Oligoclonal Expansion of Intraepidermal T Cells in Psoriasis Skin Lesions
2001; Elsevier BV; Volume: 117; Issue: 6 Linguagem: Inglês
10.1046/j.0022-202x.2001.01548.x
ISSN1523-1747
AutoresDavid A. Norris, B L Kotzin, Wei-Jen Lin, Marlyn Achziger, Blake Tomkinson,
Tópico(s)Transgenic Plants and Applications
ResumoCD8+ T cell infiltration into the epidermis is thought to be a key event in the pathogenesis of psoriasis. A quantitative competitive polymerase chain reaction method was developed to examine the expression of T cell receptor β chain variable region 2, 3, 6.1-3, 8, and 13.1 genes in the epidermis of psoriatic lesions. Paired epidermal samples and peripheral blood samples from five psoriasis patients were studied. The results demonstrated the expansion of T cell receptor β chain variable region 3 (two patients), 8 (two patients), and/or 2 (one patient). Contrary to previous reports, neither β chain variable region 6.1-3 nor β chain variable region 13.1 subgroups were expanded in any of the lesions. DNA sequence analysis revealed dominant T cell clones observed in all expanded β chain variable region families and heterogeneous populations and/or small clones observed in nonexpanded β chain variable region families. Using CDR3 length analysis to examine the complete β chain repertoire of the infiltrating T cells in the lesional epidermis, we found that approximately 50% of the T cell receptor β chain variable region families in each patient's lesion demonstrated abnormal CDR3 DNA length distribution, indicating the presence of monoclonal or oligoclonal T cell expansion. Together, the results show that among different patients, T cell oligoclonality is not restricted to a limited number of T cell receptor β chain variable region families. In an attempt to identify the pathogenic T cells among the many expanded T cell clones in the lesions, we compared T cell receptor expansion in the lesional epidermis with nonlesional epidermis. Particular T cell receptor were found to be preferentially expanded in lesional epidermis and these lesion-specific T cell clones may be most important in the pathogenesis and development of psoriatic lesions. CD8+ T cell infiltration into the epidermis is thought to be a key event in the pathogenesis of psoriasis. A quantitative competitive polymerase chain reaction method was developed to examine the expression of T cell receptor β chain variable region 2, 3, 6.1-3, 8, and 13.1 genes in the epidermis of psoriatic lesions. Paired epidermal samples and peripheral blood samples from five psoriasis patients were studied. The results demonstrated the expansion of T cell receptor β chain variable region 3 (two patients), 8 (two patients), and/or 2 (one patient). Contrary to previous reports, neither β chain variable region 6.1-3 nor β chain variable region 13.1 subgroups were expanded in any of the lesions. DNA sequence analysis revealed dominant T cell clones observed in all expanded β chain variable region families and heterogeneous populations and/or small clones observed in nonexpanded β chain variable region families. Using CDR3 length analysis to examine the complete β chain repertoire of the infiltrating T cells in the lesional epidermis, we found that approximately 50% of the T cell receptor β chain variable region families in each patient's lesion demonstrated abnormal CDR3 DNA length distribution, indicating the presence of monoclonal or oligoclonal T cell expansion. Together, the results show that among different patients, T cell oligoclonality is not restricted to a limited number of T cell receptor β chain variable region families. In an attempt to identify the pathogenic T cells among the many expanded T cell clones in the lesions, we compared T cell receptor expansion in the lesional epidermis with nonlesional epidermis. Particular T cell receptor were found to be preferentially expanded in lesional epidermis and these lesion-specific T cell clones may be most important in the pathogenesis and development of psoriatic lesions. complementary-determining region 3 T cell receptor β chain constant region β chain variable region β chain joining region peripheral blood lymphocyte quantitative competitive polymerase chain reaction Psoriasis vulgaris, a common inflammatory skin disease, is characterized by abnormal keratinocyte differentiation, hyperproliferation of keratinocytes, and infiltration of inflammatory cells (Boehncke et al., 1996Boehncke W.H. Dressel D. Zollner T.M. Kaufmann R. Pulling the trigger on psoriasis.Nature. 1996; 379: 777Crossref PubMed Scopus (107) Google Scholar;Ortonne, 1996Ortonne J.P. Aetiology and pathogenesis of psoriasis.Br J Dermatol. 1996; 135: 1-5Crossref PubMed Scopus (72) Google Scholar). Although there has been debate over whether keratinocyte or lymphocyte abnormalities drive the disease, association with certain HLA class I genotypes (e.g., Cw6) and recent evidence demonstrating the importance of T lymphocytes in the pathogenesis of psoriasis implicate a lymphocyte-mediated etiology (Tiilikainen et al., 1980Tiilikainen A. Lassus A. Karvonen J. Vartiainen P. Julin M. Psoriasis HLA-Cw6.Br J Dermatol. 1980; 102: 179-184Crossref PubMed Scopus (253) Google Scholar;Gottlieb et al., 1995aGottlieb S.L. Gilleaudeau P. Johnson R. Estes L. Woodworth T.G. Gottlieb A.B. Krueger J.G. Response of psoriasis to a lymphocyte-selective toxin (DAB389IL-2) suggests a primary immune, but not keratinocyte, pathogenic basis.Nature Med. 1995; 1: 442-447Crossref PubMed Scopus (566) Google Scholar, Gottlieb et al., 1995bGottlieb S. Heftler N.S. Gilleaudeau P. Short-duration anthralin treatment augments therapeutic efficacy of cyclosporine in psoriasis: a clinical and pathologic study.J Am Acad Dermatol. 1995; 33: 637-645Abstract Full Text PDF PubMed Scopus (32) Google Scholar;Wrone-Smith and Nickoloff, 1996Wrone-Smith T. Nickoloff B.J. Dermal injection of immunocytes induces psoriasis.J Clin Invest. 1996; 98: 1878-1887Crossref PubMed Scopus (381) Google Scholar). The strongest evidence for a lymphocyte-mediated pathogenesis comes from clinical studies using lymphocyte selective therapies, including immunosuppressive drugs (e.g., cyclosporine A) (Wong et al., 1993Wong R.L. Winslow C.M. Cooper K.D. The mechanisms of action of cyclosporin A in the treatment of psoriasis.Immunol Today. 1993; 14: 69-74Abstract Full Text PDF PubMed Scopus (119) Google Scholar;Gottlieb et al., 1995bGottlieb S. Heftler N.S. Gilleaudeau P. Short-duration anthralin treatment augments therapeutic efficacy of cyclosporine in psoriasis: a clinical and pathologic study.J Am Acad Dermatol. 1995; 33: 637-645Abstract Full Text PDF PubMed Scopus (32) Google Scholar), bone marrow transplantation (Eedy et al., 1990Eedy D.J. Burrows D. Bridges J.M. Jones F.G. Clearance of severe psoriasis after allogenic bone marrow transplantation.Br Med J. 1990; 300: 908Crossref PubMed Scopus (151) Google Scholar), and T lymphocyte specific drugs (e.g., anti-CD4 antibodies and interleukin-2-toxin conjugate) (Thivolet and Nicolas, 1994Thivolet J. Nicolas J.F. Immunointervention in psoriasis with anti-CD4 antibodies.Int J Dermatol. 1994; 33: 327-332Crossref PubMed Scopus (19) Google Scholar;Gottlieb et al., 1995aGottlieb S.L. Gilleaudeau P. Johnson R. Estes L. Woodworth T.G. Gottlieb A.B. Krueger J.G. Response of psoriasis to a lymphocyte-selective toxin (DAB389IL-2) suggests a primary immune, but not keratinocyte, pathogenic basis.Nature Med. 1995; 1: 442-447Crossref PubMed Scopus (566) Google Scholar). Treatment with the interleukin-2 toxin drug not only reversed the T lymphocyte abnormalities, but also reversed other epidermal abnormalities (e.g., epidermal thickening and keratinocyte hyperplasia), implicating a central role for lymphocytes in the pathogenesis of psoriasis. Moreover, animal models of psoriasis have succeeded in generating psoriatic skin lesions by injecting activated blood-derived T lymphocytes into SCID mice with autologous human-grafted skin (Wrone-Smith and Nickoloff, 1996Wrone-Smith T. Nickoloff B.J. Dermal injection of immunocytes induces psoriasis.J Clin Invest. 1996; 98: 1878-1887Crossref PubMed Scopus (381) Google Scholar;Nickoloff and Wrone-Smith, 1999Nickoloff B.J. Wrone-Smith T. Injection of pre-psoriatic skin with CD4+ T cells induces psoriasis.Am J Pathol. 1999; 155: 145-158Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). Recent flow cytometry analysis has further characterized the functional phenotype of the intraepidermal T cells as CD8+CD3+ GMP-17+ (cytotoxic granule), with a subpopulation expressing the activation marker CD25+. These cells were found in lesional psoriatic skin but not in nonlesional skin or resolving lesion skin, suggesting a functional connection to the maintenance of psoriatic lesions (Austin et al., 1998Austin L.M. Coven T.R. Bhardwaj N. Steinman R. Krueger J.G. Intraepidermal lymphocytes in psoriatic lesions are activated GMP-17 (TIA-1) +CD8+CD3+ CTLs as determined by phenotypic analysis.J Cutan Pathol. 1998; 25: 79-88Crossref PubMed Scopus (66) Google Scholar). Furthermore, analysis of the lymphokine profiles of isolated T cells from psoriasis patients demonstrated a shift towards production of type I cytokines, e.g., interleukin-2, tumor necrosis factor-α, and interferon-γ, both in lesional skin and peripheral blood, suggesting an imbalance in the T cell population, possibly contributing to the continued activation of T cells in psoriasis (Prinz, 1997Prinz J.C. Psoriasis vulgaris, streptococci and the immune system: a riddle to be solved soon?.Scand J Immunol. 1997; 45: 583-586Crossref PubMed Scopus (12) Google Scholar;Austin et al., 1999Austin L.M. Ozawa M. Kikuchi T. Walters I.B. Krueger J.G. The majority of epidermal T cells in psoriasis vulgaris lesions can produce type 1 cytokines, interferon γ, and tumor necrosis factor α defining TC1 (cytotoxic T lymphocytes) and TH1 effector populations: a type 1 differentiation bias is also measured in circulating blood T cells in psoriasis patients.J Invest Dermatol. 1999; 113: 752-759https://doi.org/10.1046/j.1523-1747.1999.00749.xCrossref PubMed Scopus (417) Google Scholar). T cells in psoriatic lesions have been reported to show preferential usage of certain T cell receptor β chain (TCRBV) families in the infiltrating T lymphocytes possibly implicating a role for microbial antigens/superantigens in triggering psoriatic diseases (Travers et al., 1999Travers J.B. Hamid Q.A. Norris C. et al.Epidermal HLA-DR and the enhancement of cutaneous reactivity to superantigenic toxins in psoriasis.J Clin Invest. 1999; 104: 1181-1189Crossref PubMed Scopus (54) Google Scholar;Leung et al., 1995aLeung D.Y.M. Travers J.B. Giorno R. et al.Evidence for a streptococcal superantigen-driven process in acute guttate psoriasis.J Clin Invest. 1995; 96: 2106-2112Crossref PubMed Scopus (235) Google Scholar, Leung et al., 1995bLeung D.Y.M. Travers J.B. Norris D.A. The role of superantigens in skin disease.J Invest Dermatol. 1995; 105: 37S-42SCrossref PubMed Scopus (87) Google Scholar;Skov and Baadsgard, 1995Skov L. Baadsgard O. Superantigens, do they have a role in skin diseases.Arch Dermatol. 1995; 131: 829-832Crossref PubMed Scopus (49) Google Scholar). Polyclonal expansion of BV2 by a streptococcal superantigen has been demonstrated in nonlesional skin at the advancing edge of guttate psoriasis lesions, implicating the streptococcal pyrogenic exotoxin C as the initiating agent (Leung et al., 1995aLeung D.Y.M. Travers J.B. Giorno R. et al.Evidence for a streptococcal superantigen-driven process in acute guttate psoriasis.J Clin Invest. 1995; 96: 2106-2112Crossref PubMed Scopus (235) Google Scholar). Conversely, the finding of clonal expansions in chronic psoriasis vulgaris has been used to implicate conventional antigens rather than superantigens in triggering the psoriasis vulgaris; however, there is considerable debate concerning the pattern of TCR subfamilies preferentially expressed in psoriatic lesions. Oligoclonal expansion of intraepidermal CD8+ lymphocyte expressing BV3 and BV13.1 has been reported in established plaques of type I (early age at onset) psoriasis (Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar); however, preferential expression of other BV have been described in whole dermal/epidermal preparations, including BV2 and BV6 (Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078-4083PubMed Google Scholar), BV2 and BV5.1 (Lewis et al., 1993Lewis H.M. Baker B.S. Bokth S. Powies A.V. Garioch J.J. Valdimarsson H. Fry L. Restricted T-cell receptor V beta gene usage in the skin of patients with guttate and chronic plaque psoriasis.Br J Dermatiol. 1993; 129: 514-520Crossref PubMed Scopus (117) Google Scholar). Other studies found no pattern of expansion in the lesions compared with that in the blood (Boehncke et al., 1995Boehncke W.H. Dressel D. Manfras B. Sollner T.M. Wettstein A. Bohm B.O. Sterry W. T-cell receptor repertoire in chronic plaque-stage psoriasis is restricted and lacks enrichment of superantigen-associated V beta regions.J Invest Dermatol. 1995; 104: 725-728Crossref PubMed Scopus (34) Google Scholar;Moss et al., 1997Moss P. Charmley P. Mulvihill E. et al.The repertoire of T cell antigen receptor β-chain variable regions associated with psoriasis vulgaris.J Invest Dermatol. 1997; 109: 14-19Crossref PubMed Scopus (22) Google Scholar). The difficulties of finding and defining the expanded subfamilies in the lesional T cell populations are probably due to variations among various studies in polymerase chain reaction (PCR) techniques and tissue examined. In these studies, analysis of TCR β chain repertoire were best characterized by studying the T cell infiltrates in the dermis of early lesions (Leung et al., 1995aLeung D.Y.M. Travers J.B. Giorno R. et al.Evidence for a streptococcal superantigen-driven process in acute guttate psoriasis.J Clin Invest. 1995; 96: 2106-2112Crossref PubMed Scopus (235) Google Scholar;Norris et al., 1997Norris D.A. Travers J.B. Leung D.Y.M. Lymphocyte activation in the pathogenesis of psoriasis.J Invest Dermatol. 1997; 109: 1-4Crossref PubMed Scopus (57) Google Scholar) and in the epidermis of established lesions (Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar). With appropriately selected tissue samples, study of TCRBV usage and the DNA sequencing of the TCR CDR3 (complementarily determining region 3) junctional region may facilitate understanding of the role of the TCR–antigen interaction in the pathogenesis of psoriasis and further help in developing novel therapies for treatment of this disease. In this study, we developed a competitive PCR method to quantify TCRBV expression in the psoriatic biopsy samples and examine BV usage independent of PCR primer efficiency. The BV usage and clonality of each BV family was examined using epidermal tissue separated from biopsies of psoriatic lesions, and the results compared with peripheral blood from the same patient. DNA sequencing and CDR3 length analyses were also used to examine closely the clonality in each T cell BV family. Consistent with previous reports (Lewis et al., 1993Lewis H.M. Baker B.S. Bokth S. Powies A.V. Garioch J.J. Valdimarsson H. Fry L. Restricted T-cell receptor V beta gene usage in the skin of patients with guttate and chronic plaque psoriasis.Br J Dermatiol. 1993; 129: 514-520Crossref PubMed Scopus (117) Google Scholar;Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar;Boehncke et al., 1995Boehncke W.H. Dressel D. Manfras B. Sollner T.M. Wettstein A. Bohm B.O. Sterry W. T-cell receptor repertoire in chronic plaque-stage psoriasis is restricted and lacks enrichment of superantigen-associated V beta regions.J Invest Dermatol. 1995; 104: 725-728Crossref PubMed Scopus (34) Google Scholar;Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078-4083PubMed Google Scholar;Moss et al., 1997Moss P. Charmley P. Mulvihill E. et al.The repertoire of T cell antigen receptor β-chain variable regions associated with psoriasis vulgaris.J Invest Dermatol. 1997; 109: 14-19Crossref PubMed Scopus (22) Google Scholar), we observed marked T cell oligoclonality in the epidermis of psoriatic lesions, but contrary to some reports (Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar;Lewis et al., 1993Lewis H.M. Baker B.S. Bokth S. Powies A.V. Garioch J.J. Valdimarsson H. Fry L. Restricted T-cell receptor V beta gene usage in the skin of patients with guttate and chronic plaque psoriasis.Br J Dermatiol. 1993; 129: 514-520Crossref PubMed Scopus (117) Google Scholar;Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078-4083PubMed Google Scholar), we observed no preferential use of specific BV (e.g., BV3 or BV13.1) in the five patients examined. In addition, comparison of TCRBV use in lesional, active lesional (advancing edge), and perilesional nonlesional psoriatic biopsies, demonstrated expansions of T cell clones in established and active lesional epidermis, but not in nearby nonlesional epidermis, potentially establishing a novel way to identify disease relevant clones. All six psoriasis patients Table I, aged 27–70, had recent recurrence of active plaques. None of the patients were treated with immune suppressive drugs immediately prior to the time of sampling. Three six millimeter punch biopsies were taken from the patients' skin, two from independent and physically separated clinically active lesions (L1 and L2) and one from clinically nonlesional skin (N). A skin biopsy was also taken from a healthy 50 y old individual without evidence of any skin disorder. Blood was drawn at time of skin biopsy, and peripheral blood lymphocytes (PBL) isolated on a Ficoll/Hypaque gradient and positively selected into CD4+and CD8+ populations by Dynal bead sorting (Dynal, Great Neck, NY). PBL were also prepared from the blood of a healthy 26 y old individual and used as the reference in CDR3 length analysis. Skin punch biopsies were soaked overnight at 4°C in dispase buffer and the epidermis peeled off and immediately immersed into "Ultraspec" RNA isolation reagents (Biotecx, Inc., Houston, TX) followed by homogenization. RNA purification was performed according to the manufacturer's protocol. cDNA was synthesized by AMV reverse transcriptase using an oligo dT primer (Promega, Madison, WI).Table IPsoriasis patient informationPP no.AgeSexDuration of psoriasisBiopsy site (label)aL1 and L2 represent lesions taken from separated plaques. N was the biopsy taken from normal nonlesional skin. In PP6, L was the biopsy taken from the center of the lesion, L/N was from the edge of the same lesion, and N was from the perilesional uninvolved skin.127M2 yBack (L1)270M20 yThigh (L1, L2, N)370FSince childhoodThigh (L1, L2, N)445MSince childhoodKnee (L1), back (L2, N)540M18 yBack (L1, L2, N)650M3 moBack (L, L/N, N)a L1 and L2 represent lesions taken from separated plaques. N was the biopsy taken from normal nonlesional skin. In PP6, L was the biopsy taken from the center of the lesion, L/N was from the edge of the same lesion, and N was from the perilesional uninvolved skin. Open table in a new tab TCRBV-specific primers were chosen from published studies and primers with the highest efficiency were used in this study (BV 1, 3, 4, 5.1, 6.1–3, 6.7, 7, 8, 9, 13.1, 13.2, 14, 18, 20, 23, and 24 fromChoi et al., 1989Choi Y.W. Kotzin B. Herron L. Callahan J. Marrack P. Kappler J. Interaction of Staphylococcus aureus toxin 'superantigens' with human T cells.Proc Natl Acad Sci USA. 1989; 86: 8941-8945Crossref PubMed Scopus (916) Google Scholar; BV 2, 11, 15, 21, and 22 fromMaslanka et al., 1995Maslanka K. Piatek T. Gorski J. Yassai M. Gorski J. Molecular analysis of T cell repertoire: spectratypes generated by multiplex PCR and evaluated by radioactivity or fluorescence.Hum Immunol. 1995; 44: 28-34Crossref PubMed Scopus (97) Google Scholar; BV 12, 16, and 17 from Clontech, Palo Alto, CA). T cell receptor β chain constant region (TCRBC) was used as an internal control using the forward BC28 (5′CGAGGTCGCTGTGT TTGAGC) and reverse BC238 (5′GCGGCTGCTCAGGCAGTATC) oligonucleotides. Fluorescein-labeled reverse primers were used in the quantitative competitive PCR (QC-PCR) (reverse BC83F/5′TGGCCT TTTGGGTGTGGGAG) and CDR3 length analysis (reverse BC66F;Maslanka et al., 1995Maslanka K. Piatek T. Gorski J. Yassai M. Gorski J. Molecular analysis of T cell repertoire: spectratypes generated by multiplex PCR and evaluated by radioactivity or fluorescence.Hum Immunol. 1995; 44: 28-34Crossref PubMed Scopus (97) Google Scholar). An unlabeled reverse BC83 primer was used in the PCR cloning for DNA sequence analysis. Oligo primers and fluorescein-labeled primers were synthesized by BioServe Biotechnologies (Laurel, MD). Competitors (illustrated in Figure 1a) used for this study were constructed by series of recombination of TCR β chain constant region (BC) and the polylinker from pGEM7. The resulting plasmid, pGEM7-BC+, consisted of a 40 base pair polylinker at the BglII site in TCRBC coding region. The competitor, BC+, was prepared by amplifying pGEM7-BC+ with primers derived from the conserved regions between BC1 and BC2. The V–DJ–C sequences from individual TCRBV families were added 5′ to the polylinker of pGEM7-BC+ at the BglII site in TCRBC coding region and resulted in competitor for each BV families (named BVX+). Competitors BV2+, BV3+, BV6.1–3+, BV8+, and BV13.1+ were constructed for this study, and each have approximately a 40 bp increase in size relative to their wild-type sequence (ranged from 200 to 250 bp) Figure 1a. Competitors were PCR amplified, gel purified and quantified by ultraviolet absorbency at A260. Competitors were serially diluted approximately 3-fold to concentrations as low as 0.0003 pg per μl. A fixed amount of cDNA (diluted if necessary) was added to a set of tubes with various dilutions of the competitors. The PCR mix consisted of a total volume of 20 µl: 1 × PCR buffer (10 mM Tris–HCl, 50 mM KCl, 1.5 mM MgCl2, 0.001% gelatin), 0.2 mM deoxyribonucleoside triphosphate, 0.6 µM of each primers (3′ primers were end labeled with fluorescein; 3′-BC83F for all BV PCR and 3′-BC238F for BC PCR), and 0.75 U Taq DNA polymerase (Promega). All QC-PCR reactions were run at the following conditions for 35 cycles: 94°C for 30 s, 56°C for 1 min, 72°C for 1 min; followed by an extension at 72°C for 6 min. A FluorImager/ImageQuaNT (Molecular Dynamic, Sunnyvale, CA) quantified the PCR products separated on 2.5% Metaphor agarose (FMC, Rockland, ME) in 1 × tris-borate-EDTA buffer (TBE). The signals were plotted on a log–log scale of competitor concentration (pg per µl) vs the ratio (competitor/target) of fluorescent intensity, and the target cDNA concentration was obtained at the ratio of 1: 1 (i.e., log ratio = 0). An example of the TCRBV QC-PCR and its calculation is shown in Figure 1(b, c). As shown in Figure 1b, the signal of the target DNA increased as the competitor concentration decreased. Unlike the PCR products of the constant region (BC), the heterogeneous population in the BV PCR products will result in a cluster of bands as shown in the right panel of Figure 1b. The percentage of a particular BV chain was calculated by dividing the target DNA concentration of the BV with the concentration of the BC in the same cDNA preparation Figure 1c. QC-PCR was also used to quantify TCRBC message, which was used as an internal control and/or a measure of total T cell specific message in each cDNA preparation for subsequent DNA sequencing and CDR3 length analyses. The cDNA template in each 20 µl PCR reaction was adjusted to an amount equivalent to 0.1 pg TCRBC message, the amount we previously determined to be sufficient to minimize PCR skewing. Taq polymerase (Promega) was used to amplify the CDR3 regions by the reverse BC83 primer paired with individual BV primers previously described. The conditions for PCR were similar to that used in QC-PCR except that fewer cycles (30 cycles) were used to reduce skewing due to extensive amplification. PCR products containing the CDR3 regions were gel-purified and cloned into the pCRII vector using the TA cloning system (Invitrogen, Carlsbad, CA). The CDR3 sequences of individual clones were determined by an ABI automatic sequencer (PE Biosystems, Norwalk, CT) using the M13 forward primer site in the pCRII vector. CDR3 length analysis is a PCR-based assay that analyzes the length spectrum of TCRB chain VDJ region in a given T cell population (Maslanka et al., 1995Maslanka K. Piatek T. Gorski J. Yassai M. Gorski J. Molecular analysis of T cell repertoire: spectratypes generated by multiplex PCR and evaluated by radioactivity or fluorescence.Hum Immunol. 1995; 44: 28-34Crossref PubMed Scopus (97) Google Scholar). cDNA equivalent to 0.05 pg TCRBC message was amplified for 35 cycles with fluorescein-labeled BC66 reverse primer paired with 24 BV specific forward primers using cloned pfu DNA polymerase (Stratagene, La Jolla, CA). Preliminary experiments demonstrated that cDNA at concentrations as low as 0.03 pg of TCRBC message in a 20 µl PCR reaction was able to generate consistent CDR3 pattern after 35 cycles of PCR. In some patients, two pairs of TCRBV primers were used in each reaction due to limited cDNA obtained from the epidermis. PCR products were mixed 3: 1 with formamide/dye, denatured at 80°C for 5 min and separated on a vertical 6% polyacrylamide gel/urea/1 × TBE. Gels were scanned with a FluorImager and individual bands analyzed using the area quantitation program provided by the ImageQuaNT software (Molecular Dynamic, Sunnyvale, CA). We developed a QC-PCR to investigate the expression of certain TCRBV families in the epidermis from biopsies of psoriatic skin lesions. QC-PCR quantifies DNA relative to a DNA standard (competitor) added to the PCR reaction therefore it avoids the variations often seen in semiquantitative PCR due to the differences in the primer efficiency and the PCR conditions. QC-PCR of TCRBC (used to reveal total TCR message) and the four TCRBV (BV2, 3, 6.1–3, and 13.1) previously suggested to be overexpressed in lesions (Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar;Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078-4083PubMed Google Scholar) as well as TCRBV8 (TCRBV control) were used to analyze cDNA from lesional epidermis and CD8+ PBL from five psoriasis patients (PP1–PP5, Table I). Expansion of a TCRBV family in a lesion was defined as a greater than 2-fold increase compared with CD8+ PBL of the same patient. Of the five patients examined, a TCRBV expansion was only observed in PP2 (BV3 and BV8) and PP3 (BV2, BV3, and BV8) Table II. Contrary to previous reports (Chang et al., 1994Chang J.C.C. Smith L.R. Froning K.J. et al.CD8+ T cells in psoriatic lesions preferentially use T-cell receptor Vß3 and/or Vß13.1 Genes Proc Natl Acad Sci USA. 1994; 91: 9282-9286Crossref PubMed Scopus (210) Google Scholar;Menssen et al., 1995Menssen A. Trommler P. Vollmer S. et al.Evidence for an antigen-specific cellular immune response in skin lesions of patients with psoriasis vulgaris.J Immunol. 1995; 155: 4078-4083PubMed Google Scholar), consistently increased expression of TCRBV 2, 3, 6.1–3, or 13.1 was not observed in the five patients examined. TCRBV analysis of an independent lesion (lesion 2) in PP3, PP4, and PP5 gave comparable results with lesion 1, with the exception of PP3, in which a BV8 expansion was only observed in lesion 2 Table II.Table IIAnalysis of TCRBV expression by competitive PCR% BV expression in skin lesion/PBLaPercentage of each TCRBV was calculated as illustrated in Figure 1. Individual TCRBV in the T cells of the lesional epidermis was compared with that in the CD8+ PBL of the same patient. The underlined values represent TCRBV expanded more than 2-fold in the lesion compared with CD8+ PBL. Lesions 1 and 2 were sampled from separated lesions at the same time.PP1PP2PP3PP4PP5BVLesion 1Lesion 1Lesion 1Lesion 2Lesion 1Lesion 2Lesion 1Lesion 227.7/5.45.5/4.450.7/3.433.1/3.43.3/3.32.5/3.39.4/7.710.2/7.733.5/1.920.4/8.432.4/4.371.1/4.33.1/0.91.5/0.94.9/15.47.4/15.46.1–31.0/1.54.2/234.4/5.33.1/5.312.1/15.67.0/15.61.9/16.52.1/16.585.7/4.488.1/1.09.0/10.925.5/10.92.4/5.62.8/5.68.0/12.27.3/12.213.13.5/5.53.0/3.44.1/16.43.1/16.42.6/162.5/1.66.8/7.86.4/7.8a Percentage of each TCRBV was calculated as illustrated in Figure 1. Individual TCRBV in the T cells of the lesional epidermis was compared with that in the CD8+ PBL of the same patient. The underlined values represent TCRBV expanded more than 2-fold in the lesion compared with CD8+ PBL. Lesions 1 and 2 were sampled from separated lesions at the same time. Open table in a new tab
Referência(s)