Dynamic Transcriptional Regulatory Complexes, Including E2F4, p107, p130, and Sp1, Control Fibroblast Growth Factor Receptor 1 Gene Expression during Myogenesis
2005; Elsevier BV; Volume: 280; Issue: 22 Linguagem: Inglês
10.1074/jbc.m410744200
ISSN1083-351X
AutoresRajini Parakati, Joseph X. DiMario,
Tópico(s)Ubiquitin and proteasome pathways
ResumoDevelopmentally controlled transcriptional regulation of myogenic cell proliferation and differentiation via expression of the fibroblast growth factor receptor 1 (FGFR1) gene is positively regulated by Sp1 and negatively regulated by E2F4-based transcriptional complexes. We report that p107 and p130 formed transcriptional complexes with E2F4 on the FGFR1 promoter and repressed FGFR1 gene transcription in myogenic cells. However, in Drosophila melanogaster SL2 cells, only p107 was able to repress Sp1-mediated transactivation of the FGFR1 promoter. Gel shift assays using transfected myoblast nuclear extracts showed that ectopic p107 reduced Sp1 occupancy of the proximal Sp binding site of the FGFR1 promoter, and coimmunoprecipitation studies indicated that Sp1 interacts with p107 but not with p130. Gel shift assays also demonstrated that Sp1 interacted with p107 in E2F4-p107 transcriptional complexes in myoblasts. The nature of the repressor transcriptional complex was altered in differentiated muscle fibers by the relative loss of the E2F4-p107-Sp1 transcription complex and replacement by the repressor E2F4-p130 complex. These findings demonstrate that activation and repression of FGFR1 gene transcription is governed by interplay between Sp1, p107, p130, and E2F4 in distinct transcriptional complexes during skeletal muscle development. Developmentally controlled transcriptional regulation of myogenic cell proliferation and differentiation via expression of the fibroblast growth factor receptor 1 (FGFR1) gene is positively regulated by Sp1 and negatively regulated by E2F4-based transcriptional complexes. We report that p107 and p130 formed transcriptional complexes with E2F4 on the FGFR1 promoter and repressed FGFR1 gene transcription in myogenic cells. However, in Drosophila melanogaster SL2 cells, only p107 was able to repress Sp1-mediated transactivation of the FGFR1 promoter. Gel shift assays using transfected myoblast nuclear extracts showed that ectopic p107 reduced Sp1 occupancy of the proximal Sp binding site of the FGFR1 promoter, and coimmunoprecipitation studies indicated that Sp1 interacts with p107 but not with p130. Gel shift assays also demonstrated that Sp1 interacted with p107 in E2F4-p107 transcriptional complexes in myoblasts. The nature of the repressor transcriptional complex was altered in differentiated muscle fibers by the relative loss of the E2F4-p107-Sp1 transcription complex and replacement by the repressor E2F4-p130 complex. These findings demonstrate that activation and repression of FGFR1 gene transcription is governed by interplay between Sp1, p107, p130, and E2F4 in distinct transcriptional complexes during skeletal muscle development. Fibroblast growth factor receptors (FGFRs) 1The abbreviations used are: FGFR, fibroblast growth factor receptor; FGF, fibroblast growth factor; HA, hemagglutinin; PBS, phosphate-buffered saline; BS, blocking solution; CMV, cytomegalovirus; CAT, chloramphenicol acetyltransferase.1The abbreviations used are: FGFR, fibroblast growth factor receptor; FGF, fibroblast growth factor; HA, hemagglutinin; PBS, phosphate-buffered saline; BS, blocking solution; CMV, cytomegalovirus; CAT, chloramphenicol acetyltransferase. have diverse functional roles in mitogenesis, angiogenesis, cell migration, differentiation, mesoderm induction, bone growth and limb development (1Basilico C. Moscatelli D. Adv. Cancer Res. 1992; 59: 115-165Crossref PubMed Scopus (1049) Google Scholar). In skeletal muscle, FGFR1 mediates the mitogenic activity initiated by FGF1 and FGF2. During skeletal myogenesis, FGFR1 gene expression is positively regulated in proliferating myoblasts and negatively regulated in differentiated muscle fibers. The functional significance of regulated expression of the FGFR1 gene during myogenesis is demonstrated by overexpression in vivo. Chick embryos overexpressing wild-type FGFR1 displayed delayed myoblast differentiation and muscle fiber formation. On the contrary, chick embryos overexpressing a dominant-negative form of FGFR1 displayed premature muscle fiber formation with decreased muscle mass (2Itoh N. Mima T. Mikawa T. Development. 1996; 122: 291-300Crossref PubMed Google Scholar, 3Flanagan-Steet H. Hannon K. McAvoy M.J. Hullinger R. Olwin B.B. Dev. Biol. 2000; 218: 21-37Crossref PubMed Scopus (75) Google Scholar).Although regulation of FGFR1 gene expression is important for normal growth and development of skeletal muscles, the molecular mechanism governing its transcription is poorly understood. Positive regulation of FGFR1 gene expression in proliferating myoblasts is governed by the Sp1 transcription factor. The chicken FGFR1 promoter contains two functional, distal Sp1 binding sites, and the proximal region contains three Sp1 binding sites, all of which are essential for full promoter activity in proliferating myoblasts (4Patel S.G. DiMario J.X. Gene. 2001; 270: 171-180Crossref PubMed Scopus (21) Google Scholar, 5Parakati R. DiMario J.X. J. Biol. Chem. 2002; 277: 9278-9285Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Negative transcriptional regulators control FGFR1 promoter activity as FGFR1 gene expression declines during myogenic differentiation. We recently identified E2F4 as a negative regulator of FGFR1 gene expression in skeletal muscle cells (6Parakati R. DiMario J.X. Dev. Dyn. 2005; 232: 119-130Crossref PubMed Scopus (7) Google Scholar). Its repressor activity was mediated by E2F4 binding to a proximal cis-element at –65 bp. However, E2F4 was present in both myoblast and muscle fiber nuclear extracts and bound to the E2F site. Therefore, the mechanism of E2F4-mediated repression of FGFR1 promoter activity in a cell and developmentally regulated manner could not be explained by E2F4-mediated repression alone.Members of the E2F family of transcriptional regulators functionally interact with the pocket protein transcription factors, p107, p130, and pRb. The nature of these interactions defines the transcriptional regulatory complexes as activators or repressors. These complexes regulate expression of a variety of genes, many of which are associated with cell cycle regulation (7Nevins J.R. Cell Growth Differ. 1998; 9: 585-593PubMed Google Scholar). E2F1, E2F2, and E2F3 specifically interact with pRb and not p107 or p130 in vivo (8Helin K. Lees J.A. Vidal M. Dyson N. Harlow E. Fattaey A. Cell. 1992; 70: 337-350Abstract Full Text PDF PubMed Scopus (521) Google Scholar, 9Shan B. Zhu X. Chen P.L. Durfee T. Yang Y. Sharp D. Lee W.H. Mol. Cell. Biol. 1992; 12: 5620-5631Crossref PubMed Scopus (267) Google Scholar). E2F5 binds specifically to p130 in vivo (10Trimarchi J.M. Lees J.A. Nat. Rev. Mol. Cell. Biol. 2002; 3: 11-20Crossref PubMed Scopus (957) Google Scholar, 11Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1962) Google Scholar). In contrast, E2F4 associates with pRb, p107, and p130 and comprises the majority of E2F-pocket protein complexes in vivo (12Beijersbergen R.L. Kerkhoven R.M. Zhu L. Carlee L. Voorhoeve P.M. Bernards R. Genes Dev. 1994; 8: 2680-2690Crossref PubMed Scopus (316) Google Scholar, 13Moberg K. Starz M.A. Lees J.A. Mol. Cell. Biol. 1996; 16: 1436-1449Crossref PubMed Scopus (304) Google Scholar). Primary embryonic mouse fibroblasts that lack E2F4 and -5 or their associated pocket proteins are defective in their ability to exit the cell cycle (14Bruce J.L. Hurford Jr., R.K. Classon M. Koh J. Dyson N. Mol. Cell. 2000; 6: 737-742Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Repressive E2F-pocket protein complexes are also required for normal development in vivo. Mice lacking E2F4 or -5 display developmental defects resulting in neonatal lethality (15Rempel R.E. Saenz-Robles M.T. Storms R. Morham S. Ishida S. Engel A. Jakoi L. Melhem M.F. Pipas J.M. Smith C. Nevins J.R. Mol. Cell. 2000; 6: 293-306Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 16Lindeman G.J. Dagnino L. Gaubatz S. Xu Y. Bronson R.T. Warren H.B. Livingston D.M. Genes Dev. 1998; 12: 1092-1098Crossref PubMed Scopus (152) Google Scholar).p107 and p130 expression levels and E2F binding activities are differentially regulated during cell cycle progression and withdrawal from the cell cycle (17Callaghan D.A. Dong L. Callaghan S.M. Hou Y.X. Dagnino L. Slack R.S. Dev. Biol. 1999; 207: 257-270Crossref PubMed Scopus (62) Google Scholar, 18Ikeda M. Jakoi L. Nevins J.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 3215-3220Crossref PubMed Scopus (224) Google Scholar, 19Kastner A. Espanel X. Brun G. Cell Growth Differ. 1998; 9: 857-867PubMed Google Scholar, 20Kiess M. Gill R.M. Hamel P.A. Cell Growth Differ. 1995; 6: 1287-1298PubMed Google Scholar). Proliferating human fibroblasts have high levels of p107 and E2F4-p107 complexes and very low levels of p130 (18Ikeda M. Jakoi L. Nevins J.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 3215-3220Crossref PubMed Scopus (224) Google Scholar, 19Kastner A. Espanel X. Brun G. Cell Growth Differ. 1998; 9: 857-867PubMed Google Scholar). Levels of p107 decline as cells exit the cell cycle, whereas p130 increases until p130-E2F4 complexes predominate (21Lipinski M.M. Jacks T. Oncogene. 1999; 18: 7873-7882Crossref PubMed Scopus (343) Google Scholar). p107 and p130 also interact with other cell cycle-associated proteins. In muscle fibers, p107 and p130 associate with cyclin D3, levels of which increase during myogenesis (20Kiess M. Gill R.M. Hamel P.A. Cell Growth Differ. 1995; 6: 1287-1298PubMed Google Scholar). Formation of these multimeric complexes has been suggested to play a role in control of cyclinE-cdk2 activity in differentiated cells and prevent cell cycle reentry (7Nevins J.R. Cell Growth Differ. 1998; 9: 585-593PubMed Google Scholar).Pocket proteins regulate gene expression via different E2F-mediated mechanisms. p107 and p130 directly bind E2Fs and modulate their transcriptional activity (20Kiess M. Gill R.M. Hamel P.A. Cell Growth Differ. 1995; 6: 1287-1298PubMed Google Scholar, 22Shin E.K. Shin A. Paulding C. Schaffhausen B. Yee A.S. Mol. Cell. Biol. 1995; 15: 2252-2262Crossref PubMed Google Scholar, 23Corbeil H.B. Whyte P. Branton P.E. Oncogene. 1995; 11: 909-920PubMed Google Scholar, 24De Luca A. Baldi A. Esposito V. Howard C.M. Bagella L. Rizzo P. Caputi M. Pass H.I. Giordano G.G. Baldi F. Carbone M. Giordano A. Nat. Med. 1997; 3: 913-916Crossref PubMed Scopus (202) Google Scholar). p107 and p130 also recruit additional transcription factors to promoters containing E2F sites. For example, pRb and p130 interact directly with histone deacetylase (HDAC1) leading to local chromatin remodeling (25Brehm A. Miska E.A. McCance D.J. Reid J.L. Bannister A.J. Kouzarides T. Nature. 1998; 391: 597-601Crossref PubMed Scopus (1067) Google Scholar, 26Luo R.X. Postigo A.A. Dean D.C. Cell. 1998; 92: 463-473Abstract Full Text Full Text PDF PubMed Scopus (836) Google Scholar, 27Magnaghi-Jaulin L. Groisman R. Naguibneva I. Robin P. Lorain S. Le Villain J.P. Troalen F. Trouche D. Harel-Bellan A. Nature. 1998; 391: 601-605Crossref PubMed Scopus (801) Google Scholar). E2F-pocket protein complexes also interact with Sp1 in the regulation of specific E2F-dependent genes. Sp1 has been reported to interact directly with p107, pRb, and E2F1–3 (28Datta P.K. Raychaudhuri P. Bagchi S. Mol. Cell. Biol. 1995; 15: 5444-5452Crossref PubMed Scopus (91) Google Scholar, 29Chang Y.-C. Illenye S. Heintz N.H. Mol. Cell. Biol. 2001; 21: 1121-1131Crossref PubMed Scopus (60) Google Scholar, 30Karlseder J. Rotheneder H. Wintersberger E. Mol. Cell. Biol. 1996; 16: 1659-1667Crossref PubMed Scopus (314) Google Scholar, 31Lin S.-Y. Black A.R. Kostic D. Pajovic S. Hoover C.N. Azizkhan J.C. Mol. Cell. Biol. 1996; 16: 1668-1675Crossref PubMed Scopus (252) Google Scholar, 32Rotheneder H. Geymayer S. Haidweger E. J. Mol. Biol. 1999; 293: 1005-1015Crossref PubMed Scopus (80) Google Scholar). However, E2F4 lacks an Sp1 binding domain and therefore does not interact directly with Sp1 (30Karlseder J. Rotheneder H. Wintersberger E. Mol. Cell. Biol. 1996; 16: 1659-1667Crossref PubMed Scopus (314) Google Scholar). Nevertheless, Sp1 may contribute to E2F4-based transcriptional complexes via interaction with pocket protein co-regulators.We demonstrated in this study that pocket protein family members p107 and p130 regulate E2F4-mediated repression of FGFR1 gene expression in skeletal muscle cells. Transient transfections in proliferating myoblasts and electromobility shift assays indicated that these proteins form functional complexes with E2F4 and repress FGFR1 gene promoter activity. We further demonstrate that in proliferating myoblasts, Sp1 interacts with p107 and masks the transcriptional repressor activity of the E2F4-p107 complex at the E2F site located in the proximal promoter region of the FGFR1 gene. These findings provide a novel mechanism for developmentally regulated expression of the FGFR1 gene during skeletal myogenesis.EXPERIMENTAL PROCEDURESPlasmid DNA Constructs—The plasmid m23/m42/m54FGFR1 containing mutations of three Sp1 sites in the proximal promoter region was described previously (5Parakati R. DiMario J.X. J. Biol. Chem. 2002; 277: 9278-9285Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Mutation of the E2F site in the above plasmid was made by using the QuikChange site directed mutagenesis kit (Stratagene) (6Parakati R. DiMario J.X. Dev. Dyn. 2005; 232: 119-130Crossref PubMed Scopus (7) Google Scholar) with the following forward primer and its antisense oligonucleotide as a reverse primer 5′-GGTTCCCATGCAGCTATCATACAGGGGGTTAACCTGCAC-3′. The base substitutions are underlined. Mutagenesis was confirmed by DNA sequencing, and the plasmid DNA was designated as m23/m42/m54/m65FGFR1. The new truncated promoter versions of plasmid m23/m42/m54FGFR1 and m23/m42/m54/m65FGFR1 were prepared by deletion of a distal 2.2-kb SacI fragment and ligation to generate the plasmids mSp11058FGFR1 and mE2F/Sp11058FGFR1, respectively. The truncated plasmid 1058FGFR1 containing wild-type Sp1 and E2F promoter sequences was described previously (4Patel S.G. DiMario J.X. Gene. 2001; 270: 171-180Crossref PubMed Scopus (21) Google Scholar).Cell Culture, DNA Transfections, and Reporter Assays—Fetal chick myoblasts (embryonic day 13) were isolated from leg muscles and incubated in collagen coated dishes as described previously (33DiMario J.X. Stockdale F.E. Exp. Cell Res. 1995; 216: 431-442Crossref PubMed Scopus (37) Google Scholar, 34O'Neill M.C. Stockdale F.E. J. Cell Biol. 1972; 52: 52-65Crossref PubMed Scopus (204) Google Scholar). Cells were cultured in FM medium (15% horse serum (Hyclone Labs), 5% chick embryo extract, 1.32 mm CaCl2, in F-10 base medium (Invitrogen)) at 37 °C in a 5% CO2 humidified incubator. Medium was replaced every other day. Myotube cultures were treated with 10 μg/ml β-arabinofuranoside hydrochloride as described previously (35Patel S.G. Funk P.E. DiMario J.X. Gene. 1999; 237: 265-276Crossref PubMed Scopus (23) Google Scholar).The plasmid 3284FGFR1CAT containing the full-length wild-type FGFR1 promoter was described previously (35Patel S.G. Funk P.E. DiMario J.X. Gene. 1999; 237: 265-276Crossref PubMed Scopus (23) Google Scholar). Myoblasts were plated at a density of 2.5 × 106 cells/6-cm dish in FM medium and transfected using Lipofectamine Plus reagent (Invitrogen) as described previously (5Parakati R. DiMario J.X. J. Biol. Chem. 2002; 277: 9278-9285Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). For all transfections, 1.5 or 3 μg of 3284FGFR1CAT plasmid and 1 μg of pRSVβGAL plasmid were kept constant. Increasing amounts of p107 or p130 expression plasmids, pCMVp107 and pCMVp130 encoding human cMyc-tagged p107 and hemagglutinin (HA) tagged p130, respectively, and vector DNA alone were added to bring total DNA to 8 μg. Some cultures were transfected with 1.5 μg of pCMVTAG (Stratagene). Transfected cells were harvested after 24 h and 10 days in culture and suspended in 100 μl of 0.25 m Tris-HCl, pH 7.8. Cells were lysed by three rounds of freezing and thawing, and the CAT assays were performed as described previously (35Patel S.G. Funk P.E. DiMario J.X. Gene. 1999; 237: 265-276Crossref PubMed Scopus (23) Google Scholar). Resulting thin layer chromatography plates were then cut and quantified by liquid scintillation counting. β-Galactosidase activities were used to normalize transfection efficiencies (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual,2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). The CAT activities from expression of wild-type 3284FGFR1CAT co-transfected with increasing amounts of pCMVp107 and pCMVp130 were expressed as percentage activities relative to FGFR1 promoter activity in the absence of exogenous p107 or p130.For transfection of SL2 cells, cells were grown in Drosophila melanogaster SFM medium (Invitrogen) supplemented with 2 mm l-glutamine plus 1× antibiotic-antimycotic (Invitrogen) at 25 °C without CO2. Cells were plated at a density of 2.5 × 106 cells/6-cm dish on the day before transfection. Cells were transfected in D. melanogaster SFM medium without antibiotics using Cellfectin reagent (Invitrogen) according to the manufacturer's protocol. Each plate received various amounts of pCMVp107 and pCMVp130 expression plasmids, 1 μg of pRSVβGAL, 750 ng of Sp1 expression plasmid (pPacSp1), 1.5 or 3 μgof promoter-CAT reporter plasmid as well as pKS BlueScript (Stratagene) DNA to bring the total DNA up to 8 μg per plate. After transfection, cells were maintained in growth medium. Cells were harvested 48 h after transfection, and CAT assays were performed (35Patel S.G. Funk P.E. DiMario J.X. Gene. 1999; 237: 265-276Crossref PubMed Scopus (23) Google Scholar). For all transfection assays, four to five independent experiments were performed.Immunocytochemistry—Rabbit anti-E2F4, p107, p130, Sp1, E47, Gαq, and HA primary antibodies and horseradish peroxidase-conjugated anti-mouse IgG and anti-rabbit IgG were obtained from Santa Cruz Biotechnology Inc. Mouse anti-pRb was obtained from BD Transduction Laboratories. Mouse anti-cMyc and β-actin antibodies were obtained from Invitrogen and Abcam, respectively. DAPI was obtained from Molecular Probes, Inc. Fluorescein-conjugated anti-mouse IgG and anti-rabbit IgG were obtained from Vector Laboratories, Inc.Myogenic cultures were immunostained 24 h or 10 days after plating. Cells were washed three times with phosphate-buffered saline (PBS) and fixed with 100% methanol for 5 min. Cultures were washed as above and incubated for 1 h with blocking solution (BS) containing 0.3% bovine serum albumin and 0.1% Tween in PBS. Polyclonal anti-rabbit E2F4, p130, p107, and Sp1 antibodies and pRb monoclonal antibody were diluted 1:700 in BS. Cultures were incubated in primary antibodies for 1 h at room temperature and washed as above. Fluorescein-conjugated anti-mouse IgG and anti-rabbit IgG were diluted 1:100 in BS and added to the cultures for 1 h. DAPI at a concentration of 1.2 μm in PBS was added to the cultures for 10 min at room temperature and washed five times with PBS. Two drops of 2.5% diazabicyclooctane in glycerol/PBS (9:1) and coverslips were applied, and the cells were viewed with fluorescence microscopy.Subcellular Fractionation and Western Blotting—Fractionation of cultured cells was performed as described previously (6Parakati R. DiMario J.X. Dev. Dyn. 2005; 232: 119-130Crossref PubMed Scopus (7) Google Scholar). For Western blots, proteins (50 μg) were resolved in 7.5% SDS-polyacrylamide gels and electrotransferred onto nitrocellulose membranes. The blots were then blocked for 1 h at 37 °C or overnight at 4 °C in BS containing 5% nonfat dry milk in PBS with 0.05% Tween. Thereafter, the blots were incubated with rabbit polyclonal p107, p130, Sp1, E47, cMyc, or HA antibody and mouse monoclonal pRb antibody, diluted 1:1000 in BS for 1 h at room temperature, washed three times with PBS containing 0.05% Tween, and incubated with horseradish peroxidase-conjugated anti-rabbit IgG as a secondary antibody (1:4000 dilution) for 1 h at room temperature. The blots were washed five to six times in PBS containing 0.05% Tween, and the immunocomplexes were detected using the Super Signal chemiluminescent substrate (Pierce) and x-ray film.Preparation of Nuclear Extracts and Electromobility Shift Assay— Nuclear extracts were prepared as described previously (37Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9140) Google Scholar). Complementary oligonucleotides were commercially synthesized (Integrated DNA Technology). The oligonucleotides (10 μg each) were boiled for 10 min in 10× kinase buffer and allowed to cool gradually to room temperature. Approximately 200 ng of double-stranded oligonucleotide were 5′ end-labeled using T4 kinase (Promega) and [γ-32P]ATP (MP Biomedicals). The sequence of the wild-type E2F4 binding site oligonucleotide was 5′-CATGCAGCAGCGGGACAGGGGGCTG-3, and the mutated E2F4 binding site oligonucleotide was 5′-CCATGCAGCTATCATACAGGGGGCTG-3′. Base substitutions are underlined. The –23 Sp1 oligonucleotide sequence was 5′-GACTCTCTTTCTCCCCTCCACAGCTC-3′, and the consensus Sp1 oligonucleotide sequence was 5′-ATTCGATCGGGGCGGGGCGAGC-3′.Nuclear extract proteins (12 μg) were added to a 20-μl binding reaction containing 20 mm HEPES, pH 7.9, 1 mm MgCl2, 4% Ficoll, 0.5 mm dithiothreitol, 50 mm KCl, 2 μg of poly dIdC (Amersham Biosciences), 300 μg/ml bovine serum albumin, and 50 μg/ml salmon sperm DNA and incubated at 4 °C for 30 min. For supershifts, 2 μg of the antibody was added to the reaction mixture. Labeled probe (70,000 cpm in 1 μl) was added and further incubated for 25 min at 4 °C. Protein-DNA complexes were resolved by electrophoresis in 5% non-denaturing polyacrylamide gels with 1× Tris-borate/EDTA buffer. The gels were dried and exposed to x-ray film overnight.Transient Electromobility Shift Assay—Transfections of D. melanogaster SL2 cells were performed as described above using Cellfectin reagent (Invitrogen). Each plate received various combinations of transcription factor expression constructs. One set of plates received 1 μgof Sp1 expression plasmid (pPacSp1), 3 μg of E2F4 expression plasmid (pCMVE2F4), and 3 μg of p107 expression plasmid (pCMVp107). The other set received only 1 μg of pPacSp1 and 3 μg of pCMVp107, and the total amount of DNA transfected was adjusted to 7 μg with pKS Blue-Script DNA (Stratagene). Forty-eight hours after transfection, nuclear extracts were prepared (38Ausubel F.M. Brent R. Kingston R.E. Moore D.M. Seidman J.G. Smith J.A. Struhl K. Ausubel F.M. Brent R. Kingston R.E. Moore D.M. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Associates, New York1987Google Scholar), and the gel shifts were performed as described above with 3 μg of nuclear extracts.Immunoprecipitations—Nuclear extracts were prepared as described for electromobility shift assays (37Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9140) Google Scholar). Extracts from ∼4 × 107 cells (100 μl containing 200 μg of protein) were diluted to 1 ml with chilled NET buffer (150 mm NaCl, 0.1% Nonidet P-40, and 50 mm Tris-HCl, pH 7.5) containing protease inhibitors. The nuclear lysate was precleared by incubation with 50 μl of protein A/G agarose (Santa Cruz Biotechnology) for 2 h at 4 °C and further centrifugation. The nuclear protein was incubated with 2 μg of antibody against E2F4, pRb, p107, p130, and Sp1 (Santa Cruz Biotechnology) overnight at 4 °C. After addition of 50 μlof protein A/G agarose, the suspension was incubated for another 2 h at 4 °C. The beads were pelleted by centrifugation, washed three times with cold NET buffer, and resuspended in 50 μl of 2× SDS sample buffer. After the suspension was heated to 95 °C for 10 min, 20-μl samples were resolved in denaturing SDS-polyacrylamide gels, transferred to nitrocellulose membrane, and probed for the presence of specific proteins by immunodetection as described above.Chromatin Immunoprecipitation—We performed chromatin immunoprecipitations using a modification of previously published methods (39Takahashi Y. Rayman J.B. Dynlacht B.D. Genes Dev. 2000; 14: 804-816PubMed Google Scholar, 40Weinmann A.S. Bartley S.M. Zhang T. Zhang M.Q. Farnham P.J. Mol. Cell. Biol. 2001; 21: 6820-6832Crossref PubMed Scopus (331) Google Scholar). Formaldehyde was added to a final concentration of 1% directly to the cell culture media of proliferating myoblasts and differentiated myotubes (4 × 107 cells). Fixation proceeded at room temperature for 10 min and was stopped by the addition of glycine to a final concentration of 0.125 m. Cells were washed with PBS, trypsinized, and harvested in PBS containing 10% horse serum. Cells were collected by centrifugation and rinsed in cold PBS. The cell pellets were resuspended in swelling buffer (10 mm potassium acetate, 15 mm magnesium acetate, 0.1 m Tris, pH 7.6, 0.5 mm phenylmethylsulfonyl fluoride, and 100 ng/ml leupeptin and aprotinin) and incubated on ice for 20 min, and then processed on a Dounce homogenizer. The nuclei were collected by microcentrifugation and then resuspended in sonication buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl, pH 8.1, 0.5 mm phenylmethylsulfonyl fluoride, and 100 ng/ml leupeptin and aprotinin) and incubated on ice for 10 min. Before sonication, 0.1 g of glass beads (212- to 300-μm diameter; Sigma) was added to each sample. The samples were sonicated on ice with an Ultra sonicator at setting 3 for four 20-s pulses to an average length of 0.5 to 1.0 kb and then microcentrifuged.Chromatin was pre-cleared with a mixture of protein A and protein G Sepharose (blocked previously with 1 mg/ml salmon sperm DNA and 1 mg/ml bovine serum albumin) at 4 °C for 4 h two times. Precleared chromatin was equally divided and was separately incubated with 4 μg of anti-E2F4, anti-p107, anti-p130, anti-Sp1, and Gαq antibodies, or no antibodies overnight at 4 °C. Immunoprecipitation, washing, and elution of immune complexes were carried out as described previously (41Boyd K.E. Wells J. Gutman J. Bartley S.M. Farnham P.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13887-13892Crossref PubMed Scopus (246) Google Scholar). Before the first wash, 20% of the supernatant from the reaction with no primary antibody for each sample (myoblasts and myotubes) was saved as total input chromatin and was processed with the eluted immunoprecipitates beginning at the cross-link reversal step. Cross-links were reversed by the addition of NaCl to a final concentration of 200 mm, and RNA was removed by the addition of 10 μg of RNase A per sample followed by incubation at 65 °C for 4 to 5 h. The samples were then ethanol precipitated. The samples were resuspended in 100 μl of Tris-EDTA, pH 7.5, 25 μlof5× proteinase K buffer (1.25% SDS, 50 mm Tris, pH 7.5, and 25 mm EDTA), and 10 μg of proteinase K (Sigma) and incubated at 45 °C for 2 h. Samples were extracted with phenol-chloroform and ethanol-precipitated. The pellets were collected by microcentrifugation, resuspended in 30 μl of water, and analyzed by PCR.PCR mixtures contained 2 μl of immunoprecipitate or 2 μl of a 1:200 dilution of the total sample, 50 ng of each primer, 25 mm MgCl2, 2.5 mm dNTP mix, and 2.5 units of TaqDNA polymerase in a total volume of 100 μl. After 25 cycles of amplification, the PCR products were run in 1% agarose gels and analyzed by ethidium bromide staining. The PCR primers used to amplify the –321 to +9 region were: 5′ CTGTTTTCAGTGCCAACT 3′ (forward primer, –321 to –302) and 5′ CATGGGGCCCCGTCGGCCGCTG 3′ (reverse primer, +9 to –13). The primers used to amplify the –1950 to –1788 region were: 5′ CCGCGTGAACAAGTGCTTCTTTG 3′ (forward primer, –1950 to –1927) and 5′ GGGAAAGGGTTCATTGGGAAAC 3′ (reverse primer, –1788 to –1809).For transient chromatin immunoprecipitation assays (42Lavrrar J.L. Farnham P.J. J. Biol. Chem. 2004; 279: 46343-46349Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar), fetal chick myoblasts (embryonic day 13) were plated at a density of 2.5 × 106 cells/10 cm and were transfected with 1.5 μg of the 1058FGFR1 wild-type promoter construct and its mutant derivatives by using Lipofectamine Plus reagent (Invitrogen) as described previously (5Parakati R. DiMario J.X. J. Biol. Chem. 2002; 277: 9278-9285Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). After a 24-h incubation, the cells were cross-linked with the use of formaldehyde and harvested, and chromatin immunoprecipitations were performed as described above. The resulting DNA was analyzed by PCR reactions with a forward primer (–321 to +9 bp) common to all constructs and a reverse primer to the pCAT3Basic (Promega) plasmid backbone (5′-GATATATCAACGGTGGTATATCCAGTG-3′) at +351 to +325 bp.RESULTSCellular Localization of Pocket Proteins in Chicken Muscle Cells—We have recently shown that E2F4, present in the nuclei of both myoblasts and myotubes, acts as a negative regulator of FGFR1 gene expression (6Parakati R. DiMario J.X. Dev. Dyn. 2005; 232: 119-130Crossref PubMed Scopus (7) Google Scholar). To identify potential E2F4 binding partners within nuclei, we analyzed the intracellular distribution of pocket proteins in undifferentiated myoblasts and differentiated myotubes by immunocytochemistry. p107, p130, and pRb proteins were localized to nuclei of both myoblasts and myotubes (Fig. 1). Immunofluorescent localization of these proteins in the nuclei of myoblasts and myotubes colocalized with 4,6-diamidino-2-phenylindole fluorescence.Western blot analysis was carried out using fractionated cell lysates of both myoblasts and myotubes to validate the immunostaining results (Fig. 2). p107, p130, and pRb proteins were detected in the nuclear extra
Referência(s)