium. Cells were labeled in 5 ml of 0.05 mm palmitate/minimal medium containing 20 μCi of [14C]nicotinamide for 24 h. Cell pellets were extracted with 100 μl of water and 300 μl of chloroform. For mouse lungs, a control uninfected mouse lung was run in parallel to ensure that no incorporation was derived from unlysed eukaryotic cells. To label microaerophilically adapted and anaerobically adapted M. tuberculosis, M. tuberculosis was grown for 4 or 8 days into NRP-1 (microaerophilic cells) or 3 and 8 weeks into NRP-2 (anaerobic cells) (30Wayne L.G. Parish T. Stoker N.G. Mycobacterium tuberculosis Protocols. Humana Press Inc., Totowa, NJ2001: 247-270Google Scholar) as described below. Tubes were briefly opened under aerobic conditions to add 20 μCi of [14C]nicotinamide after which the lids of the tubes were loosely closed and the NRP-1 tubes sealed in microaerophilic bags (type Cfj, BD Biosciences) and the NRP-2 tubes in anaerobic bags (type A, BD Biosciences). An aerobic culture of M. tuberculosis of initial similar cell number (108 CFU/ml) was labeled in parallel under aerobic conditions. Cells were harvested after 3 days of incubation, washed, and extracted as above. Analysis of [14C]Nicotinamide Incorporation—Pyridine nucleotides were visualized by TLC using Whatman LHPKDF silica gel 60A plates. TLC plates were developed in 4:6 1 m ammonium acetate, pH 5, ethanol, dried, and exposed to a PhosphorImager screen (Amersham Biosciences) for 24–48 h. Migration positions of unlabeled NAD+, NADH, NADP+, NADPH, NMN, NaMN and nicotinamide standards (all from Sigma) were determined by UV shadowing. Generation of Recombinant Proteins—The M. tuberculosis nadE gene was amplified using the primers TAGGATCCAACTTTTACTCCGCCTACCAGCA and TAGCGGCCGCTAGCCCTTGGGCACCT cloned into the BamHI and NotI sites of a Gateway expression system in fusion with an N-terminal His6 tag as described (34Leder L. Freuler F. Forstner M. Mayr L.M. Curr. Opin. Drug Discovery Dev. 2007; 10: 193-202PubMed Google Scholar). The protein expression was induced with 100 μm of isopropyl 1-thio-β-d-galactopyranoside for 20 h at 18°C. Soluble recombinant NadE protein was purified on Novagen histidine-binding column, following the recommendations of the manufacturer. The fusion protein obtained was cleaved by PreScission protease (GE Healthcare) between the His6 sequence and the N terminus of the protein following the protocol recommended by the manufacturer. pncB1 was cloned into pET30(b)+ (Novagen) using the primers GCCATGGTGGGGCCACCCCCAGCCGCC and GGGATCCTCAGGCCGGGATCGTGCGTG for PCR amplification (Pfx polymerase, Invitrogen) of the gene, which enabled cloning between the NcoI and BamHI sites (underlined) of the vector. Protein expression was induced by addition of 1 mm isopropyl 1-thio-β-d-galactopyranoside at an A650 nm of 0.6 and induction for 3 h. Cells were lysed, and histidine-tagged protein was purified on Qiagen nickel spin columns using the native protein purification protocol recommended by the manufacturer. pncB2 was amplified using the primers CAACCATGGCGATCCGCCAAC and GAAGCTTCTAGGGTCGTTTGGCCTTCGC which enabled cloning between the NcoI and HindIII sites (underlined) of pET 28(b)+ and pET30(b)+ (Novagen). Protein expression was induced as above. Histidine-tagged protein was purified as described above. Native nonfusion protein was assayed in cell lysates prepared by sonication in 0.18 m Tris, 0.18 m potassium phosphate, pH 7.5. Control lysates were prepared from cells expressing pET28(b)+ vector. PncB Assay—Phosphoribosyltransferase assays were performed in an assay mix consisting of 20 mm Tris, 200 mm glutamate, pH 7.4, 7 mm MgSO4, 6 mm dithiothreitol, 4 mm ATP, 0.5 mm phosphoribosyl pyrophosphate, 6 mm MgCl2, 0.017 μCi of [14C]nicotinamide or [14C]nicotinic acid and 1 μg of recombinant protein (or 10 μg of cell lysate) in a total volume of 30 μl. Reactions were incubated at 37 °C and stopped by addition of 10 μl of chloroform, and reactions were spotted onto TLC plates and developed as described above. Assays were alternatively performed in a reaction mix consisting of 30 mm potassium phosphate, 30 mm Tris, pH 7.5, 1 mm phosphoribosyl pyrophosphate, 3 mm ATP, 10 mm MgCl2, 0.017 μCi of [14C]nicotinamide or [14C]nicotinic acid, and 1 μg of recombinant protein (or 10 μg of cell lysate) in a total volume of 30 μl. Reactions were performed and analyzed as above. Generation of Mutant Strains—A knock-out mutant of the de novo NAD biosynthetic pathway (nad::hyg) was constructed as follows. A 5074-bp XbaI-ApaI cosmid DNA fragment spanning nadA–C was cloned into pcDNA2.1. A 775-bp SphI-Asp718 fragment was replaced with the hygromycin resistance gene leaving only 775 bp of the 5′ end of nadA and 1084 bp of the 3′ end of nadB. A PacI fragment containing the sacB and lacZ genes from pGOAL17 (35Parish T. Stoker N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (400) Google Scholar) was cloned into the EcoRV site of this plasmid to generate pcnadABKO, which was used for electroporation of M. tuberculosis. Electroporation and generation of double crossover strains were performed as described previously (35Parish T. Stoker N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (400) Google Scholar, 36Boshoff H.I. Reed M.B. Barry III, C.E. Cell. 2003; 113: 183-193Abstract Full Text Full Text PDF PubMed Scopus (335) Google Scholar). The resulting nad::hyg knock-out strain was routinely maintained in nicotinamide-supplemented (10 μg/ml) medium. For complementation the XbaI-ApaI fragment containing the entire nadA–C operon along with 288 bp of upstream sequence was cloned into pMV306K (37Mdluli K. Sherman D.R. Hickey M.J. Kreiswirth B.N. Morris S. Stover C.K. Barry III, C.E. J. Infect. Dis. 1996; 174: 1085-1090Crossref PubMed Scopus (102) Google Scholar) and electroporated into nad::hyg. Complemented mutants were selected on 7H11 Middlebrook agar supplemented with hygromycin and kanamycin but without nicotinamide. To generate the pncB1::aph knock-out mutant, a 5913-bp HindIII-BglII cosmid DNA fragment spanning pncB1 was cloned into pcDNA2.1. The aph gene was cloned into the EcoRV site of pncB1, which creates an insertion 317 bp from the start codon. A PacI fragment containing the sacB and lacZ genes from pGOAL17 (35Parish T. Stoker N.G. Microbiology. 2000; 146: 1969-1975Crossref PubMed Scopus (400) Google Scholar) was cloned into the ScaI site of this plasmid to generate pc1330KO, which was used for electroporation of M. tuberculosis. Electroporation and generation of double crossover strains were performed as above. A complementing construct was generated by cloning of a 1727-bp SphI-XmnI fragment containing pncB1 along with 250 bp of upstream sequence into pMV306H (37Mdluli K. Sherman D.R. Hickey M.J. Kreiswirth B.N. Morris S. Stover C.K. Barry III, C.E. J. Infect. Dis. 1996; 174: 1085-1090Crossref PubMed Scopus (102) Google Scholar) and used for electroporation into the pncB1::aph strain with selection of complemented mutants on 7H11 Middlebrook agar containing hygromycin and kanamycin. A pncB2::hyg construct was generated by cloning a 3401-bp EcoRI-Asp-718 cosmid DNA fragment containing pncB2 into pcDNA2.1. A hygromycin resistance gene was cloned into the BglII site, which generates an insertion 854 bp from the start codon. The PacI fragment from pGOAL17 was cloned into the XbaI site to generate pc0573KO, which was used for electroporation into the pncB1::aph strain. For complementation of pncB1::aph/pncB2::hyg double knock-out mutants, pncB2 was amplified with the following primers, GGGCTGCAGGAATGAGCAAGGAGTAACCGGCAAC and GGGTCTAGACTAGGGTCGTTTGGCCTTCG, and the PCR product was cut using the primer-encoded PstI and XbaI sites (underlined). This fragment contains the ribosome-binding site of pncB2 and was cloned with the hsp60 promoter from pMV261 (37Mdluli K. Sherman D.R. Hickey M.J. Kreiswirth B.N. Morris S. Stover C.K. Barry III, C.E. J. Infect. Dis. 1996; 174: 1085-1090Crossref PubMed Scopus (102) Google Scholar) into pGINT (38Dawes S.S. Warner D.F. Tsenova L. Timm J. McKinney J.D. Kaplan G. Rubin H. Mizrahi V. Infect. Immun. 2003; 71: 6124-6131Crossref PubMed Scopus (63) Google Scholar) to yield pGhsp60pncB2. pGhsp60pncB2 was used for electroporation of this strain, and complemented mutants were selected on 7H11 Middlebrook agar containing hygromycin, kanamycin, and gentamycin. Survival under Anaerobic Conditions—The nad::hyg mutant was set up in Wayne NRP cultures as described (30Wayne L.G. Parish T. Stoker N.G. Mycobacterium tuberculosis Protocols. Humana Press Inc., Totowa, NJ2001: 247-270Google Scholar) in 20 ml of Dubos medium containing 10 μg/ml nicotinamide in 19.5 × 145-mm glass tubes containing a magnetic stirrer bar and sealed with Teflon-lined caps. The tubes were further sealed with paraplast. One control culture was similarly set up except that the culture contained 0.5 μg/ml methylene blue. The methylene blue decolorized 2 weeks after initiation. Four weeks after initiation, the cultures (20 ml) were opened in an anaerobic chamber, and exogenous nicotinamide was removed by washing five times in 10 ml of Dubos medium. Half of the cells were resuspended in nicotinamide-free Dubos medium (1 ml) and half were resuspended in 10 μg/ml nicotinamide in Dubos medium (1 ml) and cultured at 37 °C in anaerobic bags (Bio-bag type A, BD Biosciences). One day after washing, nicotinamide-starved cells were harvested again by centrifugation under anaerobic conditions and washed once in 2 ml of Dubos medium to remove nicotinamide that had slowly equilibrated between the intra- and extracellular environments followed by resuspension in 1 ml of Dubos. The parallel culture in nicotinamide-containing medium was similarly washed and resuspended in 1 ml of 10 μg/ml nicotinamide in Dubos medium. Cell cultures were resealed in anaerobic bags and returned to 37 °C for 7 days after which serial dilutions were plated on 7H11 Middlebrook agar containing 10 μg/ml nicotinamide. A similar control experiment was performed for the WT parental strain to monitor kinetics o
Referência(s)