Portal de Periódicos da CAPES

Trypanosoma cruzi Arginine Kinase Characterization and Cloning

2000; Elsevier BV; Volume: 275; Issue: 2 Linguagem: Inglês

10.1074/jbc.275.2.1495

1083-351X

Claudio A. Pereira, G. Alonso, M.Cristina Paveto, Adolfo M. Iribarren, Magali Cabanas, Héctor N. Torres, Mirtha M. Flawiá,

Biochemical and Molecular Research

This work contains the first description of a guanidino kinase in a flagellar unicellular parasite. The enzyme phosphorylates l-arginine and was characterized in preparations from Trypanosoma cruzi, the ethiological agent of Chagas' disease. The activity requires ATP and a divalent cation. Under standard assay conditions (1 mm l-arginine), the presence of 5-fold higher concentrations of canavanine or histidine produced a greater than 50% enzyme inhibition. The base sequence of this enzyme revealed an open reading frame of 357 amino acids and a molecular weight of 40,201. The amino acid sequence shows all of the characteristic consensus blocks of the ATP:guanidino phosphotransferase family and a putative “actinin-type” actin-binding domain. The highest amino acid identities of the T. cruzi sequence, about 70%, were with arginine kinases from Arthropoda. Southern and chromosome blots revealed that the kinase is encoded by a single-copy gene. Moreover, Northern blot analysis showed an mRNA subpopulation of about 2.0 kilobases, and Western blotting of T. cruzi-soluble polypeptides revealed a 40-kDa band. The finding in the parasite of a phosphagen and its biosynthetic pathway, which are totally different from those in mammalian host tissues, points out this arginine kinase as a possible chemotherapy target for Chagas' disease. This work contains the first description of a guanidino kinase in a flagellar unicellular parasite. The enzyme phosphorylates l-arginine and was characterized in preparations from Trypanosoma cruzi, the ethiological agent of Chagas' disease. The activity requires ATP and a divalent cation. Under standard assay conditions (1 mm l-arginine), the presence of 5-fold higher concentrations of canavanine or histidine produced a greater than 50% enzyme inhibition. The base sequence of this enzyme revealed an open reading frame of 357 amino acids and a molecular weight of 40,201. The amino acid sequence shows all of the characteristic consensus blocks of the ATP:guanidino phosphotransferase family and a putative “actinin-type” actin-binding domain. The highest amino acid identities of the T. cruzi sequence, about 70%, were with arginine kinases from Arthropoda. Southern and chromosome blots revealed that the kinase is encoded by a single-copy gene. Moreover, Northern blot analysis showed an mRNA subpopulation of about 2.0 kilobases, and Western blotting of T. cruzi-soluble polypeptides revealed a 40-kDa band. The finding in the parasite of a phosphagen and its biosynthetic pathway, which are totally different from those in mammalian host tissues, points out this arginine kinase as a possible chemotherapy target for Chagas' disease. polymerase chain reaction base pair(s) kilobases kilobase pair(s) N-Phosphorylated guanidino compounds, commonly referred to as phosphagens, play a critical role as an energy reserve because of the high energy phosphate that can be transferred when the renewal of ATP is needed. It has also been proposed that these compounds function in spatial buffering of cellular energy production sites. So, phosphagens act as reserves not only of ATP but also of inorganic phosphate, which is mostly returned to the medium by metabolic consumption of ATP. Phosphoarginine is the main reserve of high energy phosphate compounds in a wide variety of invertebrates. In addition phosphocreatine, phosphoglycocyamine, phosphotaurocyamine, phosphohypotaurocyamine, phosphoopheline, and phospholombricine are also found, whereas in vertebrates the only one present is phosphocreatine (1.Morrison J.F. Boyer P.D. The Enzymes. 8. Academic Press, New York1973: 457-486Google Scholar, 2.Huennekens F.M. Whiteley H.R. Florkin M. Mason H.S. Comparative Biochemistry. 1. Academic Press, New York1960: 107-180Crossref Google Scholar). Arginine kinase (EC 2.7.3.3) is a member of a conserved family of phosphotransferases which also includes creatine kinase. These enzymes catalyze the reversible transfer of a phosphoryl group from ATP to a guanidino acceptor, which can be either an amino acid (e.g.lombricine or arginine) or a carboxylate (e.g. creatine or glycocyamine; Reaction 1).MgATP+guanidino acceptor⇄P­guanidino acceptor+MgADP+H+REACTION 1Arginine kinase is present in Annelida, Celenterata, Platyhelmintes, Nemertea, Mollusca, Phoronida, Arthropoda, Equinodermata, Hemichordata, and Chordata, where, like other phosphagen kinases, it maintains ATP homeostasis during muscle contraction (1.Morrison J.F. Boyer P.D. The Enzymes. 8. Academic Press, New York1973: 457-486Google Scholar,2.Huennekens F.M. Whiteley H.R. Florkin M. Mason H.S. Comparative Biochemistry. 1. Academic Press, New York1960: 107-180Crossref Google Scholar). Common in most of these phosphotransferases is the presence in the binding sites of substrates of five arginine residues interacting with ATP, two carboxylate amino acids, and one cysteine residue interacting with the guanidino acceptor group (3.Zhou G. Smasundaram T. Blank E. Parthasarathy G. Ellington W.R. Chapman M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8449-8454Crossref PubMed Scopus (234) Google Scholar). In addition, some arginine kinases contain a domain for interaction with actin (4.Reddy R.R. Houmeida A. Benyamin Y. Roustan C. Eur. J. Biochem. 1992; 206: 251-257Crossref PubMed Scopus (21) Google Scholar). Most of the enzymatic reactions studied in trypanosomatids, which involves l-arginine, are related to the ornithine-arginine pathway. Distinct genus of trypanosomatids utilizes different enzymes in arginine catabolism. Members of the Trypanosoma genus include T. cruzi, the causative agent of Chagas' disease, devoid of ornithine decarboxylase, arginine decarboxylase, and arginase (5.Camargo E.P. Coelho J.A. Moraes G. Figueiredo E.N. Exp. Parasitol. 1978; 46: 141-144Crossref PubMed Scopus (57) Google Scholar, 6.Yoshida N. Camargo E.P. J. Bacteriol. 1978; 136: 1184-1186Crossref PubMed Google Scholar). In addition, the existence of the nitric oxide pathway inT. cruzi was demonstrated recently by this laboratory. This signaling pathway involves a putativel-glutamate/N-methyl-d-aspartate receptor, a nitric oxide synthase, and a guanylyl cyclase and seems to be a control step in epimastigote flagellar motility (7.Paveto C. Pereira C. Espinosa J. Montagna A.E. Farber M. Esteva M. Flawiá M.M. Torres H.N. J. Biol. Chem. 1995; 270: 16576-16579Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 8.Pereira C. Paveto C. Espinosa J. Alonso G. Flawiá M.M. Torres H.N. J. Eukar. Microbiol. 1997; 44: 155-156Crossref PubMed Scopus (25) Google Scholar). The existence of a high affinity and very specific l-arginine transporter was also demonstrated in T. cruzi epimastigotes. One of the major products of l-arginine uptake was characterized as phosphoarginine (9.Pereira C.A. Alonso G.D. Paveto M.C. Flawiá M.M. Torres H.N. J. Eukar. Microbiol. 1999; 46: 566-570Crossref PubMed Scopus (65) Google Scholar). The present article provides wide information on the enzymatic and genetic characterization of T. cruzi arginine kinase. Enzymes and PCR1 reagents were provided by Promega Corporation (Madison, WI). Oligonucleotides were from Biosynthesis, Inc. (Lewisville, TX), and other reagents were from Sigma Chemical Co. (St. Louis, MO). Unless otherwise indicated, T. cruziepimastigote forms of the Tulahuen 2 strain were cultured at 28 °C in a medium containing 5 g/liter liver infusion, 5 g/liter Bacto-tryptose (Difco Laboratories, Detroit, MI), 68 mmNaCl, 5.3 mm KCl, 22 mmNa2HPO4, 0.2% glucose, 0.002% hemin supplemented with 10% fetal calf serum, 10 units/ml penicillin, and 10 mg/liter streptomycin. Cell viability was assessed by direct microscopic examination. For arginine kinase purification, epimastigotes from 7-day cultures (late logarithmic phase) were collected by centrifugation at 1,000 × g, washed three times with 25 mm Hepes adjusted to pH 7.3 with Tris and containing 1.8 mmCaCl2, 0.8 mm MgSO4, 2.7 mm KCl, 1.2 mm KH2PO4, 154 mm NaCl, and 5.5 mm d-glucose (buffer A). The pellet was then resuspended (1 ml/each 30 ml of culture) in 25 mm Hepes buffer, pH 7.3, containing 0.01 mg/ml leupeptin, 2 mg/ml soybean trypsin inhibitor, 1 mmbenzamidine, 25 units/ml Trasylol, 0.1 mmphenylmethylsulfonyl fluoride, and 0.5 mm tosyl-lysine chloromethyl ketone, and lysed by six cycles of freezing in liquid N2 and thawing at 4 °C. The extract was then centrifuged 5 min at 8,000 × g. The supernatant thus obtained was used as a source of epimastigote proteins for the arginine kinase purification. The supernatant fluid (5.0 ml) was applied to a 5 × 1-cm Whatman DE-52 column equilibrated with 25 mm Hepes buffer, pH 7.6, and washed with 25 ml of the same buffer solution. The enzyme activity was recovered in the percolate. After a concentration step using Amicon ultracentrifugation cells, the sample (0.5 ml) was applied to a Superose-6 HR10/30 column (Amersham Pharmacia Biotech) equilibrated as above. The effluent, obtained at a rate of 0.3 ml/min, was collected in 0.5-ml fractions. The peak activity fractions were pooled and used as a source of kinase activity. These fractions were enriched 80-fold in enzyme activity with a recovery of about 55% (specific activity 0.8–1.2 μmol·min−1·mg of protein−1; see Fig. 3 B). Purification of recombinant arginine kinase was performed on a Ni-NTA agarose column (QIAGEN, Valencia, CA) according to the manufacturer's instructions for denatured polypeptides. The eluate was then dialyzed successively for 24 h against decreasing urea concentrations (from 7.0 m to none) in 0.1 m phosphate buffer, pH 7.2, containing 7 mm 2-mercaptoethanol, 10% glycerol, and 0.15 m NaCl, to obtain recombinant arginine kinase with a specific activity of 10–16 μmol·min−1·mg of protein−1 and a yield of 10–20 mg of protein/liter of culture (see Fig. 3 A). The incubation mixture contained 25 mm Hepes buffer, pH 7.3, 2 mm ATP, 5 mm magnesium acetate, 10 mm 2-mercaptoethanol, 1 mm l-[2,3-3H]arginine (NEN Life Science Products, Boston, MA; 0.5 μCi/assay), and an enzyme source (0.1–8 μg of protein) in a total volume of 0.2 ml. Incubations were carried out for 10 min at 30 °C, and reactions were stopped by the addition of 1 ml of 25 mm Hepes buffer, pH 7.3, containing 10 mm l-arginine and 5 mm EDTA (stop buffer). The mixtures were then resolved by passage through a strong anion exchange resin, AG 1-X4, 200–400 mesh chloride form (Bio-Rad Laboratories, Hercules, CA) mounted into 1-ml tulip columns equilibrated with stop buffer. After loading the samples, the columns were washed with 3 ml of 25 mm Hepes buffer, pH 7.3, and eluted with 2 ml of 1 m NaCl. The eluates were counted for radioactivity. The assay method for arginine kinase activity is validated for the ulterior analysis of the anion exchange eluate products by mass spectrometry (see below). Under the conditions described above, phosphoarginine but not l-arginine was retained by the anion exchange resin. In addition, the eluate fraction contained less than 2% of free l-arginine and more than 95% of the phosphoarginine produced. Arginine kinase activity was assayed alternatively using a modification of the procedure described by France et al. (10.France R.M. Cellers D.S. Grossman S.H. Arch. Biochem. Biophys. 1997; 345: 73-78Crossref PubMed Scopus (58) Google Scholar). The reaction mixture contained 25 mm Hepes, pH 7.3, 10 mm l-arginine, 2 mm[γ-32P]ATP (NEN Life Science Products), 5 mm magnesium acetate, 10 mm 2-mercaptoethanol, and an enzyme source in a final volume of 0.2 ml. The reaction was carried out for 10 min at 30 °C and stopped by the addition of trichloroacetic acid to a final concentration of 1.4% and heating for 1 min at 100 °C. Mixtures were cooled 1 min on ice and then extracted with isobutyl alcohol/(NH)4MoO4 as described by Richards et al. (11.Richards D.E. Rega A.F. Garrahan P.J. Biochim. Biophys. Acta. 1978; 511: 194-201Crossref PubMed Scopus (86) Google Scholar). Aliquots of 0.1 ml of the organic phase were counted for radioactivity. For both procedures, the enzyme activity was proportional to the incubation time (2–20 min) and enzyme protein (0.1–1.0 μg protein of Superose fraction). DNA was obtained from an epimastigote lysate, treated with proteinase K, by phenol-chloroform extraction and centrifugation through a CsCl gradient. Total RNA was prepared from approximately 3.7 × 1010 cells (99% epimastigotes), according to Chomszynski and Sacchi (12.Chomszynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159PubMed Google Scholar). A putative arginine kinase sequence of 287 bp was amplified from T. cruzi DNA as template using two degenerated primers with the sequences GA(C/T)GA(C/T)CACTT(C/T)CT(G/T/C)TT(C/T)AA(A/G)G (forward) and GTCGT(A/G)CC(G/A/C)AG(A/G)TT(C/T)G(A/T)(G/T)GG(A/G)C (reverse). Primer structures were deduced from arginine kinase amino acid sequences from Apis mellifera, Drosophila melanogaster, Penaeus japonicus, andCaenorhabditis elegans (see “Results” and Fig.2 A). Incubation mixtures contained 400–700 ng of T. cruzi DNA, 200–500 ng of each primer and 4 mmMgCl2. Amplification conditions were as follows: 5 min at 95 °C, 35 cycles of 2 min at 95 °C, 1 min at 55 °C, and 1.5 min at 72 °C, followed by an extension step at 72 °C for 10 min. A 287-bp product was obtained by PCR amplification, subcloned, and sequenced. This product showed an 83% identity with theTrypanosoma brucei rhodesiense expressed sequence tag (Accession Number W00186) and a high identity with others related guanidino kinases. Probes were labeled with the random primer DNA labeling kit from Bio-Rad using [α-32P]dCTP (NEN Life Science Products) as the labeled nucleotide. A T. cruzi genomic library from the CL Brener clone was obtained from Dr. M. Levin. This library was prepared by Dr. Edson Rondinelli (Instituto de Biofisica, Universidade de Rio de Janeiro, Brazil) in the λ phage replacement vector Lambda FIX II (Stratagene, La Jolla, CA), containing 12–15-kbp inserts into the XhoI site, and is available through the T. cruzi genome initiative (13.Zingales B. Rondinelli E. Degrave W. da Silveira F. Levin M. Le Paslier D. Modabber F. Dobrokhotov B., B. Swindle J. Kelly J.M. Åslung L. Hoheisel J.D. Ruiz A.M. Cazzulo J.J. Pettersson U. Frash A.C. Parasitol. Today. 1997; 13: 16-22PubMed Google Scholar). Approximately 100,000 independent recombinant phages were screened with the 287-bp PCR fragment as a probe and, after three rounds of selection, three phage clones giving positive hybridization signals were selected. The positive phage clones were subjected to sequencing using the PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit (Perkin-Elmer, Foster City, CA). This procedure requires the Applied Biosystems model 373A DNA automatic sequencer. Mixtures were supplemented with double-stranded phage DNA and the corresponding oligonucleotide. Reactions were performed in the model 480 DNA Thermal Cycler (Perkin-Elmer) following the manufacturer's instructions. For Northern blot analysis, 10–20 μg of total RNA samples from epimastigote cells were electrophoresed on a 1.5% agarose gel, transferred to a Hybond N+ nylon membrane (Amersham Pharmacia Biotech), and hybridized with the full-length arginine kinase gene as a probe. The Southern blot analysis was performed using aliquots of 5 μg of DNA previously digested with the following endonucleases: AccI,BamHI, BglI, and EcoRI. The products were resolved by electrophoresis in a 0.8% agarose gel, transferred, and hybridized as described for Northern blots. Pulsed-field gel electrophoresis was performed in a CHEF electrophoresis cell (Bio-Rad) with a hexagonal electrode array. Agarose blocks containing about 107 epimastigote forms were prepared as described (14.Engman D.M. Reddy L.V. Donelson J.E. Kirchhoff L.V. Mol. Biochem. Parasitol. 1987; 22: 115-123Crossref PubMed Scopus (76) Google Scholar). The separation of the chromosomal bands was carried out in 1.0% Gel Seakem agarose (FMC BioProducts, Rockland, ME) in 0.5 × TBE (45 mm Tris, 45 mm boric acid, 1 mm EDTA, pH 8.3), and run in the same buffer. The electrophoretic conditions were as follows: 16 h, 6 V/cm pulsed each 60–90 s; 20 h, 3 V/cm pulsed each 200–500 s; and 24 h, 2.7 V/cm pulsed each 500–1,200 s, maintained at constant temperature (14 °C). After electrophoresis, the gel was stained with ethidium bromide (0.1 μg/ml) and photographed. Chromosomes fromSaccharomyces cerevisiae (Life Technologies, Gaithersburg, MD) were used as molecular mass standards. The gel was treated for 10 min with 0.25 m HCl and washed twice with bidistilled water. DNA was denatured in a solution containing 0.4 mNaOH and 1 m NaCl (two incubations, 20 min each). The transfer of nucleic acids and hybridization conditions were the same as those described for Northern blots. A fragment carrying the entire T. cruzi arginine kinase sequence was obtained by PCR using as primers the following oligonucleotides: CGCGGATCCAACTCAGTCACGATGGCC (5′-end carrying aBamHI site) and CGGAATTCGGCTCACCTCGCAGATTC (3′-end carrying an EcoRI site). Conditions were similar to those described above. After double digestion with BamHI andEcoRI, the fragment thus generated was purified with the Wizard PCR Preps Kit (Promega) and ligated to the pRSET A vector (Invitrogen, Carlsbad, CA) treated previously with EcoRI andBamHI. This plasmid transcribes under the control of the T7 promoter and includes a polyhistidine tag. Expression was performed in the BL21(DE3)pLysS host (E. coli B, F−, dcm, ompT, hsdS, (rb−, mB−), gal λ(DE3),[pLysS, Camr ]). An overnight culture was carried out in 700 ml of LB medium containing ampicillin and chloramphenicol. Induction was performed with 100 mmisopropyl-1-thio-β-d-galactopyranoside for 60 min at 37 °C. Arginine kinase antiserum was obtained using female mice from the BALB/c strain immunized by an intraperitoneal injection of 50 μg of recombinant arginine kinase plus 0.1 ml of incomplete Freund's adjuvant followed, 15 days later, by a booster intraperitoneal injection of 50 μg of recombinant protein. After 15 days, mice were bled by exposing the ocular cavity. Procedures for SDS-polyacrylamide gel electrophoresis of protein samples were carried out as described by Laemmli (15.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). Polypeptides were electrotransferred from polyacrylamide gels to Hybond-C membranes (Amersham Pharmacia Biotech). For reaction with the antibody, the transferred membranes were blocked with a 5% (w/v) non-fat milk suspension for 30 min. After incubation for 2 h with a 1:100 dilution of the mouse anti-arginine kinase antiserum, detection was carried out by incubating with a 1:2,000 dilution of sheep anti-mouse Ig conjugated with horseradish peroxidase (Amersham Pharmacia Biotech). The latter was developed with the Renaissance Western blot Chemiluminescence Reagent Plus (NEN Life Science Products). l-Arginine and phosphoarginine characterization was performed by mass spectrometry using a ZAB-SE Q4F (Micromass, UK) mass spectrometer (high mass, 800; low mass, 50; resolution, 1,000; time (s/dec), 4; ionization mode, FAB− and FAB+; accelerating voltage, 8,000 V). Protein was assayed as described by Bradford (16.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216440) Google Scholar). Sequences were analyzed, compared, and aligned using Advanced BLAST version 2.0, Clustal W, and LaserGene software (DNASTAR, Inc.). Consensus sequences in T. cruzi arginine kinase were located with BLOCKS (17.Henikoff J.G. Henikoff S. Pietrokovski S. Nucleic Acids Res. 1999; 27: 226-228Crossref PubMed Scopus (84) Google Scholar). An arginine kinase activity was detected in partially purified preparations from T. cruzi epimastigote soluble extracts. The activity requires ATP and a divalent cation such as Mg2+, Mn2+, or Ca2+; dATP or GTP is less efficient than ATP in phosphorylating l-arginine (Table I). Michaelis-Menten constant (K m) values for both ATP and l-arginine were about 0.3 mm, and the optimum pH was 8.2 (results not shown). Identical results were obtained with the two kinase assay procedures (see “Experimental Procedures”).Table IEffect of divalent cations and nucleoside triphosphates on T. cruzi arginine kinase activityAdditions/omissionsArginine kinaseRecombinant AKμmol · min −1 · mg −1μmol · min −1 · mg −1None (control)0.81 ± 0.00410.65 ± 0.257Minus ATP0.00 ± 0.0020 ± 0.005Minus Mg2+, plus 10 mm EDTA0.11 ± 0.0100.28 ± 0.027Minus Mg2+, plus 5 mm Mn2+0.74 ± 0.0440.27 ± 0.022Minus Mg2+, plus 5 mm Ca2+0.47 ± 0.0327.03 ± 0.147Plus 5 mmZn2+0.05 ± 0.0190.56 ± 0.052Minus Mg2+, plus 5 mm Zn2+0.00 ± 0.0050.19 ± 0.017Plus 5 mmCu2+0.02 ± 0.0070.50 ± 0.262Minus Mg2+, plus 5 mm Cu2+0.00 ± 0.0100.15 ± 0.097Minus ATP, plus 2 mmdATP0.49 ± 0.1017.69 ± 0.059Minus ATP, plus 2 mm GTP0.16 ± 0.1220.03 ± 0.0030.8 μg of partially purified T. cruzi soluble extract and 0.2 μg of the recombinant protein were assayed for arginine kinase (AK) activity with the standard method as described under “Experimental Procedures,” with the modifications listed in the table. A control reaction was performed in the presence of 2 mm ATP and 5 mm MgAcO. Data are the means ± S.D. of triplicates. Open table in a new tab 0.8 μg of partially purified T. cruzi soluble extract and 0.2 μg of the recombinant protein were assayed for arginine kinase (AK) activity with the standard method as described under “Experimental Procedures,” with the modifications listed in the table. A control reaction was performed in the presence of 2 mm ATP and 5 mm MgAcO. Data are the means ± S.D. of triplicates. The reaction product was characterized by mass spectrometry. Standard phospho-l-arginine and arginine kinase reaction products gave the same FAB+ signals: m/z 113 and 207; FAB− signals were also identical:m/z 255 and 283. The effects of several amino acids, arginine/guanidine derivatives, and polyamines on T. cruzi arginine kinase were tested. Under standard assay conditions (1 mm l-arginine), the presence of 5-fold higher concentrations of canavanine and histidine produced a greater than 50% inhibition. Other compounds such as l-homoarginine, l-glutamate, N-methyl-l-arginine, l-nitroarginine,l-lysine, l-aspartate, agmatine, and ethylguanidine elicited inhibitions of between 20 and 35% (TableII). Inhibition constant (K i) values for canavanine and homoarginine were calculated because both metabolites produced inhibition of arginine kinase activity as well as arginine transport in epimastigote cells (9.Pereira C.A. Alonso G.D. Paveto M.C. Flawiá M.M. Torres H.N. J. Eukar. Microbiol. 1999; 46: 566-570Crossref PubMed Scopus (65) Google Scholar). K i values for canavanine and homoarginine were 6.0 mm, and 7.0 mm respectively (results not shown).Table IIEffect on T. cruzi arginine kinase of several amino acids, arginine/guanidine derivatives and polyaminesAdditionArginine kinaseInhibitionRecombinant AKInhibitionμmol · min −1 · mg −1%μmol · min −1 · mg −1%None (control)1.20 ± 0.027015.99 ± 0.5410l-Histidine0.52 ± 0.0225611.74 ± 0.08527l-Lysine0.90 ± 0.0552513.58 ± 0.04515Glycine1.19 ± 0.145115.34 ± 0.2354l-Isoleucine1.02 ± 0.0641514.55 ± 0.4539l-Aspartate0.90 ± 0.0842513.43 ± 0.26016l-Glutamate0.82 ± 0.0073113.81 ± 0.58014N-Methyl-l-arginine0.86 ± 0.0552813.25 ± 1.12717l-Nitroarginine0.86 ± 0.0372811.95 ± 0.41225d-Arginine1.27 ± 0.020016.59 ± 0.1700l-Homoarginine0.80 ± 0.0163313.83 ± 0.25613l-Ornithine1.06 ± 0.0851214.53 ± 0.3769l-Citrulline1.17 ± 0.032213.75 ± 0.09614Creatine1.05 ± 0.0111313.39 ± 0.30516Canavanine0.27 ± 0.044779.30 ± 0.35742Agmatine0.96 ± 0.1822013.47 ± 1.28316Putrescine1.29 ± 0.045017.77 ± 0.5440Ethylguanidine0.94 ± 0.0512214.27 ± 0.73911Guanidine propionic0.97 ± 0.0971813.57 ± 0.83115Amino guanidine1.01 ± 0.0041614.68 ± 0.3448Guanidine1.11 ± 0.067714.07 ± 0.32112Methylguanidine1.19 ± 0.042113.81 ± 0.08314Urea1.15 ± 0.079414.69 ± 0.0678γ-Guanidine butyramide1.16 ± 0.100315.74 ± 0.0782The effects of different compounds were tested on the native and recombinant arginine kinase (AK) standard assay, as described under “Experimental Procedures,” in the presence of 1 mmarginine and a 5-fold molar excess (5 mm) of the metabolite screened. Data are the means ± S.D. of triplicates. Open table in a new tab The effects of different compounds were tested on the native and recombinant arginine kinase (AK) standard assay, as described under “Experimental Procedures,” in the presence of 1 mmarginine and a 5-fold molar excess (5 mm) of the metabolite screened. Data are the means ± S.D. of triplicates. Available arginine kinase sequences were selected as a source of information to amplify a putative homologue from T. cruzi DNA. Arthropods and helminths such as A. mellifera, D. melanogaster, P. japonicus, and C. elegans belong to the lowest evolved metazoa and posses arginine kinases with reported genetic sequences. All of these sequences share amino acid identities of about 60–70% (see Fig. 2). Taking into account this information, a set of primers was designed and used to amplify a putative arginine kinase fromT. cruzi DNA. The only product resulting from this amplification was a fragment of 287 bp. After sequencing, the fragment revealed a 79% amino acid identity with an equivalent domain ofD. melanogaster arginine kinase. The 287-bp fragment was used to probe a T. cruzi genomic library in λ FIX II. Following a tertiary screening, three clones were isolated with 12–15-kbp inserts. One of these, when subjected to sequencing, revealed an open reading frame corresponding to a polypeptide of 357 amino acids (Fig. 1) with a molecular weight of 40,201 and a theoretical isoelectric point of 7.04. This protein sequence shows all of the characteristic consensus blocks of the ATP:guanidino phosphotransferase family (see “Experimental Procedures”): BL001112A (positions 52–95), BL00112B (positions 116–149), BL00112C (positions 161–191), BL00112D (positions 199–245), BL00112E (positions 259–288), and BL00112F (positions 306–354). BL00112E houses the consensus CPTNLGT (positions 271–277), which partially corresponds to the active site of the kinase. In addition, a putative “actinin-type” actin binding domain (18.Kuhlman P.A. Hemmings L. Critchley D.R. FEBS Lett. 1992; 304: 201-206Crossref PubMed Scopus (58) Google Scholar), DAKTFLVWVNE, was found (positions 214–224). 5′- and 3′-noncoding sequences were also characterized. A proposed “pyrimidine-rich” region and a splice leader acceptor site were located at the 5′-noncoding region, whereas downstream of the coding region, a 309-bp noncoding sequence was found, apparently followed by an open reading frame. This sequence is identical to a T. cruzi expressed sequence tag (GenBank AI035059) reported by theT. cruzi genome initiative. The protein coded by this open reading frame of 82 amino acids is quite unusual: it contains 15 arginines, 5 lysines, and has an isoelectric point of 10.8. The highest amino acid identities of the T. cruzi sequence were with arginine kinases of A. mellifera (insect), D. melanogaster (insect), P. japonicus (crustacean), and C. elegans (helminth): 69.6, 66.9, 71.8, and 58.5%, respectively. Identity with a putative bacterial arginine kinase, from Chlamydia trachomatis, was rather poor: 11.2%. When the comparison was made with other guanidino kinases, the degree of homology was 39% with the human creatine kinase, 38% with the lombricine kinase from Eisenia fetida(annelid), and 36% with the guanidino acetate kinase of Neanthes diversicolor (annelid) (Fig.2 A). A phylogenetic tree was constructed from the 10 ATP:guanidino phosphotransferase sequences analyzed (Fig. 2 B). The phenogram indicates the existence of three major groups: one corresponding to arthropod and helminth arginine kinases; the second to a variety of creatine, lombricine, and glycocyamine kinases; and a third group that comprises a bacterial arginine kinase. T. cruzi arginine kinase clearly belongs to the first group. The expressed enzyme was purified to near homogeneity as described under “Experimental Procedures” (Fig.3 A) and assayed for biochemical properties. It was recovered with a specific activity of about 10–16 μmoles·min−1·mg of protein−1. This value was 10 times lower than those reported for some arthropod and mollusk muscle arginine kinases (19.Rosenthal G.A. Dahlman D.L. Robinson G.W. J. Biol. Chem. 1977; 252: 3679-3683Abstract Full Text PDF PubMed Google Scholar, 20.Reddy R.R.S. Roustan C. Benyamin Y. Comp. Biochem. Physiol. 1991; 99B: 387-394Google Scholar, 21.Strong S.J. Ellington R.W. Comp. Biochem. Physiol. 1996; 113B: 809-816Crossref Scopus (25) Google Scholar). On the other hand, some kinetic properties of the recombinant and the native T. cruzi enzymes were similar but not identical; for example, the K m value for ATP andl-arginine was about 0.3 mm for both preparations (results not shown). On the other hand, the recombinant enzyme was less active with Mn2+ than the native one (TableI). Southern blots were carried out on DNA from the T. cruzi Tulahuen 2 strain digested with four restriction endonucleases. Hybridization analysis using as probe the fragment carrying the entire T. cruzi arginine kinase sequence revealed that T. cruzi arginine kinase is encoded by a single-copy gene (Fig. 4 A). These results are consistent with those obtained by pulsed-field gel electrophoresis analysis of T. cruzi chromosomes (chromosome blot), in which only two chromosomal bands of 880 and 847 kbp were detected (see Fig. 4 C). On the other hand, Northern blot analysis of T. cruzi RNA using the fragment carrying the entire T. cruziarginine kinase sequence revealed a mRNA subpopulation of about 2.0 kb (Fig. 4 B). Western blot analysis of polypeptides in an epimastigote soluble extract, using the antiserum against T. cruzi recombinant arginine kinase, revealed a 40-kDa polypeptide band (Fig.4 D). Cytosolic fractions of some lower eukaryotic organisms were assayed for arginine kinase activity. The activity was present in the Tulahuen 0, Tulahuen 2 and G T. cruzistrains, as well as in: Trypanosoma rangeli,Herpetomonas muscarum, and Leptomonas samueli. No activity was detected in Crithidia fasciculata,Leishmania chagasi, Plasmodium falciparum,Toxoplasma gondii, Euglena gracilis, andAcanthamoeba polyphaga (results not shown). The present study reports the biochemical characterization and the analysis of the genetic sequence of arginine kinase from the flagellate protozoan T. cruzi. The enzyme was partially purified from epimastigote cells and from an E. coli expression system. Except for the behavior to divalent cations and some inhibitors both preparations showed similar kinetic properties. This may be attributable to an inappropriate folding of the recombinant enzyme or the presence of a histidine tag. Because this enzyme presents an extraordinary amino acid homology compared with those from crustaceans and insects, the evolutionary origin of its sequence is under discussion. Indeed, it is accepted that arthropods were the first hosts for trypanosomatids. Later, some of them diverged to parasitize plants and warm blooded animals. Thus, it may be speculated that some kind of horizontal genetic transfer between arthropods and trypanosomatids might have occurred during evolution. An interesting fact is related to the role of arginine kinase in trypanosomatids and, in general terms, in protozoa organisms from which it was believed that phosphoguanidino phosphagens were excluded. In this regard, the presence of a putative actinin-like actin binding domain in the sequence of this enzyme clearly suggests a relationship with cytoskeletal structures related to cell movement, particularly flagellar movement and other processes requiring a high energy consumption. From the experience in T. cruzi, it is evident that the role of phosphagens is not restricted to multicellular organisms bearing movements driven by muscle tissue. A last point is related to therapeutic implications of arginine kinase. Because this kinase is not present in mammalian tissues, it could be a possible target for the future development of chemotherapeutic agents against Chagas' disease and other parasitic diseases caused by related organisms. For this purpose, a rational approach would involve three steps: 1) identification in the parasite of a unique biochemical compound different from those in the host cell (in our case phosphoarginine); 2) characterization of the target enzyme responsible for the production of such compound (the arginine kinase described here); and 3) search for a specific inhibitor of this enzyme. We express our thanks to Dr. Antonio Gonzalez Aguilar from the Lopez-Neyra Institute for Research in Parasitology, Granada, Spain for helping us with the sequencing and to Dr. Tomohiko Suzuki from the Kochi University in Japan for the helpful advice.