Receptor Activator of Nuclear Factor κB Ligand (RANKL)/Osteoprotegerin (OPG) Ratio Is Increased in Severe Osteolysis
2003; Elsevier BV; Volume: 163; Issue: 5 Linguagem: Inglês
10.1016/s0002-9440(10)63560-2
ISSN1525-2191
AutoresEva Grimaud, Luc Soubigou, Séverine Couillaud, Patrick Coipeau, Philippe Moreau, Norbert Passuti, F. Gouin, Françoise Rédiní, Dominique Heymann,
Tópico(s)Bone health and osteoporosis research
ResumoPathological osteolyses are considered a consequence of a disturbance in the mechanisms that govern the bone remodeling, mainly the communication between osteoclasts and osteoblasts. Osteoprotegerin (OPG) and receptor activator of NF-κB ligand (RANKL) are newly discovered molecules that play a key role in these communications. RANKL is essential for osteoclast differentiation via its receptor RANK located on the osteoclast membrane. OPG is a soluble decoy receptor that inhibits osteoclast differentiation through its binding to RANKL. The aim of this study is the analysis of the RANKL/OPG balance by complementary methods (semiquantitative reverse transcription-polymerase chain reaction, immunohistochemistry, and enzyme-linked immunosorbent assay) in human osteolysis associated to various bone etiologies (n = 60), tumoral (primitive, secondary) or not, compared to healthy tissues (n = 16). Results demonstrated that RANKL/OPG ratio was significantly increased in patients suffering from severe osteolysis compared to the control group and that this imbalance is involved in bone resorption mechanisms. In this study, OPG expression appears to reflect a protective mechanism of the skeleton to compensate increased bone resorption by inhibiting osteoclast formation and bone resorbing activity. Moreover, as revealed by immunohistochemistry, RANKL and OPG were colocalized in all of the tissues analyzed. To define the veracity of RANKL/OPG index in assessing and managing patients with severe osteolysis, an extended population of patients suffering from severe osteolysis must be now monitored. Pathological osteolyses are considered a consequence of a disturbance in the mechanisms that govern the bone remodeling, mainly the communication between osteoclasts and osteoblasts. Osteoprotegerin (OPG) and receptor activator of NF-κB ligand (RANKL) are newly discovered molecules that play a key role in these communications. RANKL is essential for osteoclast differentiation via its receptor RANK located on the osteoclast membrane. OPG is a soluble decoy receptor that inhibits osteoclast differentiation through its binding to RANKL. The aim of this study is the analysis of the RANKL/OPG balance by complementary methods (semiquantitative reverse transcription-polymerase chain reaction, immunohistochemistry, and enzyme-linked immunosorbent assay) in human osteolysis associated to various bone etiologies (n = 60), tumoral (primitive, secondary) or not, compared to healthy tissues (n = 16). Results demonstrated that RANKL/OPG ratio was significantly increased in patients suffering from severe osteolysis compared to the control group and that this imbalance is involved in bone resorption mechanisms. In this study, OPG expression appears to reflect a protective mechanism of the skeleton to compensate increased bone resorption by inhibiting osteoclast formation and bone resorbing activity. Moreover, as revealed by immunohistochemistry, RANKL and OPG were colocalized in all of the tissues analyzed. To define the veracity of RANKL/OPG index in assessing and managing patients with severe osteolysis, an extended population of patients suffering from severe osteolysis must be now monitored. Bone is a specialized connective tissue formed by a mineralized matrix that confers its elastic and strength properties. Bone remodeling allows to adapt bone tissue to mechanical constraints and to maintain phosphocalcic homeostasis through coordinated phases of formation and resorption. Thus, bone remodeling involves synthesis of organic matrix by osteoblasts, and bone resorption by osteoclasts. This equilibrium is tightly regulated by physical parameters (ie, mechanical stimulations) and numerous polypeptides (hormones, cytokines).1Heymann D Rousselle AV gp130 cytokine family and bone cells.Cytokine. 2000; 12: 1465-1468Crossref Scopus (156) Google Scholar Any disturbance between these effectors leads to the development of skeletal abnormalities, characterized by decreased (osteoporosis) or increased (osteopetrosis) bone mass. Increased osteoclast activity is observed in many osteopathic disorders, including postmenopausal osteoporosis, Paget's disease, primary bone tumors, lytic bone metastases, multiple myeloma, or rheumatoid arthritis, leading to increased bone resorption and a loss of bone mass.2Goltzman D Karaplis AC Kremer R Rabbani SA Molecular basis of the spectrum of skeletal complications of neoplasia.Cancer. 2000; 88: 2903-2908Crossref PubMed Google Scholar, 3Goltzman D Osteolysis and cancer.J Clin Invest. 2001; 107: 1219-1220Crossref PubMed Scopus (74) Google Scholar, 4Gouin F Moreau A Guicheux J Passuti N Heymann D Mechanism of tumor-induced osteolysis.Rev Chir Orthop. 1999; 85: 58-68PubMed Google Scholar Concerning bone tumors, tumor cells release agents (hormones, eicosanoid, growth factors, cytokines) into the bone microenvironment, which act on osteoblastic stromal cells to enhance the production of osteoclast-activating factors. Most notable of these is the osteoprotegerin (OPG) ligand, also named receptor activator of nuclear factor κB ligand (RANKL), which is a member of the tumor necrosis factor (TNF) cytokine family. OPG and RANKL have been recently identified as members of a ligand-receptor system that directly regulates osteoclast differentiation and bone resorption.5Simonet WS Lacey DL Dunstan CR Kelley M Chang MS Luthy R Nguyen HQ Wooden S Bennett L Boone T Shimamoto G DeRose M Elliott R Colombero A Tan HL Trail G Sullivan J Davy E Bucay N Renshaw-Gegg L Hughes TM Hill D Pattison W Campbell P Sander S Van G Tarpley J Derby P Lee R Amgen EST ProgramBoyle WJ Osteoprotegerin: a novel secreted protein involved in the regulation of bone density.Cell. 1997; 89: 309-319Abstract Full Text Full Text PDF PubMed Scopus (4261) Google Scholar, 6Tsuda E Goto M Michizuki S Yano K Kobayashi F Morinaga T Hisgashio K Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis.Biochem Biophys Res Commun. 1997; 234: 137-142Crossref PubMed Scopus (720) Google Scholar, 7Yasuda H Shima N Nakagawa N Yamaguchi K Kinosaki M Mochizuki S Tomoyasu A Yano K Goto M Murakami A Tsuda E Morinaga T Higashio K Udagawa N Takahashi N Suda T Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL.Proc Natl Acad Sci USA. 1998; 95: 3597-3602Crossref PubMed Scopus (3500) Google Scholar, 8Lacey DL Timms E Tan HL Kelley MJ Dunstan CR Burgess T Elliott R Colombero A Elliott G Scully S Hsu H Sullivan J Hawkins N Davy E Capparelli C Eli A Qian YX Kaufman S Sarosi I Shalhoub V Senaldi G Guo J Delaney J Boyle WJ Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation.Cell. 1998; 93: 165-176Abstract Full Text Full Text PDF PubMed Scopus (4546) Google Scholar RANKL has been shown to both activate mature osteoclasts and mediate osteoclastogenesis in the presence of M-CSF.9Kong YY Feige U Sarosi I Bolon B Tafuri A Morony S Capparelli C Li J Elliott R McCabe S Wong T Campagnuolo G Moran E Bogoch ER Van G Nguyen LT Ohashi PS Lacey DL Fish E Boyle WJ Penninger JM Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand.Nature. 1999; 402: 304-309Crossref PubMed Scopus (1570) Google Scholar, 10Burgess TL Qian Y Kaufman S Ring BD Van G Capparelli C Kelley M Hsu H Boyle WJ Dunstan C Hsu S Lacey DL The ligand for osteoprotegerin (OPGL) directly activates mature osteoclasts.J Cell Biol. 1999; 145: 527-538Crossref PubMed Scopus (601) Google Scholar Soluble- and membranous-form of RANKL is preferentially expressed by committed preosteoblastic cells, whereas their specific receptor RANK is expressed on hematopoietic osteoclast progenitors.8Lacey DL Timms E Tan HL Kelley MJ Dunstan CR Burgess T Elliott R Colombero A Elliott G Scully S Hsu H Sullivan J Hawkins N Davy E Capparelli C Eli A Qian YX Kaufman S Sarosi I Shalhoub V Senaldi G Guo J Delaney J Boyle WJ Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation.Cell. 1998; 93: 165-176Abstract Full Text Full Text PDF PubMed Scopus (4546) Google Scholar, 11Hsu H Lacey DL Dunstan CR Solovyev I Colombero A Timms E Tan HL Elliott G Kelley MJ Sarosi I Wang L Xia XZ Elliott R Chiu L Black T Scully S Capparelli C Morony S Shimamoto G Bass MB Boyle WJ Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegerin ligand.Proc Natl Acad Sci USA. 1999; 96: 3540-3545Crossref PubMed Scopus (1398) Google Scholar This interaction is necessary and, together with M-CSF, sufficient for osteoclast formation, since mice lacking RANKL are unable to produce osteoclasts and since exogenously provided soluble RANKL and M-CSF stimulate osteoclastogenesis in the absence of stromal/osteoblastic cells.7Yasuda H Shima N Nakagawa N Yamaguchi K Kinosaki M Mochizuki S Tomoyasu A Yano K Goto M Murakami A Tsuda E Morinaga T Higashio K Udagawa N Takahashi N Suda T Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL.Proc Natl Acad Sci USA. 1998; 95: 3597-3602Crossref PubMed Scopus (3500) Google Scholar, 8Lacey DL Timms E Tan HL Kelley MJ Dunstan CR Burgess T Elliott R Colombero A Elliott G Scully S Hsu H Sullivan J Hawkins N Davy E Capparelli C Eli A Qian YX Kaufman S Sarosi I Shalhoub V Senaldi G Guo J Delaney J Boyle WJ Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation.Cell. 1998; 93: 165-176Abstract Full Text Full Text PDF PubMed Scopus (4546) Google Scholar In this system, OPG produced by osteoblasts acts as a decoy receptor for RANKL, preventing it from binding to and activating RANK. It also inhibits the development of osteoclasts6Tsuda E Goto M Michizuki S Yano K Kobayashi F Morinaga T Hisgashio K Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis.Biochem Biophys Res Commun. 1997; 234: 137-142Crossref PubMed Scopus (720) Google Scholar and down-regulates the RANKL signaling through RANK.5Simonet WS Lacey DL Dunstan CR Kelley M Chang MS Luthy R Nguyen HQ Wooden S Bennett L Boone T Shimamoto G DeRose M Elliott R Colombero A Tan HL Trail G Sullivan J Davy E Bucay N Renshaw-Gegg L Hughes TM Hill D Pattison W Campbell P Sander S Van G Tarpley J Derby P Lee R Amgen EST ProgramBoyle WJ Osteoprotegerin: a novel secreted protein involved in the regulation of bone density.Cell. 1997; 89: 309-319Abstract Full Text Full Text PDF PubMed Scopus (4261) Google Scholar The evidence of OPG as an inhibitor of osteoclastogenesis emerges from experiments with transgenic mice, where overexpression of OPG leads to severe osteopetrosis and reduced number of mature osteoclasts.5Simonet WS Lacey DL Dunstan CR Kelley M Chang MS Luthy R Nguyen HQ Wooden S Bennett L Boone T Shimamoto G DeRose M Elliott R Colombero A Tan HL Trail G Sullivan J Davy E Bucay N Renshaw-Gegg L Hughes TM Hill D Pattison W Campbell P Sander S Van G Tarpley J Derby P Lee R Amgen EST ProgramBoyle WJ Osteoprotegerin: a novel secreted protein involved in the regulation of bone density.Cell. 1997; 89: 309-319Abstract Full Text Full Text PDF PubMed Scopus (4261) Google Scholar In contrast, OPG knockout mice are osteoporotic.12Mizuno A Amizuka N Irie K Murakami A Fujise N Kanno T Sato Y Nakagawa N Yasuda H Mochizuki S Gomibuchi T Yano K Shima N Washida N Tsuda E Morinaga T Higashio K Ozawa H Severe osteoporosis in mice lacking osteoclastogenesis inhibitory factor/osteoprotegerin.Biochem Biophys Res Commun. 1998; 247: 610-615Crossref PubMed Scopus (686) Google Scholar The biological effects of OPG on bone cells include the inhibition of terminal stages of osteoclast differentiation, suppression of mature osteoclast activation, and induction of apoptosis.13Theill LE Boyle WJ Penninger JM RANK-L and RANK: T cells, bone loss, and mammalian evolution.Annu Rev Immunol. 2002; 20: 795-823Crossref PubMed Scopus (652) Google Scholar, 14Grimaud E Rédini F Heymann D Osteoprotegerin: a new agent for the treatment of bone disease.Drug Discov Today. 2002; 6: 1241-1242Crossref Google Scholar In fine, bone remodeling appears to be mainly controlled by the balance RANKL/OPG. RANKL and OPG have been already detected in several tumor cells. Thus, soluble RANKL was produced by human prostate cancer cells when injected to SCID mice.15Zhang J Dai J Lin DL Smith P Strayhorn C Mizokami A Fu Z Westman J Keller ET Osteoprotegerin inhibits prostate cancer-induced osteoclastogenesis and prevents prostate tumor growth in the bone.J Clin Invest. 2001; 107: 1235-1243Crossref PubMed Scopus (406) Google Scholar Similarly, Brown et al16Brown JM Corey E Lee ZD True LD Yun TJ Tondravi M Vessela RI Osteoprotegerin and RANK ligand expression in prostate cancer.Urology. 2001; 57: 611-616Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar reported that RANKL was heterogeneously expressed in 10 of 11 prostate carcinoma specimens and the proportion of tumor cells expressing RANKL was significantly increased in all bone metastases. Moreover, RANKL was expressed in squamous cell carcinoma cell lines derived from malignancy tissues associated with hypercalcemia17Nagai M Kyakumoto S Sato N Cancer cells responsible for humoral hypercalcemia express mRNA encoding a secreted form of ODF/TRANCE that induces osteoclast formation.Biochem Biophys Res Commun. 2000; 269: 532-536Crossref PubMed Scopus (86) Google Scholar and was detected in more than 90% of metastatic tumor cells in lesions of breast, lung, and thyroid adenocarcinoma.18Huang L Cheng YY Chom LTC Zheng MH Kumta SM Tumour cells produce receptor activator of NF-kB ligand (RANKL) in skeletal metastases.J Clin Pathol. 2002; 55: 877-878Crossref PubMed Scopus (62) Google Scholar The studies of Thomas et al19Thomas RJ Guise TA Yin JJ Elliott J Horwood NJ Martin TJ Gillepsie MT Breast cancer cells interact with osteoblasts to support osteoclast formation.Endocrinology. 1999; 140: 4451-4458Crossref PubMed Scopus (405) Google Scholar and Chikatsu et al20Chikatsu N Takeuchi Y Tamura Y Fukumoto S Yano K Tsuda E Ogata E Fujita T Interactions between cancer and bone marrow cells induce osteoclast differentiation factor expression and osteoclast-like cell formation in vitro.Biochem Biophys Res Commun. 2000; 267: 632-637Crossref PubMed Scopus (86) Google Scholar thus revealed that RANKL mRNA has not been detected in melanoma and breast cancer cells, whereas Good et al21Good CR O'Keefe RJ Puzas JE Schwarz EM Rosier RN Immunohistochemistry study of receptor activator of nuclear kappa-B ligand (RANK-L) in human osteolytic bone tumors.J Surg Oncol. 2002; 79: 174-179Crossref PubMed Scopus (24) Google Scholar have demonstrated recently by immunohistochemical techniques that primary benign bone tumors, primary malignant tumors, and bone metastases were positive for RANKL. These data suggested that tumor cells could switch to become positive for RANKL in bone. To our knowledge, serum RANKL has never been investigated. In addition, few data are available on the production and expression of OPG in these pathologies.22Lipton A Ali SM Leitzel K Chinchilli V Witters L Engle L Holloway D Bekker P Dunstan C Serum osteoprotegerin levels in healthy controls and cancer patients.Clin Cancer Res. 2002; 8: 2306-2310PubMed Google Scholar, 23Huang L Xu J Wood D Zheng MH Gene expression of osteoprotegerin ligand, osteoprotegerin, and receptor activator of NFkB in giant cell tumor of bone.Am J Pathol. 2000; 156: 761-767Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar, 24Roux S Amazit L Meduri G Guichon-Mantel A Milgrom E Mariette X RANK (receptor activator of nuclear factor κB) and RANK ligand are expressed in giant cell tumors of bone.Am J Clin Pathol. 2002; 117: 210-216Crossref PubMed Scopus (133) Google Scholar, 25Giuliani N Bataille R Mancini C Lazzaretti M Barille S Myeloma cells induce imbalance in the osteoprotegerin/osteoprotegerin ligand system in the human bone marrow environment.Blood. 2001; 98: 3527-3533Crossref PubMed Scopus (357) Google Scholar The present work studied the expression and the production of RANKL and OPG by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR), enzyme-linked immunosorbent assay (ELISA) and immunohistochemistry, in a large number of bone pathological situations where osteolysis occurred. The balance RANKL/OPG was systematically analyzed, compared to healthy controls and correlated to the severity of osteolysis. Seventy-one patients were included in the present study and all were treated at the University Hospital of Nantes (France) between September 2001 and December 2002 (Table 1). Sixty patients, 31 women [59.9 ± 18.3 years (mean age ± SD), range 17 to 80] and 29 men [47 ± 20.8 years, range 15 to 86] with pathological osteolysis referred to the Department of Orthopedic Surgery (University Hospital of Nantes) were included in the various pathological groups. Eleven patients, 8 women [65.6 ± 21.8 years, range 23 to 83] and 3 men [44.6 ± 11 years, range 33 to 55] were included in the control group; healthy tissues (n = 16; muscle, bone, capsule) were harvested during resection of epiphysis for metaphyseal bone tumors or during operations for intramedullary nail removal. Pathological osteolysis cases included prosthesis aseptic loosening [total hip arthroplasty (THA); n = 16], giant cell tumors (GCT) (n = 6), osteitis (n = 2), primary benign bone tumors (PBBT) (desmoplastic fibroma, essential cyst, aneurismal bone cyst, chondromyxoid fibroma, fibrous dysplasia, eosinophile granuloma, osteo-cartilaginous exostose, chondroma; n = 13), tumors of soft tissues (liposarcoma, synovial sarcoma, villonodular synovitis; n = 4), hematological malignancies (myeloma; n = 2), primary malignant bone tumors (PMBT) (angiosarcoma, Ewing sarcoma, chondrosarcoma, osteosarcoma; n = 9) and bone metastases from other primary origins (lung, renal, breast; n = 8). Osteolysis degree was measured arbitrarily by analogical scale: the reference group, free of any osteolysis is noted "−"; when osteolysis and osteocondensation coexist within the same tissue, the sample is noted "0"; grade 1, 2, and 3 are attributed according to the classification of Campanacci et al (Table 1).26Campanacci M Baldini N Boriani S Sudanese A Giant cell tumor of bone.J Bone Joint Surg. 1987; 69A: 106-114Google Scholar This classification initially described for the GCT is subdivided in 3 grades: grade 1 or "quiet form" corresponds to the tumors whose osteolysis is multilocular without cortical destruction; grade 3 or "aggressive form" corresponds to the tumors associated with a rupture of the cortical bone and grade 2 or "active form" is between the two grades previously described. When osteolysis occurred without information, the sample was noted "+" (Table 1). Part of the specimens obtained during surgery were frozen and kept at −80°C until RNA transcript analyses, while the other part was fixed immediately in 10% formaldehyde solution until immunohistochemical analysis.Table 1Characteristics of Patients with Pathologic Osteolysis and Control GroupsGroupPatientClassificationOsteolysisSexControl1Bone−F2Bone−M3Bone−F4Bone−F5Bone−F6Bone−M7Bone−F8Bone−M9Bone−F10Cartilage−F11Cartilage−F4aCapsule−F5aCapsule−F7aCapsule−F5bMuscle−F7bMuscle−FTHA12THA+F13THA+M14THA+F15THA+F16THA+F17THA+F18THA+M19THA+F20THA+F21THA+M22THA+F23THA+M24THA+F25THA+F26THA+M27THA+FGCTs28GCT3F29GCT3F30GCT3M31GCT2M32GCT3M33GCT3MOsteitis34Osteitis+M35Osteitis+MPBBTs36Desmoplastic fibroma1M37Desmoplastic fibroma1F38Chondromyxoid fibroma2M39Aneurismal bone cyst2F40Essential cyst1M41Fibrous dysplasia1M42Eosinophile granuloma1M43Osteo-cartilaginous exostose0F44Osteo-cartilaginous exostose0M45Osteo-cartilaginous exostose0M46Chondroma0M47Chondroma0M48Chondroma0FTumors of the soft tissues49Liposarcoma−M50Liposarcoma−F51Synovial-sarcoma3F52Villonodular synovitis2MHematologic malignancies53Myeloma3F54Myeloma3MPMBTs55Chondrosarcoma0F56Angiosarcoma3F57Ewing sarcoma0F58Ewing sarcoma0M59Osteosarcoma3F60Osteosarcoma3F61Osteosarcoma+F62Osteosarcoma3M63Osteosarcoma+FBone metastases from other primary origins64Lung3M65Lung3M66Kidney3M67Kidney3M68Breast3F69Uterus3F70Unknown3F71Unknown3FOsteolysis was graded as described in Materials and Methods. Ages of the patients are given in years. Open table in a new tab Osteolysis was graded as described in Materials and Methods. Ages of the patients are given in years. Total RNA was extracted from frozen samples and RT-PCR performed as described elsewhere.27Wittrant Y Couillaud S Theoleyre S Dunstan C Heymann D Rédini F Osteoprotegerin differentially regulates protease expression in osteoclast cultures.Biochem Biophys Res Commun. 2002; 293: 38-44Crossref PubMed Scopus (55) Google Scholar Briefly, dissected samples were ground in liquid nitrogen before dissolution in Trizol reagent (Invitrogen, Eragny, France) according to the manufacturer's instructions. Total RNA was quantified by measuring OD260, and integrity was checked by 1% agarose/formaldehyde gel electrophoresis. RNA samples were then treated with DNase I (0.1 U/μl) before the reverse-transcription step, to exclude the possibility of interference with contaminating genomic DNA. cDNA was then amplified by PCR to generate products corresponding to mRNA encoding human RANKL, OPG, and 18S (corresponding oligonucleotides are listed Table 2) using Taq Polymerase (Promega, Charbonnières, France) under semiquantitative conditions. PCR products were then analyzed in 1% agarose gels, stained with ethidium bromide, and photographed. Band densities were measured using the ImageQuant computer software program. Relative expression of the RANKL and OPG genes were calculated as the ratio to 18S signal. After the number of PCR cycles was increased for each studied gene, a plot was done for each sample allowing the determination of the cycle values corresponding to the linear part of the amplification curve (Table 2) used to quantify the messages versus the 18S signal determined in the same way.Table 2Oligonucleotide Primers Used for RT-PCRDesignationSequencesConditions (cycle number)Message size18S+: 5′ TCAAGAACGAAAGTCGGAGGTTCG 3′1 minute 94°C475 bp−: 5′ TTATTGCTCAATCTCGGGTGGCTG 3′1 minute 62°C1 minute 72°C(28 cycles)OPG+: 5′ GCTAACCTCACCTTCGAG 3′30 seconds 94°C324 bp30 seconds 55°C−: 5′ TGATTGGACCTGGTTACC 3′30 seconds 72°C(40 cycles)RANKL+: 5′ GCCAGTGGGAGATGTTAG 3′30 seconds 94°C486 bp30 seconds 55°C−: 5′ TTAGCTGCAAGTTTTCCC 3′30 seconds 72°C(40 cycles)Primers are represented in a 5′ to 3′ orientation, with that for the coding strand (+) and the non-coding strand (−). The product size generated by reverse transcription and PCR amplification of the authentic mRNA is indicated, together with semi-quantitative PCR conditions. Open table in a new tab Primers are represented in a 5′ to 3′ orientation, with that for the coding strand (+) and the non-coding strand (−). The product size generated by reverse transcription and PCR amplification of the authentic mRNA is indicated, together with semi-quantitative PCR conditions. In all cases, tissue samples were harvested from pathological osteolysis bearing patients during incisional or excisional biopsies and immediately fixed in 10% formaldehyde solution. The samples were decalcified by electrolysis, and after embedding in paraffin augmented by pycolytis (a process to add 10% to 15% of "pycolyte" to the paraffin to improve the quality of the sections) (Dubbar Electronique France, Rueil-Malmaison, France), 5-μm-thick sections were mounted on glass slides. Deparaffinized sections were treated with 3% hydrogen peroxide (H2O2) for 5 minutes to block endogenous peroxydase. The sections were then incubated with primary polyclonal anti-RANKL or anti-OPG antibodies (R&D Systems, Abingdon, UK), diluted 1:20 and 1:6, respectively, for 2 hours at room temperature in a humidified atmosphere. After the sections were incubated with 1:500 anti-rabbit biotinylated immunoglobulin (Amersham, Little Chalfont, UK) for 1 hour and streptavidin-horseradish peroxidase (HRP) at 1:500 (Dako, Copenhagen, Denmark) for 45 minutes at room temperature, they were revealed with a staining kit (Sigma, St. Louis, MO). Preparations were counterstained with hematoxylin, dehydrated and mounted with Gel Mount (Biomedica, Foster City, CA). All antibody and streptavidin dilutions were prepared with phosphate-buffered saline (pH 7.4). The negative controls included 1) suppression of the primary antibody and 2) substitution of the primary polyclonal antibody with polyclonal anti-κ IgG fraction antiserum. Sera were available from healthy volunteers (n = 14) and from part of patients with pathological osteolysis associated with aseptic loosening (n = 16), GCTs (n = 4), osteitis (n = 2), PBBTs (n = 12), tumors of the soft tissue (n = 3), hematological malignancies (n = 2), PMBTs (n = 9), and bone metastases from other primary origins (n = 8). All sera were obtained at the time of biopsies and were frozen at −80°C until assay. All assays were performed as blind study. OPG were assayed using a specific ELISA test (Duoset; R&D Systems) according the recommendations of the manufacturer. Briefly, wells were coated overnight with 100 μl anti-hOPG at 2 μg/ml in 1% PBS, then blocked by addition of 100 μl 1 mol/L sulfuric acid and incubated with samples or standard of recombinant human OPG for 2 hours. After 3 washes, the plates were incubated with biotinylated anti-hOPG mAb at 200 ng/ml for 2 hours and then with streptavidin-HRP conjugate (1:200) and tetramethylbenzidine (TMB) substrate solution for 20 to 30 minutes. The reaction was stopped with 1 mol/L sulfuric acid, and absorbance was determined at 450 nm, with correction at 540 nm in a microtiter reader (PerkinElmer, Shelton, CT). Similar methodology was used for RANKL assay using rabbit polyclonal anti-RANKL antibodies (PeproTech, London, UK), and recombinant human RANKL (R&D Systems) as standard. Statistical analysis were carried out using a nonparametric test for unpaired samples according to the method of Mann and Whitney (Statview 5000; Abacus Concepts Inc., Berkeley, CA). P value of less than 0.05 was considered significant. To determine the potential involvement of RANKL and OPG in pathological osteolysis, relative OPG and RANKL gene expressions were investigated in control and pathological samples. Results of representative samples from different osteolytic pathologies are presented in Figure 1A. Total mRNAs could be extracted from 75% of samples studied (controls, 14 of 16; pathological groups, 43 of 60), and OPG transcript was detectable in each case. Its expression was greatly variable both in control and in pathological groups (minimum to maximum, 0.13 to 8.16 and 0.11 to 3.27, respectively) and no significant difference was found between each group (Table 3). RANKL transcript was detected in 89.6% of the above-described samples (Figure 1B). Indeed, in 7 cases [1 cartilage control (patient 10), 3 THA (patients 13, 18, 19), 1 GCT (patient 33), 1 PMBT (patient 41) and 1 metastases (patient 70)] no RANKL mRNA was detected. No significant difference could be evidenced between each osteolytic pathology and the control group (Table 3). As bone remodeling is controlled by the RANKL/OPG balance, RANKL/OPG mRNA ratio were calculated in each case. Thus, relative RANKL/OPG mRNA expression was significantly increased in all of the pathological samples compared to the control [0.94 ± 1.36 and 0.27 ± 0.23, respectively; P < 0.05]. More specifically, relative RANKL/OPG mRNA ratio was increased in PMBTs (1.08 ± 1.29, P < 0.01), in bone metastases (1.92 ± 2.50, P < 0.01), both compared to the control group. Similarly, RANKL/OPG mRNA expression was significantly increased in severe grade 3 osteolysis (1.03 ± 1.58, P < 0.05) (Figure 1B; Table 3). These data demonstrate that the RANKL/OPG balance is disturbed in severe osteolysis in favor of RANKL.Table 3RANKL and OPG Expression per Group of Pathologies StudiedGroupSerum concentration (pg/ml) mean ± SDmRNA expression (relative expression/18S) mean ± SDOPGRANKLRANKL/OPGOPGRANKLRANKL/OPGControl236.5 ± 66.6 (n = 13)66.4 ± 86.9 (n = 13)0.32 ± 0.381.82 ± 2.00 (n = 14)0.45 ± 0.44 (n = 14)0.27 ± 0.23Total hip arthroplasty437.2 ± 306.9 (n = 16)198.1 ± 163 (n = 16)0.99 ± 1.501.47 ± 1.58 (n = 15)0.49 ± 0.4 (n = 15)0.51 ± 0.53Giant cell tumors207.2 ± 126.8 (n = 4)160 ± 138.5 (n = 4)1.13 ± 1.200.97 ± 0.49 (n = 6)0.54 ± 0.51 (n = 6)0.48 ± 0.44Osteitis285 ± 106.1 (n = 2)285 ± 91.9 (n = 2)1.13 ± 0.741.08 ± 1.11 (n = 2)0.72 ± 0.7 (n = 2)0.60 ± 0.47Primary benign bone tumors229.3 ± 152.2 (n = 12)263.3 ± 349.1 (n = 12)0.45 ± 0.442.16 ± 2.03 (n = 6)0.66 ± 0.43 (n = 6)0.48 ± 0.43Tumors of the soft tissues350 ± 264.6 (n = 3)396.6 ± 306.6 (n = 3)1.23 ± 1.500.26 (n = 1)0 (n = 1)0Hematologic malignancies505 ± 176.7 (n = 2)140 ± 198 (n = 2)0.22 ± 0.31NDNDNAPrimary malignant bone tumors299.1 ± 234.5 (n = 9)235.4 ± 272.3 (n = 9)1.05 ± 1.53*P < 0.05 and1.23 ± 1.02 (n = 8)0.75 ± 0.40 (n = 8)1.08 ± 1.29**P < 0.01 compared to the control group; ND, not determined; NA, non-applicable.Bone metastasis from other primary origins319.6 ± 163.4 (n = 8)393.7 ± 267.2 (n = 8)*P < 0.05 and1.55 ± 1.54**P < 0.01 compared to the control group; ND, not determined; NA, non-applicable.0.66 ± 0.46 (n = 5)0.69 ± 0.54 (n = 5)1.92 ± 2.50**P < 0.01 compared to the control group; ND, not determined; NA, non-applicable.Tumors associated with severe osteolysis318.8 ± 190.6 (n = 18)226.6 ± 243.5 (n = 18)1.04 ± 1.36*P < 0.05 and0.75 ± 0.50 (n = 9)0.57 ± 0.47 (n = 9)1.03 ± 1.58*P < 0.05 and* P < 0.05 and** P < 0.01 compared to the control group; ND, not determined; NA, non-appl
Referência(s)