Clinical Relevance of Helicobacter pylori cagA and vacA Gene Polymorphisms
2008; Elsevier BV; Volume: 135; Issue: 1 Linguagem: Inglês
10.1053/j.gastro.2008.03.041
ISSN1528-0012
AutoresDaniela Basso, Carlo–Federico Zambon, Darren P. Letley, Alessia Stranges, Alberto Marchet, Joanne L. Rhead, Stefania Schiavon, Graziella Guariso, Marco Ceroti, Donato Nitti, Massimo Rugge, Mario Plebani, John C. Atherton,
Tópico(s)Gastroesophageal reflux and treatments
ResumoBackground & Aims: The Helicobacter pylori gene cagA and s1 or m1 forms of vacA are more common in disease-associated strains. Recently, forms of cagA encoding multiple type C EPIYA segments (which increase phosphorylation-dependent CagA activity) and a new type i1 “intermediate region” polymorphism in vacA (which confers toxicity) have been described. We assessed the association of new and established cagA and vacA polymorphisms with disease. Methods: We studied 203 H pylori–infected subjects (53 gastric cancer [GC], 52 peptic ulcer [PU], and 98 gastritis). vacA signal, mid and intermediate region polymorphisms, cagA presence, and EPIYA-C segment number were analyzed by polymerase chain reaction. Results: cagA-positive strains were significantly associated with GC and PU (P < .001 and P < .05). GC risk was further associated with the number of cagA EPIYA-C segments (odds ratio [OR] = 7.37, 95% confidence interval [CI] = 1.98–27.48 for 1 EPIYA-C segment; OR = 32.5, 95% CI = 8.41–125.58 for 2 or more EPIYA-C segments). Increasing number of EPIYA-C segments also increased the risk of intestinal metaplasia. Type s1 and i1 vacA alleles were also associated with GC and type i1 vacA with PU (OR = 2.58, 95% CI = 1.19–5.61), including a significant association with duodenal ulcer. In multivariate analysis, the associations of cagA EPIYA-C segment number with GC and intestinal metaplasia as well as vacA i1 type association with PU remained. Conclusions: We confirmed the associations of cagA and vacA polymorphisms with disease but now define their most important features. For cancer risk, among Western strains, the most important factor is the number of cagA EPIYA-C segment. For PU risk, it is the intermediate region type of vacA. Background & Aims: The Helicobacter pylori gene cagA and s1 or m1 forms of vacA are more common in disease-associated strains. Recently, forms of cagA encoding multiple type C EPIYA segments (which increase phosphorylation-dependent CagA activity) and a new type i1 “intermediate region” polymorphism in vacA (which confers toxicity) have been described. We assessed the association of new and established cagA and vacA polymorphisms with disease. Methods: We studied 203 H pylori–infected subjects (53 gastric cancer [GC], 52 peptic ulcer [PU], and 98 gastritis). vacA signal, mid and intermediate region polymorphisms, cagA presence, and EPIYA-C segment number were analyzed by polymerase chain reaction. Results: cagA-positive strains were significantly associated with GC and PU (P < .001 and P < .05). GC risk was further associated with the number of cagA EPIYA-C segments (odds ratio [OR] = 7.37, 95% confidence interval [CI] = 1.98–27.48 for 1 EPIYA-C segment; OR = 32.5, 95% CI = 8.41–125.58 for 2 or more EPIYA-C segments). Increasing number of EPIYA-C segments also increased the risk of intestinal metaplasia. Type s1 and i1 vacA alleles were also associated with GC and type i1 vacA with PU (OR = 2.58, 95% CI = 1.19–5.61), including a significant association with duodenal ulcer. In multivariate analysis, the associations of cagA EPIYA-C segment number with GC and intestinal metaplasia as well as vacA i1 type association with PU remained. Conclusions: We confirmed the associations of cagA and vacA polymorphisms with disease but now define their most important features. For cancer risk, among Western strains, the most important factor is the number of cagA EPIYA-C segment. For PU risk, it is the intermediate region type of vacA. The main virulence determinant of Helicobacter pylori is a pathogenicity island called cag. cag pathogenicity island–positive strains have been shown in many studies to be closely associated with peptic ulcer (PU) and gastric cancer (GC).1Peek Jr, R.M. Blaser M.J. Helicobacter pylori and gastrointestinal tract adenocarcinomas.Nat Rev Cancer. 2002; 2: 28-37Crossref PubMed Scopus (1474) Google Scholar, 2Palli D. Masala G. Del Giudice G. et al.CagA+ Helicobacter pylori infection and gastric cancer risk in the EPIC-EURGAST study.Int J Cancer. 2007; 120: 859-867Crossref PubMed Scopus (113) Google Scholar Genes in the cag pathogenicity island encode a type IV secretion system through which an effector protein, CagA, is translocated into the host cell cytoplasm.3Blaser M.J. Atherton J.C. Helicobacter pylori persistence: biology and disease.J Clin Invest. 2004; 113: 321-333Crossref PubMed Scopus (764) Google Scholar Once inside the host cell, CagA can disrupt signaling pathways by phosphorylation-dependent and -independent mechanisms, leading to abnormal proliferation, motility, and cytoskeletal change in gastric epithelial cells.4Segal E.D. Cha J. Lo J. et al.Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori.Proc Natl Acad Sci U S A. 1999; 96: 14559-14564Crossref PubMed Scopus (669) Google Scholar, 5Stein M. Rappuoli R. Covacci A. Tyrosine phosphorylation of the Helicobacter pylori CagA antigen after cag-driven host cell translocation.Proc Natl Acad Sci U S A. 2000; 97: 1263-1268Crossref PubMed Scopus (519) Google Scholar, 6Mimuro H. Suzuki T. Tanaka J. et al.Grb2 is a key mediator of Helicobacter pylori CagA protein activities.Mol Cell. 2002; 10: 745-755Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar, 7Hirata Y. Maeda S. Mitsuno Y. et al.Helicobacter pylori CagA protein activates serum response element-driven transcription independently of tyrosine phosphorylation.Gastroenterology. 2002; 123: 1962-1971Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 8Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein.Nat Rev Cancer. 2004; 4: 688-694Crossref PubMed Scopus (597) Google Scholar, 9Bagnoli F. Buti L. Tompkins L. et al.Helicobacter pylori CagA induces a transition from polarized to invasive phenotypes in MDCK cells.Proc Natl Acad Sci U S A. 2005; 102: 16339-16344Crossref PubMed Scopus (208) Google Scholar, 10Kurashima Y. Murata-Kamiya N. Kikuchi K. et al.Deregulation of beta-catenin signal by Helicobacter pylori CagA requires the CagA-multimerization sequence.Int J Cancer. 2008; 122: 823-831Crossref PubMed Scopus (59) Google Scholar CagA is phosphorylated by Src kinases in the C-terminal region on tyrosine phosphorylation motifs containing the Glu-Pro-Ile-Tyr-Ala (EPIYA) amino acid sequence. CagA is characterized by structural diversity in the EPIYA-repeat segment, which results in 2 major species: Western and East Asian CagA. Four types of EPIYA segments are described: A, B, C, and D. Western strains most commonly have an ABC pattern and East Asian strains an ABD pattern. A, B, and D segments are occasionally absent or repeated. In contrast, C segments are often duplicated and Western strains with ABCC and ABCCC patterns are relatively common. As EPIYA-C segment numbers increase, the magnitude of CagA phosphorylation increases and the CagA-induced cellular effects are more profound. This has been suggested to enhance cancer risk.8Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein.Nat Rev Cancer. 2004; 4: 688-694Crossref PubMed Scopus (597) Google Scholar, 11Higashi H. Tsutsumi R. Fujita A. et al.Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites.Proc Natl Acad Sci USA. 2002; 99: 14428-14433Crossref PubMed Scopus (471) Google Scholar, 12Zhang Y. Argent R.H. Letley D.P. et al.Tyrosine phosphorylation of CagA from Chinese Helicobacter pylori isolates in AGS gastric epithelial cells.J Clin Microbiol. 2005; 43: 786-790Crossref PubMed Scopus (25) Google Scholar, 13Azuma T. Yamazaki S. Yamakawa A. et al.Association between diversity in the Src homology 2 domain—containing tyrosine phosphatase binding site of Helicobacter pylori CagA protein and gastric atrophy and cancer.J Infect Dis. 2004; 189: 820-827Crossref PubMed Scopus (182) Google Scholar, 14Yamaoka Y. Kodama T. Kashima K. et al.Variants of the 3′ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases.J Clin Microbiol. 1998; 36: 2258-2263Crossref PubMed Google Scholar, 15Argent R.H. Kidd M. Owen R.J. et al.Determinants and consequences of different levels of CagA phosphorylation for clinical isolates of Helicobacter pylori.Gastroenterology. 2004; 127: 514-523Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 16Naito M. Yamazaki T. Tsutsumi R. et al.Influence of EPIYA-repeat polymorphism on the phosphorylation-dependent biological activity of Helicobacter pylori CagA.Gastroenterology. 2006; 130: 1181-1190Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar A second virulence factor is the vacuolating cytotoxin, VacA.17Cover T.L. Blanke S.R. Helicobacter pylori VacA, a paradigm for toxin multifunctionality.Nat Rev Microbiol. 2005; 3: 320-332Crossref PubMed Scopus (414) Google Scholar The gene encoding this (vacA), detectable in all strains, is polymorphic, with different types encoding VacA with different levels of vacuolating cytotoxin activity. The major variation occurs in the vacA signal region (which can be type s1 or s2) and the mid region (m1 or m2).18Atherton J.C. Cao P. Peek Jr, R.M. et al.Mosaicism in vacuolating cytotoxin alleles of Helicobacter pyloriAssociation of specific vacA types with cytotoxin production and peptic ulceration.J Biol Chem. 1995; 270: 17771-17777Crossref PubMed Scopus (1382) Google Scholar, 19Atherton J.C. Peek Jr, R.M. Tham K.T. et al.Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori.Gastroenterology. 1997; 112: 92-99Abstract Full Text PDF PubMed Scopus (580) Google Scholar Type s1m1 strains are highly toxigenic and s2m2 strains are nontoxigenic, while s1m2 strains are often intermediate. Few s2m1 strains have been described,20Letley D.P. Lastovica A. Louw J.A. et al.Allelic diversity of the Helicobacter pylori vacuolating cytotoxin gene in South Africa: rarity of the vacA s1a genotype and natural occurrence of an s2/m1 allele.J Clin Microbiol. 1999; 37: 1203-1205Crossref PubMed Google Scholar suggesting the existence of a strong negative selection toward this allele. The interaction of active VacA toxins with specific cellular receptors evokes a cascade of cellular events: induction of large cytoplasmic vacuoles, mitochondrial damage, cytochrome c release, inhibition of T-lymphocyte activation, and interference with antigen presentation.3Blaser M.J. Atherton J.C. Helicobacter pylori persistence: biology and disease.J Clin Invest. 2004; 113: 321-333Crossref PubMed Scopus (764) Google Scholar, 17Cover T.L. Blanke S.R. Helicobacter pylori VacA, a paradigm for toxin multifunctionality.Nat Rev Microbiol. 2005; 3: 320-332Crossref PubMed Scopus (414) Google Scholar, 21Ji X. Fernandez T. Burroni D. et al.Cell specificity of Helicobacter pylori cytotoxin is determined by a short region in the polymorphic mid region.Infect Immun. 2000; 68: 3754-3757Crossref PubMed Scopus (72) Google Scholar, 22Sundrud M.S. Torres V.J. Unutmaz D. et al.Inhibition of primary human T cell proliferation by Helicobacter pylori vacuolating toxin (VacA) is independent of VacA effects on IL-2 secretion.Proc Natl Acad Sci U S A. 2004; 101: 7727-7732Crossref PubMed Scopus (206) Google Scholar, 23Yamasaki E. Wada A. Kumatori A. et al.Helicobacter pylori vacuolating cytotoxin induces activation of the proapoptotic proteins Bax and Bak, leading to cytochrome c release and cell death, independent of vacuolation.J Biol Chem. 2006; 281: 11250-11259Crossref PubMed Scopus (124) Google ScholarvacA s1/m1 and s1/m2 strains have been associated with PU, and s1/m1 strains have been associated with GC.18Atherton J.C. Cao P. Peek Jr, R.M. et al.Mosaicism in vacuolating cytotoxin alleles of Helicobacter pyloriAssociation of specific vacA types with cytotoxin production and peptic ulceration.J Biol Chem. 1995; 270: 17771-17777Crossref PubMed Scopus (1382) Google Scholar, 19Atherton J.C. Peek Jr, R.M. Tham K.T. et al.Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori.Gastroenterology. 1997; 112: 92-99Abstract Full Text PDF PubMed Scopus (580) Google Scholar, 24Rhead J.L. Letley D.P. Mohammadi M. et al.A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer.Gastroenterology. 2007; 133: 926-936Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar Recently, Rhead et al24Rhead J.L. Letley D.P. Mohammadi M. et al.A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer.Gastroenterology. 2007; 133: 926-936Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar described a new polymorphic region in vacA that they termed the intermediate (i) region, located between the s and m regions. The i region encodes part of the p33 VacA subunit and 2 types, i1 (vacuolating) and i2 (nonvacuolating), were described. They showed that this region was directly involved in toxicity by exchange mutagenesis experiments. They then developed a polymerase chain reaction (PCR)-based typing system for this region and showed in an Iranian population that the i1 genotype was a better marker of cancer-associated strains than s1 or m1. The main aim of the present work was to study the associations of both new and established H pylori virulence markers (vacA s, m, and i region polymorphisms, cagA status, and the number of CagA EPIYA-C segments) with GC and PU. Our data set also allowed us to study the interrelationship between these virulence factors; their associations with bacterial density, gastric inflammation, and gastric intestinal metaplasia; and, in the case of the CagA EPIYA-C segment, with the region of the stomach preferentially colonized by H pylori. In this retrospective study, we selected 203 H pylori–infected subjects. A total of 150 patients with benign diseases were selected from a series of 1145 consecutive outpatients admitted to the Endoscopic Unit of the University Hospital of Padova for investigation of dyspepsia. The selection criteria were as follows: (1) presence of H pylori infection (see Supplementary Table 1 for definition; see supplementary material online at www.gastrojournal.org), (2) no previous treatment for H pylori infection, and (3) no recent (within 4 months) treatment with proton pump inhibitors, antibiotics, bismuth-containing compounds, or nonsteroidal anti-inflammatory drugs. Among these, 52 (30 male and 22 female; mean age, 50 years; age range, 17–73 years) had PU (46 duodenal and 6 gastric) and 98 (44 male and 54 female; mean age, 45 years; age range, 8–79 years) had gastritis (antral predominant, 47 cases; diffuse, 51 cases). During endoscopy, one antral biopsy specimen and one body biopsy specimen were taken for H pylori culture and 4 antral and 2 body biopsy specimens for histologic evaluation. Fifty-three H pylori–infected (see Supplementary Table 1 for definition) patients with GC (28 male and 25 female; mean age, 67 years; age range, 28–88 years) were selected from a consecutive series of 73 patients who had undergone radical resection for GC, always histologically confirmed. Tumors were located in the upper third of the stomach in 2 cases, in the middle third in 12 cases, and in the lower third in 31 cases; 2 patients had multifocal and 6 patients had cardia GC. From each resected stomach, one tumor tissue sample and one sample from the adjacent (at least 3 cm from the tumor margin) normal mucosa were obtained and snap frozen in liquid nitrogen immediately after excision and stored at −80°C until processing. Lauren's classification was as follows: intestinal, 32 cases; diffuse, 21 cases. Written informed consent was obtained from each subject or his or her guardian. GC was diagnosed and classified on surgical specimens after H&E staining. From the series of 150 patients with benign diseases, antral and body biopsy samples were used to classify type and grade of inflammation (H&E), H pylori infection, and grade (Giemsa and/or Warthin–Starry) according to the updated Sydney System criteria.25Dixon M.F. Genta R.M. Yardley J.H. et al.Classification and grading of gastritis The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994.Am J Surg Pathol. 1996; 20: 1161-1181Crossref PubMed Scopus (4443) Google Scholar The presence or absence of intestinal metaplasia (IM) was evaluated in 147 patients with benign diseases.25Dixon M.F. Genta R.M. Yardley J.H. et al.Classification and grading of gastritis The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994.Am J Surg Pathol. 1996; 20: 1161-1181Crossref PubMed Scopus (4443) Google Scholar Among patients with GC, because of confusion with neoplastic tissue, IM could only be said to be definitively present or absent in 38 patients. When analyzing the association between IM and H pylori virulence determinants, patients with GC were not included anyway because of potential confounding due to the presence of carcinoma. H pylori–positive status was defined as positive culture and histology for patients with benign diseases or positive ureA PCR for patients with GC26Zambon C.F. Basso D. Navaglia F. et al.Pro- and anti-inflammatory cytokines gene polymorphisms and Helicobacter pylori infection: interactions influence outcome.Cytokine. 2005; 29: 141-152Crossref PubMed Scopus (186) Google Scholar (details in Supplementary Table 1). DNA was obtained from frozen gastric mucosal samples of patients with GC and from clinical H pylori isolates of patients with benign diseases. s and m region polymorphisms of vacA were assayed as previously described.26Zambon C.F. Basso D. Navaglia F. et al.Pro- and anti-inflammatory cytokines gene polymorphisms and Helicobacter pylori infection: interactions influence outcome.Cytokine. 2005; 29: 141-152Crossref PubMed Scopus (186) Google ScholarvacA i region polymorphisms were studied using the primers VacF1, C1R, and C2R24Rhead J.L. Letley D.P. Mohammadi M. et al.A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer.Gastroenterology. 2007; 133: 926-936Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar (PCR conditions are detailed in Supplementary Table 2; see supplementary material online at www.gastrojournal.org). The presence or absence of cagA was studied as previously described.26Zambon C.F. Basso D. Navaglia F. et al.Pro- and anti-inflammatory cytokines gene polymorphisms and Helicobacter pylori infection: interactions influence outcome.Cytokine. 2005; 29: 141-152Crossref PubMed Scopus (186) Google Scholar The 3′ region of cagA encoding the EPIYA segments was analyzed following Yamaoka et al27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar and Argent et al28Argent R.H. Zhang Y. Atherton J.C. Simple method for determination of the number of Helicobacter pylori CagA variable-region EPIYA tyrosine phosphorylation motifs by PCR.Clin Microbiol. 2005; 43: 791-795Crossref Scopus (84) Google Scholar (conditions detailed in Supplementary Table 3; see supplementary material online at www.gastrojournal.org). We used both approaches because our DNA samples were not derived from single H pylori colonies. Multiple infections could be detected by using the primers described by Yamaoka et al,27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar while an improvement in specificity for EPIYA-repeat segment classification could be obtained by using the primers described by Argent et al.28Argent R.H. Zhang Y. Atherton J.C. Simple method for determination of the number of Helicobacter pylori CagA variable-region EPIYA tyrosine phosphorylation motifs by PCR.Clin Microbiol. 2005; 43: 791-795Crossref Scopus (84) Google Scholar The results obtained following the 2 approaches were matched to reach a final classification of the infecting strain. In a subset of 28 samples (14 GC, 6 PU, 9 gastritis), 3 of which showed multiple amplicons after PCR with primer pair TF-TR,27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar the 3′ cagA region was sequenced using the primer pairs TF/WR27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar and WF/TR27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar or WR/HpSRE2 (5′ GGCTAAAGCAATGGGCGATTT 3′) or WR/HpSRE3 (5′ CGCAAGCAAAAAGCGACCTT 3′). Sequencing reactions were analyzed on an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Foster City, CA), and data were processed with the Sequencing Analysis 3.3 software (Applied Biosystems). ClustalW program (1.82) was used to align nucleotide and amino acidic sequences and to generate a similarity tree (cladogram) of the amino acid sequences estimating genetic distances between the sequenced strains. The statistical analysis of data was made using the univariate and multivariate multinomial logistic models, the χ2 test, and the nonparametric Mann–Whitney test and the Kruskal–Wallis tests in SAS for Windows version 9.1.3 (SAS Institute Inc, Cary, NC). Of our 203 samples, 4 and 53 had untypeable vacA s and m regions, respectively. We performed successful vacA i region typing at a later date on DNA from 171 available cases. Typing of 10 cases (1 GC, 4 PU, and 5 gastritis) showed probable mixed strain infection in that both s1 and s2 or both i1 and i2 or both m1 and m2 vacA alleles, or a combination, were found. These cases were not included in subsequent association analyses. To study the structure of vacA in our samples, we excluded strains where vacA was not fully typeable or where we suspected multiple strain infections. This left strains from 123 patients. By conventional vacA s and m region typing, 42% strains were s1/m1, 16% s1/m2, and 42% s2/m2. In agreement with the original description of vacA i region,24Rhead J.L. Letley D.P. Mohammadi M. et al.A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer.Gastroenterology. 2007; 133: 926-936Abstract Full Text Full Text PDF PubMed Scopus (336) Google Scholar all s1/m1 strains were type i1 and virtually all s2/m2 strains (51/52) were i2; we found a single s2/i1/m2 isolate. Also in agreement, s1/m2 strains could be either type i1 (74%; 14/19) or i2 (26%; 5/19). Next we assessed the association of polymorphisms in different vacA regions with disease. The results of univariate multinomial logistic regression analysis are shown in Table 1. Types s1, i1, and m1 vacA strains were closely associated with GC. i1, not s1 or m1, strains were significantly associated with PU. For the vacA i region, we examined the association with duodenal ulcer (DU) and gastric ulcer strains separately; 69% of patients (27/39) with DU had vacA i1 strains, significantly more than the 44% (31/71) with gastritis (P = .01); for gastric ulcer, 50% (3/6) had i1 strains, no different from the proportion with gastritis, although the small number of gastric ulcers means our study was underpowered to show an association. Finally, we examined the association of vacA type with pattern of gastritis. Only i region type showed a significant association; 27% of patients (8/30) with antral-predominant gastritis had an i1 strain, significantly fewer than the 56% of patients (23/41) with pangastritis who had i1 strains (P = .02).Table 1Association Between H pylori vacA s, i, and m Alleles or cagA Gene and Disease DiagnosisDiagnosisvacA alleless2s1OR95% CIGastritis3953ReferencePeptic ulcer13351.980.93–4.23Gastric cancer4458.28aP < .001.2.75–24.95i2i1OR95% CIGastritis4031ReferencePeptic ulcer15302.58bP < .05.1.19–5.61Gastric cancer9355.02aP < .001.2.10–11.98m2m1OR95% CIGastritis5134ReferencePeptic ulcer26201.150.56–2.39Gastric cancer275.25bP < .05.1.03–25.80cagA genenegativepositiveOR95% CIGastritis3954ReferencePeptic ulcer12362.17bP < .05.1.00–4.69Gastric cancer34911.80aP < .001.3.43–40.61NOTE. PU and GC risks were estimated with respect to the reference group made up of patients with gastritis. The number of patients belonging to each group is reported. Odds ratios (OR) and 95% confidence intervals (CI) were estimated by the conditional univariate logistic model. Only strains without multiple s, i, or m vacA signals were included in the analysis.a P < .001.b P < .05. Open table in a new tab NOTE. PU and GC risks were estimated with respect to the reference group made up of patients with gastritis. The number of patients belonging to each group is reported. Odds ratios (OR) and 95% confidence intervals (CI) were estimated by the conditional univariate logistic model. Only strains without multiple s, i, or m vacA signals were included in the analysis. Although the 10 isolates with multiple infections (vacA genotypes) were all typed as cagA positive, they were all excluded from the analysis because they could also have contained cagA-negative strains. This left strains from 193 patients for analysis, 139 (72%) of which were cagA positive. The results of univariate multinomial logistic regression analysis for cagA are reported in Table 1. cagA was significantly associated with both GC and PU. No association was found between cagA status and distribution of gastritis in the gastritis-only patients. cagA-positive status was very closely associated with the vacA s1 genotype; all 52 s1/i1/m1 strains, all 14 s1/i1/m2 strains, and all 5 s1/i2/m2 strains were cagA positive; 50 of 51 s2/i2/m2 strains and the only s2/i1/m2 strain were cagA negative. The PCR analysis of the number of predicted type C CagA EPIYA segments (EPIYA-C) was performed at a later date on H pylori DNA samples from 59 patients with benign diseases and 53 with GC. For the patients with benign diseases, data from both antrum and corpus isolates were available for 22 patients; data from antrum only or corpus only were available for 28 and 9 patients, respectively. For the patients with GC, cagA genotyping was performed on DNA samples from both neoplastic and nonneoplastic tissue. PCR findings were negative from 21 and 7 neoplastic and nonneoplastic tissue samples, respectively. In total, cagA EPIYA results were available for 47 patients with GC; 31 patients had successful typing from both neoplastic and nonneoplastic tissue, one from only neoplastic tissue, and 15 from only nonneoplastic tissue. The number of predicted EPIYA-C segments ranged from 0 to 3. Among patients with benign disease, 44 (75%) had the same number of EPIYA-C segments in all analyses whereas 15 (25%) had differing numbers of EPIYA-C segments either within the same sample or in different samples (indicating probable mixed strain infection); for GC, 28 patients (60%) had the same number of EPIYA-C segments in all samples and 19 (40%) had differing numbers. The accuracy of PCR typing was confirmed by nucleotide sequence analysis on a subset of 32 PCR amplification products (GenBank accession numbers from EF450136 to EF450167; Supplementary Figure 1; see supplementary material online at www.gastrojournal.org). Next we used the sequence data to assess relatedness of cagA alleles in patients who appeared to have strains with differing numbers of EPIYA-C segments. We studied 2 patients who had strains with both 1 and 2 EPIYA-C segments and 1 patient who had strains with 1, 2, and 3 EPIYA-C segments (EF450138 and EF450139, EF450148 and EF450149, EF450145 and EF450146 and EF450147, respectively). The amino acid sequences were further analyzed using the ClustalW program to generate a cladogram, estimating genetic distances between the sequenced strains (Supplementary Figure 2; see supplementary material online at www.gastrojournal.org). cagA alleles from the same patient always clustered together, implying that they were more closely related than alleles from different patients. It has been suggested that strains with higher numbers of CagA EPIYA-C segments are less well able to withstand low pH.27Yamaoka Y. El-Zimaity H.M. Gutierrez O. et al.Relationship between the cagA 3′ repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH.Gastroenterology. 1999; 117: 342-349Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar We thus asked whether they preferentially colonized different parts of the stomach. For patients with benign diseases with successful strain isolation from antrum and corpus, 17 had completely concordant but 4 had discordant results (Table 2). Interestingly, all 4 of these had isolates with higher numbers of EPIYA-C segments in the gastric corpus. However, taking all the results from patients with benign disease together, although numerically a higher proportion of corpus biopsy
Referência(s)