Effects of glucose metabolism on the regulation of genes of fatty acid synthesis and triglyceride secretion in the liver
2007; Elsevier BV; Volume: 48; Issue: 7 Linguagem: Inglês
10.1194/jlr.m700090-jlr200
ISSN1539-7262
AutoresNúria Morral, Howard J. Edenberg, Scott R. Witting, Jennifer Altomonte, Tearina Chu, Matthew S. Brown,
Tópico(s)Pancreatic function and diabetes
ResumoGlucose disposal induces a signal that modulates the transcriptional regulation of genes involved in the glycolysis and lipogenesis pathways. To investigate the role of glucose metabolism on hepatic gene expression independently from insulin action, we overexpressed glucokinase, the limiting enzyme in the glycolysis pathway, in the liver of streptozotocin-induced type 1 diabetic rats. By microarray analysis, we observed that critical genes such as liver-type pyruvate kinase, malic enzyme, fatty acid synthase, and stearoyl-CoA desaturase 1 were enhanced multiple-fold, whereas genes involved in mitochondrial fatty acid oxidation and the Krebs cycle were downregulated. Despite the increase in expression of fatty acid synthesis genes and the presence of steatosis, no major alterations to the levels of genes involved in VLDL assembly and secretion, such as diacylglycerol acyltransferases 1 and 2 and microsomal triglyceride transfer protein, were observed. Overall, our data suggest that the gene expression pattern induced by glucose metabolism favors fatty acid storage in the liver rather than secretion into the circulation. Glucose disposal induces a signal that modulates the transcriptional regulation of genes involved in the glycolysis and lipogenesis pathways. To investigate the role of glucose metabolism on hepatic gene expression independently from insulin action, we overexpressed glucokinase, the limiting enzyme in the glycolysis pathway, in the liver of streptozotocin-induced type 1 diabetic rats. By microarray analysis, we observed that critical genes such as liver-type pyruvate kinase, malic enzyme, fatty acid synthase, and stearoyl-CoA desaturase 1 were enhanced multiple-fold, whereas genes involved in mitochondrial fatty acid oxidation and the Krebs cycle were downregulated. Despite the increase in expression of fatty acid synthesis genes and the presence of steatosis, no major alterations to the levels of genes involved in VLDL assembly and secretion, such as diacylglycerol acyltransferases 1 and 2 and microsomal triglyceride transfer protein, were observed. Overall, our data suggest that the gene expression pattern induced by glucose metabolism favors fatty acid storage in the liver rather than secretion into the circulation. The increased intake of dietary carbohydrate in Western societies has elicited a great interest in unraveling the regulation of genes involved in de novo lipogenesis (DNL) in response to nutritional and hormonal signals. Enhanced activity of DNL enzymes has been shown to have an impact on the composition of triglycerides in the liver as well as on the composition of VLDL (1.Donnelly K.L. Smith C.I. Schwarzenberg S.J. Jessurun J. Boldt M.D. Parks E.J. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease.J. Clin. Invest. 2005; 115: 1343-1351Crossref PubMed Scopus (2328) Google Scholar). Transcriptional regulation connects dietary signals with specific physiological responses. In recent years, it has become well established that glucose and insulin coordinate the transcriptional activation of gene expression in liver and that both are necessary for the activation to occur (2.Foufelle F. Ferre P. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c.Biochem. J. 2002; 366: 377-391Crossref PubMed Scopus (397) Google Scholar). Insulin enhances the lipogenic pathway by inducing expression of the transcription factor sterol-regulatory element binding protein 1c (SREBP-1c) (2.Foufelle F. Ferre P. New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c.Biochem. J. 2002; 366: 377-391Crossref PubMed Scopus (397) Google Scholar, 3.Horton J.D. Bashmakov Y. Shimomura I. Shimano H. Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice.Proc. Natl. Acad. Sci. USA. 1998; 95: 5987-5992Crossref PubMed Scopus (533) Google Scholar), a member of the basic domain helix-loop-helix leucine zipper family (4.Tontonoz P. Kim J.B. Graves R.A. Spiegelman B.M. ADD1: a novel helix-loop-helix transcription factor associated with adipocyte determination and differentiation.Mol. Cell. Biol. 1993; 13: 4753-4759Crossref PubMed Scopus (533) Google Scholar, 5.Wang X. Sato R. Brown M.S. Hua X. Goldstein J.L. SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis.Cell. 1994; 77: 53-62Abstract Full Text PDF PubMed Scopus (851) Google Scholar). In addition to the transcriptional regulation of lipogenic gene expression, insulin has been implicated in the regulation of VLDL secretion by acutely inhibiting the incorporation of triglycerides into VLDL and redirecting them to the cytosol (6.Wiggins D. Gibbons G.F. The lipolysis/esterification cycle of hepatic triacylglycerol. Its role in the secretion of very-low-density lipoprotein and its response to hormones and sulphonylureas.Biochem. J. 1992; 284: 457-462Crossref PubMed Scopus (199) Google Scholar, 7.Brown A.M. Gibbons G.F. Insulin inhibits the maturation phase of VLDL assembly via a phosphoinositide 3-kinase-mediated event.Arterioscler. Thromb. Vasc. Biol. 2001; 21: 1656-1661Crossref PubMed Scopus (72) Google Scholar). The hepatic transcription factor designated carbohydrate-responsive element binding protein (ChREBP) has been identified as a candidate for the induction of lipogenesis by glucose metabolism (8.Yamashita H. Takenoshita M. Sakurai M. Bruick R.K. Henzel W.J. Shillinglaw W. Arnot D. Uyeda K. A glucose-responsive transcription factor that regulates carbohydrate metabolism in the liver.Proc. Natl. Acad. Sci. USA. 2001; 98: 9116-9121Crossref PubMed Scopus (515) Google Scholar). ChREBP contains multiple domains, including a nuclear localization signal, polyproline, basic helix-loop-helix leucine zipper, and leucine zipper-like domains (8.Yamashita H. Takenoshita M. Sakurai M. Bruick R.K. Henzel W.J. Shillinglaw W. Arnot D. Uyeda K. A glucose-responsive transcription factor that regulates carbohydrate metabolism in the liver.Proc. Natl. Acad. Sci. USA. 2001; 98: 9116-9121Crossref PubMed Scopus (515) Google Scholar). ChREBP is localized in the cytoplasm under low-glucose conditions, and it translocates to the nucleus when glucose metabolism increases (9.Kawaguchi T. Takenoshita M. Kabashima T. Uyeda K. Glucose and cAMP regulate the L-type pyruvate kinase gene by phosphorylation/dephosphorylation of the carbohydrate response element binding protein.Proc. Natl. Acad. Sci. USA. 2001; 98: 13710-13715Crossref PubMed Scopus (298) Google Scholar). There is some evidence suggesting that xylulose-5-phosphate, an intermediate of the pentose phosphate pathway, is the intracellular signaling compound by which excess carbohydrate activates ChREBP (10.Uyeda K. Yamashita H. Kawaguchi T. Carbohydrate responsive element-binding protein (ChREBP): a key regulator of glucose metabolism and fat storage.Biochem. Pharmacol. 2002; 63: 2075-2080Crossref PubMed Scopus (158) Google Scholar).Glucose is converted to pyruvate via the glycolysis pathway and subsequently enters the Krebs cycle in mitochondria to be oxidized to CO2 when ATP is required. When abundant carbohydrate is available, glucose is converted to glycogen and fat, storage products that are used during fasting, strenuous exercise, or in a "fight-or-flight" situation (11.Salway J.G. Metabolism at a Glance. Blackwell Science, Oxford, UK1999Google Scholar). The conversion of carbohydrate to fatty acids involves enzymes such as ATP citrate lyase, acetyl-CoA carboxylase 1, and fatty acid synthase to generate palmitic acid (C16:0). Subsequent desaturation and/or elongation by stearoyl-CoA desaturase and long-chain fatty acyl elongase yields palmitoleic acid (C16:1), stearic acid (C18:0), and oleic acid (C18:1). The esterification of fatty acids to yield triglycerides and subsequent packaging into VLDL molecules involve several enzymes, and the details of this process are not yet completely understood. Diacylglycerol acyltransferases 1 and 2 (DGAT1 and DGAT2) are important for the esterification of diacylglycerol to yield triglycerides. It is believed that one of the two enzymes is cytoplasmic and mainly plays a role in the esterification of fatty acids that form the pool of triglycerides stored in the liver, whereas the second is present in the endoplasmic reticulum lumen and reesterifies fatty acids released from this pool to incorporate them into the triacylglycerol-rich particle that eventually forms the mature VLDL molecule (12.Owen M.R. Corstorphine C.C. Zammit V.A. Overt and latent activities of diacylglycerol acyltransferase in rat liver microsomes: possible roles in very-low-density lipoprotein triacylglycerol secretion.Biochem. J. 1997; 323: 17-21Crossref PubMed Scopus (110) Google Scholar, 13.Gibbons G.F. Wiggins D. Brown A.M. Hebbachi A.M. Synthesis and function of hepatic very-low-density lipoprotein.Biochem. Soc. Trans. 2004; 32: 59-64Crossref PubMed Scopus (190) Google Scholar, 14.Yamazaki T. Sasaki E. Kakinuma C. Yano T. Miura S. Ezaki O. Increased very low density lipoprotein secretion and gonadal fat mass in mice overexpressing liver DGAT1.J. Biol. Chem. 2005; 280: 21506-21514Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). Microsomal triglyceride transfer protein (MTP) is also located in the lumen of the endoplasmic reticulum and is strictly necessary for the assembly and secretion of apolipoprotein B-containing lipoproteins (15.Wetterau J.R. Zilversmit D.B. Localization of intracellular triacylglycerol and cholesteryl ester transfer activity in rat tissues.Biochim. Biophys. Acta. 1986; 875: 610-617Crossref PubMed Scopus (92) Google Scholar, 16.Wetterau J.R. Aggerbeck L.P. Bouma M.E. Eisenberg C. Munck A. Hermier M. Schmitz J. Gay G. Rader D.J. Gregg R.E. Absence of microsomal triglyceride transfer protein in individuals with abetalipoproteinemia.Science. 1992; 258: 999-1001Crossref PubMed Scopus (629) Google Scholar). Reduction of MTP activity levels by drug administration or in liver-specific knockout mice results in decreased levels of lipoproteins in plasma (17.Wetterau J.R. Gregg R.E. Harrity T.W. Arbeeny C. Cap M. Connolly F. Chu C.H. George R.J. Gordon D.A. Jamil H. et al.An MTP inhibitor that normalizes atherogenic lipoprotein levels in WHHL rabbits.Science. 1998; 282: 751-754Crossref PubMed Scopus (251) Google Scholar, 18.Raabe M. Veniant M.M. Sullivan M.A. Zlot C.H. Bjorkegren J. Nielsen L.B. Wong J.S. Hamilton R.L. Young S.G. Analysis of the role of microsomal triglyceride transfer protein in the liver of tissue-specific knockout mice.J. Clin. Invest. 1999; 103: 1287-1298Crossref PubMed Scopus (357) Google Scholar). The impact of glucose metabolism on the regulation of all of these enzymes is not well understood. A deeper insight into the mechanisms by which carbohydrate controls gene expression may help in the design of better therapeutic treatments for diseases involving hepatic lipid metabolism, such as the metabolic syndrome and type 2 diabetes. The aim of this study was to investigate the role of glucose on the transcriptional regulation of genes involved in DNL and VLDL assembly in the liver.MATERIALS AND METHODSAnimal groupsAthymic NIH nude rats (Cr: NIH-rnu), 6 to 8 weeks old (100–130 g), were obtained from the National Cancer Institute (Frederick, MD). Guidelines for the use and care of laboratory animals at Mount Sinai School of Medicine and at Indiana University School of Medicine were followed. The animals were housed in a barrier facility during the course of the experiment and were kept under a 12 h light cycle (7:00 AM–7:00 PM). Rats were fed a standard chow diet. Animals were fasted overnight before intravenous administration of 80 mg/kg streptozotocin (STZ) dissolved in 100 mM citrate, pH 4.5, and 150 mM NaCl. Diabetic rats were selected based on blood glucose levels of >400 mg/dl and >10 g of body weight loss.Microarray analysisFour days after STZ administration, 9 × 1011 viral particles (vp; 7.7 × 1012 vp/kg) of the adenoviral vector Ad.EF1αGK (E1-deleted adenoviral vector containing an expression cassette with the glucokinase cDNA driven by the elongation factor 1α promoter) or Ad.RSVβgal (expressing β-galactosidase from the Rous sarcoma virus promoter) (19.Dong H. Morral N. McEvoy R. Meseck M. Thung S.N. Woo S.L. Hepatic insulin expression improves glycemic control in type 1 diabetic rats.Diabetes Res. Clin. Pract. 2001; 52: 153-163Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 20.Morral N. McEvoy R. Dong H. Meseck M. Altomonte J. Thung S. Woo S.L. Adenovirus-mediated expression of glucokinase in the liver as an adjuvant treatment for type 1 diabetes.Hum. Gene Ther. 2002; 13: 1561-1570Crossref PubMed Scopus (29) Google Scholar) was injected into the tail vein to groups of five rats. Reference data were collected from a group of nondiabetic rats. Rats were fed ad libitum and were euthanized under fed conditions on the morning of day 17. The liver was quickly removed and frozen on liquid nitrogen for RNA and protein isolation.Hepatic triglyceride secretionAfter STZ administration, animals received 5 × 1011 vp (4.3 × 1012 vp/kg) of Ad.EF1αGK or Ad.RSVβgal. STZ and nondiabetic control groups received vehicle. Triglyceride secretion rates were estimated on day 8 after virus administration. Rats were fasted for 4.5 h and given an intravenous bolus of tyloxapol (Triton WR-1339; Sigma Chemical Co., St. Louis, MO). Tyloxapol was dissolved in 0.9% NaCl and injected at a dose of 300 mg/kg body weight. Blood samples were collected from tail veins for the measurement of triglycerides at 0, 30, 60, and 90 min after tyloxapol injection. Triglyceride accumulation rates were determined as (mg/min): 1/3[(TG30 − TG0)/30 + (TG60 − TG0)/60 + (TG90 − TG0)/90] × plasma volume, where TG0, TG30, TG60, and TG90 are triglyceride concentrations at 0, 30, 60, and 90 min, respectively. The plasma volume was estimated as 3.5% of body weight (21.Waynforth H.B. Flecknell P.A. Experimental and Surgical Technique in the Rat. 2nd edition. Academic Press, London1992Google Scholar). Animals were euthanized under fed conditions on the morning of day 9, and livers were obtained for Oil Red O staining.Blood glucose, serum insulin, NEFA, TG, and β-hydroxybutyrate measurementBlood glucose was measured from a blood drop obtained from the tail vein using an Elite XL glucometer (Bayer, Elkhart, IN). Serum insulin levels were measured by RIA (Linco Research, St. Louis, MO) according to the manufacturer's protocol. NEFAs were assayed using a kit from Wako (Richmond, VA). Triglycerides and β-hydroxybutyrate levels were measured by enzymatic assays using the GPO-Trinder and β-HBA (No. 310-UV) kits from Sigma Diagnostics (St. Louis, MO).Microarray analysisTotal RNA was isolated from livers of rats that received Ad.EF1αGK or Ad.RSVβgal (five rats each) using Qiagen (Valencia, CA) Maxiprep kits. An additional purification step was carried out by precipitating RNA with lithium chloride. RNA was converted to double-stranded cDNA using the SuperScript Choice system for cDNA synthesis (Gibco BRL Life Technologies, Carlsbad, CA) and a T7-(dT)24 oligomer (Genset Corp., San Diego, CA). The double-stranded cDNA was transcribed in vitro with T7 polymerase to generate biotinylated copy RNA (Enzo BioArray HighYield RNA Transcript Labeling Kit; Enzo Life Sciences, Inc., Farmingdale, NY), which was subsequently purified with the RNeasy kit (Qiagen). The copy RNA was used to hybridize 10 independent Affymetrix Rat Genome U34A arrays (Affymetrix, Santa Clara, CA) using a rotary hybridization oven and postprocessed in Gene Chip Fluidics Station 400, according to the manufacturer's protocol (Affymetrix). The array image was generated by a high-resolution GeneArray Scanner (Agilent, Palo Alto, CA). The U34A array contains ∼7,000 full-length genes and 800 expressed sequence tags. Image files were analyzed with the application Microarray Analysis Suite version 5.0 (Affymetrix). Data were extracted after global scaling to 1,000. Probe sets showing a present call in at least half of the samples of at least one of the two groups were selected (22.McClintick J.N. Jerome R.E. Nicholson C.R. Crabb D.W. Edenberg H.J. Reproducibility of oligonucleotide arrays using small samples.BMC Genomics. 2003; 4: 4Crossref PubMed Scopus (80) Google Scholar, 23.McClintick J.N. Edenberg H.J. Effects of filtering by Present call on analysis of microarray experiments.BMC Bioinformatics. 2006; 7: 49Crossref PubMed Scopus (193) Google Scholar), and a Welch's t-test was performed to determine significant differences between the Ad.EF1αGK- and Ad.RSVβgal-treated groups. False discovery rate (FDR) was calculated according to Benjamini and Hochberg (24.Benjamini Y. Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing.J. R. Stat. Soc. B. 1995; 57: 289-300Google Scholar). Gene probes that resulted in statistically significant differences (P < 0.05) were loaded onto the NIH-DAVID database (25.Dennis Jr., G. Sherman B.T. Hosack D.A. Yang J. Gao W. Lane H.C. Lempicki R.A. DAVID: Database for Annotation, Visualization, and Integrated Discovery.Genome Biol. 2003; 4: 3Crossref PubMed Google Scholar) for analysis of gene ontologies according to the biological process.Real-time PCRReal-time PCR was used to quantify mRNA levels of the following genes: ChREBP, DGAT1, DGAT2, elongation factor 2 (EF2), FAS, forkhead box A2 (FOXA2), forkhead box O1A (FOXO1A), fumarate hydratase 1 (FH), HMG-CoA reductase (HMG-CoA Red), keratinocyte fatty acid binding protein (K-FABP), lactosylceramide synthase, low density lipoprotein receptor (LDLR), liver-type pyruvate kinase, LDL receptor-related protein 1, MTP, peroxisome proliferator-activated receptor γ (PPARγ); PPARγ coactivator-1α and -1β (PGC-1α and PGC-1β), SREBP-1, and SREBP-2. Primers used for amplification are listed in Table 1 . Real-time PCR was performed using an ABI PRISM 7700 instrument (ABI, Foster City, CA) and the SYBR Green Qiagen One-Step RT-PCR kit (Qiagen) according to the manufacturer's protocol and using 0.5 μM of each primer. Primer pairs were designed to amplify a fragment of 103–450 bp and were first tested to yield a single PCR product based on the melting curve and confirmation by agarose gel electrophoresis. A standard curve was generated with serial dilutions of an RNA sample from a normal rat. Quantification of mRNA levels in test samples was measured by analyzing 50 ng of total RNA in triplicate and comparing threshold cycle values with those of the standard curve. Because β-actin was found to be expressed at significantly different levels between the treatment groups, the eukaryotic translation EF2 gene was used as a loading control. Values were expressed relative to the nondiabetic group.TABLE 1.Primer sequences for real-time RT-PCR analysisGeneAccession NumberForward Primer (5′→3′)Reverse Primer (5′→3′)ChREBPAB074517TGCCATCAACTTGTGCCAGCTGCGGTAGACACCATCCCATDGAT1NM_053437CCGTGGTATCCTGAATTGGTGGCGCTTCTCAATCTGAAATDGAT2NM_001012345ATCTTCTCTGTCACCTGGCTACCTTTCTTGGGCGTGTTCCEF2NM_017245.2GACCAGTTCCTTGTGAAGACCGAATGATGTGCTCCCCAGACTCCFASM76767TTTGCCAAGGAGGTGCGAACTACTCAGCAGAAGATGTGCGGFHNM_017005GTGCTGTATTGTCAGGGGAAGCTGGGATTGGCATTCTCTCCGTCFOXA2NM_012743TGAAGATGGAAGGGCACGAGCCCACATAGGATGACATGTTCFOXO1AXM_342244TACTTCAAGGATAAGGGCGACATTTTCTTAGCAGCCCGTCCTCHMG-CoA RedNM_013134.2CAGCACTGTCGTCATTCATTTCCACATTCCACCAGAGCGTCAAGGK-FABPNM_145878CCATGGCCAGCCTTAAGGAACCTTCTCATAGACCCGAGTLacCer SynAF048687.1TCGGAACTATTACGGATGCGGGTGAACTCTGTTCCAAAGGTCGLDLRNM_175762.2CCGCCTCTATTGGGTTGATTCGTTGCCTCACACCAGTTTACCL-PKM11709GTATCATGCTGTCCGGAGAGACGCCAACCTGTCACCACAATCACLRPXM_243524TACGCCACCAACTCAGACAACGTTTCCCGTCACTTCCCAGACTGMTPXM_227765GAACCTGAGAACCTGTCCAACGTGAACTTGCTAAGGAGGGCTTGPGC-1αNM_031347TGAATGACCTGGACACAGACAATCAAATGAGGGCAATCCGTCPGC-1βAY_188951TCCCCAGTGTCTGAAGTGGATTCTTGTCCTGGGTGCCATCPPARγAB019561GGTGTGATCTTAACTGTCGGTTCAGCTGGTCGATATCACTSREBP-1XM_213329GGTCACCGTTTCTTCGTGGATGGGCTGAGCGATACAGTTCAATGCSREBP-2XM_216989ATTCCCTTGTTTTGACCACGCTGTCCGCCTCTCTCCTTCTTTGChREBP, carbohydrate-responsive element binding protein; DGAT, diacylglycerol acyltransferase; EF2, elongation factor 2; FAS, fatty acid synthase; FH, fumarate hydratase 1; FOXA2, forkhead box A2; FOXO1A, forkhead box O1A; HMG-CoA Red, 3-hydroxy-3-methylglutaryl coenzyme A reductase; K-FABP, keratinocyte fatty acid binding protein; LacCer Syn, lactosylceramide synthase; LDLR, low density lipoprotein receptor; L-PK, liver-type pyruvate kinase; LRP, LDLR-related protein 1; MTP, microsomal triglyceride transfer protein; PGC, PPARγ coactivator; PPARγ, peroxisome proliferator-activated receptor γ; SREBP, sterol-regulatory element binding protein. Open table in a new tab Western blotApproximately 50 mg of liver in 1 ml of lysis buffer (50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.25% sodium deoxycholate, 1 mM PMSF, 1 μg/ml aprotinin, 1 μg/ml pepstatin, and 1 μg/ml leupeptin) was completely homogenized with a tissue rotor-stator (IKA, Wilmington, NC) and incubated on ice for 30 min. Cellular debris was pelleted by centrifugation at 4°C. The fat layer was removed by aspiration, and the cleared supernatant was transferred to a fresh tube. Protein concentrations were determined by colorimetric assay (Bio-Rad, Hercules, CA). For Western blotting, 50 μg of liver proteins was run on an 18% or a 4–20% SDS-PAGE gel, transferred to a polyvinylidene difluoride membrane, and probed for K-FABP (R&D Systems, Minneapolis, MN), MTP (BD Biosciences, San Jose, CA), LDLR (Abcam, Cambridge, MA), or light chain of the LDLR-related protein 1 (Calbiochem, San Diego, CA). Membranes were then stripped and reprobed with an anti-cyclophilin antibody (Novus Biologicals, Littleton, CO).Statistical analysisData in the figures and Table 2 are expressed as means ± SD. Statistical analysis was performed using an unpaired two-tailed Student's t-test. P < 0.05 was considered a significant difference.TABLE 2.Fed serum parametersParameterAd.EF1αGKAd.RSVβgalPBSNondiabeticInsulin (ng/dl)0.19 ± 0.12aSignificantly different from the nondiabetic group (P < 0.05).0.13 ± 0.02aSignificantly different from the nondiabetic group (P < 0.05).0.14 ± 0.03aSignificantly different from the nondiabetic group (P < 0.05).1.75 ± 0.82Glucose (mg/dl)226.8 ± 120.6bSignificantly different from the Ad.RSVβgal and PBS groups (P < 0.05).575.4 ± 37.6aSignificantly different from the nondiabetic group (P < 0.05).541.8 ± 114.6aSignificantly different from the nondiabetic group (P < 0.05).92.4 ± 5.0β-Hydroxybutyrate (mg/dl)8.7 ± 1.3bSignificantly different from the Ad.RSVβgal and PBS groups (P < 0.05).14.1 ± 3.722.2 ± 5.6aSignificantly different from the nondiabetic group (P < 0.05).7.2 ± 5.0FFA (mM)0.78 ± 0.10aSignificantly different from the nondiabetic group (P < 0.05).0.76 ± 0.15aSignificantly different from the nondiabetic group (P < 0.05).0.94 ± 0.2aSignificantly different from the nondiabetic group (P < 0.05).0.48 ± 0.06Triglycerides (mg/dl)51.7 ± 15.8bSignificantly different from the Ad.RSVβgal and PBS groups (P < 0.05).167.8 ± 81.9aSignificantly different from the nondiabetic group (P < 0.05).251.3 ± 33.5aSignificantly different from the nondiabetic group (P < 0.05).49.6 ± 16.2a Significantly different from the nondiabetic group (P < 0.05).b Significantly different from the Ad.RSVβgal and PBS groups (P < 0.05). Open table in a new tab RESULTSGene expression profilesGlucokinase is the first and limiting enzyme of the glycolysis pathway, and its transcription is insulin-dependent. Given that glucose metabolism depends on the presence of insulin, it is difficult to determine the role of the former on the activation of gene expression in vivo. To determine the contribution of glucose metabolism to hepatic lipogenesis independently of insulin action, we overexpressed glucokinase in the liver of type 1 diabetic animals. Rats were rendered diabetic by intravenous administration of STZ at a dose of 80 mg/kg (20.Morral N. McEvoy R. Dong H. Meseck M. Altomonte J. Thung S. Woo S.L. Adenovirus-mediated expression of glucokinase in the liver as an adjuvant treatment for type 1 diabetes.Hum. Gene Ther. 2002; 13: 1561-1570Crossref PubMed Scopus (29) Google Scholar). We previously showed that STZ-induced diabetic rats do not have detectable levels of glucokinase in liver, as a result of the lack of insulin (20.Morral N. McEvoy R. Dong H. Meseck M. Altomonte J. Thung S. Woo S.L. Adenovirus-mediated expression of glucokinase in the liver as an adjuvant treatment for type 1 diabetes.Hum. Gene Ther. 2002; 13: 1561-1570Crossref PubMed Scopus (29) Google Scholar). Four days after STZ administration, rats received 9 × 1011 vp of Ad.EF1αGK or Ad.RSVβgal (20.Morral N. McEvoy R. Dong H. Meseck M. Altomonte J. Thung S. Woo S.L. Adenovirus-mediated expression of glucokinase in the liver as an adjuvant treatment for type 1 diabetes.Hum. Gene Ther. 2002; 13: 1561-1570Crossref PubMed Scopus (29) Google Scholar). This vector dose resulted in ∼90% liver transduction and an ∼11-fold increase in glucokinase activity compared with nondiabetic animals (20.Morral N. McEvoy R. Dong H. Meseck M. Altomonte J. Thung S. Woo S.L. Adenovirus-mediated expression of glucokinase in the liver as an adjuvant treatment for type 1 diabetes.Hum. Gene Ther. 2002; 13: 1561-1570Crossref PubMed Scopus (29) Google Scholar). The equivalent volume of PBS was given to a group of STZ-treated rats, and a group of nondiabetic rats was used to collect reference data.Seventeen days after vector administration, blood glucose was ∼200 mg/dl in the group of rats that received the Ad.EF1αGK vector (∼60% reduction) and >500 mg/dl in the groups that received PBS or the control vector, Ad.RSVβgal (Table 2). Insulin levels were dramatically reduced in all STZ-treated animals (Table 2). To elucidate the gene expression pattern induced by glucose metabolism, RNA was obtained from liver of rats that received 9 × 1011 vp/kg Ad.EF1αGK or Ad.RSVβgal, and Affymetrix GeneChip analysis was carried out using individual arrays for each animal. There were 984 probe sets that differed significantly between the two conditions (P ⩽ 0.05; FDR ⩽ 0.17), of which 483 were at P ⩽ 0.01 (FDR ⩽ 0.070) and 162 were at P ⩽ 0.001 (FDR ⩽ 0.021). Approximately 28.5% of the significant probe sets (P ⩽ 0.05) were involved in metabolism and 14.4% were involved in cellular physiological processes (Table 3). All genes significantly changed are listed in supplementary appendix I (available online).TABLE 3.Distribution of probe sets significantly altered in glucokinase-overexpressing ratsFunctional CategoryPercentage of Probe SetsMetabolism28.5Cellular physiological process14.4Cell communication9.5Organismal physiological process6.2Response to stimulus6.0Homeostasis1.4Morphogenesis1.4Cell differentiation1.2Regulation of cellular process1.2Death1.0Regulation of physiological process0.4Secretion0.4Coagulation0.2Pigmentation0.2Reproduction0.2Unclassified53.6 Open table in a new tab Classification using biological function was performed to determine alterations to carbohydrate and lipid metabolism pathways (Tables 4, 5). mRNA levels of critical genes were confirmed by real-time RT-PCR (Fig. 1). Genes involved in glycolysis, such as lactate dehydrogenase and liver-type pyruvate kinase, were upregulated (Table 4, Fig. 1), whereas genes involved in the tricarboxylic acid cycle (Krebs cycle) and oxidative phosphorylation, such as FH and ATP synthase, respectively, were downregulated (Table 4). This suggests that conversion of pyruvate to CO2 was not the primary pathway in the liver of the glucokinase-overexpressing animals. Levels of mRNA of the lipogenic genes fatty acid synthase, ATP citrate lyase, and malic enzyme were increased multiple-fold (Table 5, Fig. 1), indicating that the de novo fatty acid synthesis pathway was upregulated in Ad.EF1αGK-treated animals. Consistent with this observation, several genes of the pentose phosphate pathway, including glucose 6-phosphate dehydrogenase, transaldolase, and transketolase, were also increased. The conversion of glucose to fatty acids requires NADPH for the addition of malonyl units into the nascent acyl-ACP chain. Approximately 60% of the NADPH is produced through the cascade of reactions of the pentose phosphate pathway, whereas the pyruvate/malate cycle generates ∼40% (11.Salway J.G. Metabolism at a Glance. Blackwell Science, Oxford, UK1999Google Scholar). The fructose transporter, GLUT5, was upregulated by 4.19-fold, and the expression of several genes involved in glycoprotein biosynthesis was also increased (Table 4).TABLE 4.Genes involved in carbohydrate metabolismAffymetrix IdentifierGene NameFold ChangePGlycolysis X05684_atPyruvate kinase, liver and red blood cells6.02<0.01 U07181_g_atLactate dehydrogenase B2.48<0.01 X02291exon_s_atAldolase B1.58<0.05 X02610_g_atEnolase 1α1.48<0.05Tricarboxylic acid cycle and associated reactions L22294_atPyruvate dehydrogenase kinase 12.14<0.01 AB010743_atUncoupling protein 21.7<0.05 D10655_atDihydrolipoamide acetyltransferase1.68<0.01 rc_AI171734_s_atFumarate hydratase 1−3.11<0.01 U12268_atCarbonic anhydrase 5−3.09<0.01 U10357_atPyruvate dehydrogenase kinase 2−1.78<0.05 D13124_s_atATP synthase, H+-transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2−1.41<0.05 D13123_s_atATP synthase, H+-transporting, mitochondrial F0 complex, subunit c, isoform 1−1.36<0.05 rc_AI010480_atMalate dehydrogenase, mitochondrial−1.32<0.05 L19927_atATP syntha
Referência(s)