Differential Regulation of Drosophila Tyrosine Hydroxylase Isoforms by Dopamine Binding and cAMP-dependent Phosphorylation
1999; Elsevier BV; Volume: 274; Issue: 24 Linguagem: Inglês
10.1074/jbc.274.24.16788
ISSN1083-351X
AutoresAgnès Vié, Mireille Cigna, René Toci, Serge Birman,
Tópico(s)Signaling Pathways in Disease
ResumoTyrosine hydroxylase (TH) catalyzes the first step in dopamine biosynthesis in Drosophila as in vertebrates. We have previously reported that tissue-specific alternative splicing of the TH primary transcript generates two distinct TH isoforms in Drosophila, DTH I and DTH II (Birman, S., Morgan, B., Anzivino, M., and Hirsh, J. (1994)J. Biol. Chem. 269, 26559–26567). Expression of DTH I is restricted to the central nervous system, whereas DTH II is expressed in non-nervous tissues like the epidermis. The two enzymes present a single structural difference; DTH II specifically contains a very acidic segment of 71 amino acids inserted in the regulatory domain. We show here that the enzymatic and regulatory properties of vertebrate TH are generally conserved in insect TH and that the isoform DTH II presents unique characteristics. The two DTH isoforms were expressed as apoenzymes in Escherichia coli and purified by fast protein liquid chromatography. The recombinant DTH isoforms are enzymatically active in the presence of ferrous iron and a tetrahydropteridine co-substrate. However, the two enzymes differ in many of their properties. DTH II has a lower K mvalue for the co-substrate (6R)-tetrahydrobiopterin and requires a lower level of ferrous ion than DTH I to be activated. The two isoforms also have a different pH profile. As for mammalian TH, enzymatic activity of the Drosophila enzymes is decreased by dopamine binding, and this effect is dependent on ferrous iron levels. However, DTH II appears comparatively less sensitive than DTH I to dopamine inhibition. The central nervous system isoform DTH I is activated through phosphorylation by cAMP-dependent protein kinase (PKA) in the absence of dopamine. In contrast, activation of DTH II by PKA is only manifest in the presence of dopamine. Site-directed mutagenesis of Ser32, a serine residue occurring in a PKA site conserved in all known TH proteins, abolishes phosphorylation of both isoforms and activation by PKA. We propose that tissue-specific alternative splicing of TH has a functional role for differential regulation of dopamine biosynthesis in the nervous and non-nervous tissues of insects. Tyrosine hydroxylase (TH) catalyzes the first step in dopamine biosynthesis in Drosophila as in vertebrates. We have previously reported that tissue-specific alternative splicing of the TH primary transcript generates two distinct TH isoforms in Drosophila, DTH I and DTH II (Birman, S., Morgan, B., Anzivino, M., and Hirsh, J. (1994)J. Biol. Chem. 269, 26559–26567). Expression of DTH I is restricted to the central nervous system, whereas DTH II is expressed in non-nervous tissues like the epidermis. The two enzymes present a single structural difference; DTH II specifically contains a very acidic segment of 71 amino acids inserted in the regulatory domain. We show here that the enzymatic and regulatory properties of vertebrate TH are generally conserved in insect TH and that the isoform DTH II presents unique characteristics. The two DTH isoforms were expressed as apoenzymes in Escherichia coli and purified by fast protein liquid chromatography. The recombinant DTH isoforms are enzymatically active in the presence of ferrous iron and a tetrahydropteridine co-substrate. However, the two enzymes differ in many of their properties. DTH II has a lower K mvalue for the co-substrate (6R)-tetrahydrobiopterin and requires a lower level of ferrous ion than DTH I to be activated. The two isoforms also have a different pH profile. As for mammalian TH, enzymatic activity of the Drosophila enzymes is decreased by dopamine binding, and this effect is dependent on ferrous iron levels. However, DTH II appears comparatively less sensitive than DTH I to dopamine inhibition. The central nervous system isoform DTH I is activated through phosphorylation by cAMP-dependent protein kinase (PKA) in the absence of dopamine. In contrast, activation of DTH II by PKA is only manifest in the presence of dopamine. Site-directed mutagenesis of Ser32, a serine residue occurring in a PKA site conserved in all known TH proteins, abolishes phosphorylation of both isoforms and activation by PKA. We propose that tissue-specific alternative splicing of TH has a functional role for differential regulation of dopamine biosynthesis in the nervous and non-nervous tissues of insects. Tyrosine hydroxylase (TH 1The abbreviations used are: TH, tyrosine hydroxylase; BH4, (6R)-5,6,7,8-tetrahydrobiopterin; DTH, Drosophilatyrosine hydroxylase; HTH, human tyrosine hydroxylase; PCR, polymerase chain reaction; PKA, cAMP-dependent protein kinase; Mes, 2-(N-morpholino)ethanesulfonic acid; bp, base pairs; PAGE, polyacrylamide gel electrophoresis) (tyrosine 3-monooxygenase, EC 1.14.16.2) is an eukaryotic enzyme catalyzing the first and rate-limiting step in dopamine and other catecholamine biosynthesis, i.e. the hydroxylation of the monophenol amino acid l-tyrosine to produce the ortho-diphenoll-dihydroxyphenylalanine (2Nagatsu T. Levitt M. Udenfriend S. J. Biol. Chem. 1964; 239: 2910-2917Abstract Full Text PDF PubMed Google Scholar, 3Levitt M. Spector S. Sjoerdsma A. Udenfriend S. J. Pharmacol. Exp. Ther. 1965; 148: 1-8PubMed Google Scholar). The enzyme is active in the presence of ferrous iron, O2, and a tetrahydrobiopterin co-substrate. A single gene encodes TH, which is required for embryonic development and survival in mammals (4Kobayashi K. Morita S. Sawada H. Mizuguchi T. Yamada K. Nagatsu I. Hata T. Watanabe Y. Fujita K. Nagatsu T. J. Biol. Chem. 1995; 270: 27235-27243Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 5Zhou Q.Y. Quaife C.J. Palmiter R.D. Nature. 1995; 374: 640-643Crossref PubMed Scopus (399) Google Scholar). In vertebrates, TH activity is exquisitely regulated at each step of its expression: control of gene transcription, RNA alternative processing, mRNA stability, and direct modulation of the enzyme by catecholamine feedback inhibition and protein kinase activation (6Zigmond R.E. Schwarzschild M.A. Rittenhouse A.R. Annu. Rev. Neurosci. 1989; 12: 415-461Crossref PubMed Scopus (467) Google Scholar, 7Hufton S.E. Jennings I.G. Cotton R.G. Biochem. J. 1995; 311: 353-366Crossref PubMed Scopus (186) Google Scholar, 8Kumer S.C. Vrana K.E. J. Neurochem. 1996; 67: 443-462Crossref PubMed Scopus (624) Google Scholar). In contrast, much less is known on the regulatory properties of tyrosine hydroxylase in insects. Mutations in the Drosophilapale locus, which corresponds to DTH (9Jürgens G. Wieschaus E. Nüsslein-Volhard C. Kluding H. Wilhelm Roux's Arch. Dev. Biol. 1984; 193: 283-295Crossref PubMed Scopus (659) Google Scholar, 10Budnik V. White K. J. Neurogenet. 1987; 4: 309-314Crossref PubMed Scopus (76) Google Scholar, 11Neckameyer W.S. White K. J. Neurogenet. 1993; 8: 189-199Crossref PubMed Scopus (110) Google Scholar), result in unpigmented embryos that are unable to hatch. It has been shown that dopamine has a dual function in insects, acting as a neurotransmitter in the central nervous system (12Restifo L.L. White K. Adv. Insect Phys. 1990; 22: 116-219Google Scholar, 13Lundell M.J. Hirsh J. Dev. Biol. 1994; 165: 385-396Crossref PubMed Scopus (89) Google Scholar) and as a precursor molecule required for pigmentation and hardening of the cuticle (14Wright T.R.F. Adv. Genet. 1987; 24: 127-222Crossref PubMed Scopus (395) Google Scholar, 15Hopkins T.L. Kramer K.J. Annu. Rev. Entomol. 1992; 37: 273-302Crossref Scopus (387) Google Scholar, 16Wright T.R. J. Hered. 1996; 87: 175-190Crossref PubMed Scopus (52) Google Scholar). The TH enzyme is composed of a carboxyl-terminal catalytic domain and an amino-terminal regulatory domain (17Ledley F.D. DiLella A.G. Kwok S.C.M. Woo S.L.C. Biochemistry. 1985; 24: 3389-3394Crossref PubMed Scopus (101) Google Scholar, 18Abate C. Smith J.A. Joh T.H. Biochem. Biophys. Res. Commun. 1988; 151: 1446-1453Crossref PubMed Scopus (37) Google Scholar, 19Daubner S.C. Lohse D.L. Fitzpatrick P.F. Protein Sci. 1993; 2: 1452-1460Crossref PubMed Scopus (72) Google Scholar, 20Ribeiro P. Wang Y.H. Citron B.A. Kaufman S. J. Mol. Neurosci. 1993; 4: 125-139Crossref PubMed Scopus (33) Google Scholar, 21Walker S.J. Liu X. Roskoski R. Vrana K.E. Biochim. Biophys. Acta. 1994; 1206: 113-119Crossref PubMed Scopus (31) Google Scholar). The catalytic domain has been well conserved in Drosophila TH (22Neckameyer W.S. Quinn W.G. Neuron. 1989; 2: 1167-1175Abstract Full Text PDF PubMed Scopus (123) Google Scholar). The regulatory domain is not conserved but contains a potential protein kinase A (PKA) site occurring at Ser32 that is homologous to Ser40, the major site of phosphorylation by PKA in vertebrate TH (8Kumer S.C. Vrana K.E. J. Neurochem. 1996; 67: 443-462Crossref PubMed Scopus (624) Google Scholar). Two different forms of TH proteins have been found in Drosophila melanogaster, which are produced through alternative splicing of a single copy gene (1Birman S. Morgan B. Anzivino M. Hirsh J. J. Biol. Chem. 1994; 269: 26559-26567Abstract Full Text PDF PubMed Google Scholar). The major form,Drosophila TH Type II (DTH II), contains a very acidic segment of 71 amino acids inserted in the regulatory domain close to the PKA phosphorylation site. The two DTH isoforms are expressed in distinct tissues; DTH I is specific of the nervous tissue, whereas DTH II is widely expressed in non-nervous tissues (1Birman S. Morgan B. Anzivino M. Hirsh J. J. Biol. Chem. 1994; 269: 26559-26567Abstract Full Text PDF PubMed Google Scholar). DTH II is strongly expressed in the epidermis, or hypoderm, the single-layered epithelium that covers the insect body and secretes the cuticle. To compare the kinetic and regulatory properties of the twoDrosophila TH isoforms in vitro, we have expressed each of these molecules as recombinant apoenzymes in a bacterial expression system. Both isoforms were produced at a high level and purified. We show here that the two enzymes differ in many of their properties, including their pH profiles, iron requirements, andK m values for (6R)-5,6,7,8-tetrahydrobiopterin (BH4). In addition, the two enzymes are differentially regulated by dopamine feedback inhibition and activation by cAMP-dependent phosphorylation. Our data suggest that the acidic extension in the regulatory domain of DTH II endogenously activates the enzyme. The structural difference between the two DTH isoforms could therefore have a functional role and correspond to a differential regulation of dopamine biosynthesis in nervous and non-nervous tissues of insects. The cDNA clones pDTHcDNA1 and pDTHcDNA2, which encode DTH Type I and Type II, respectively, were isolated previously (1Birman S. Morgan B. Anzivino M. Hirsh J. J. Biol. Chem. 1994; 269: 26559-26567Abstract Full Text PDF PubMed Google Scholar). cDNA segments containing the complete coding sequence of each DTH isoform were subcloned into the Escherichia coli expression vector pET-11a (23Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6320) Google Scholar). First, a NdeI site was introduced at the translation start site of both cDNAs by site-directed mutagenesis. The method we used was a modification of the three primer PCR mutagenesis procedure. PCRs were carried out with Vent polymerase (New England Biolabs) in a 50-μl final volume as described by Mariniet al. (24Marini F.D. Naeem A. Lapeyre J.N. Nucleic Acids Res. 1993; 21: 2277-2278Crossref PubMed Scopus (34) Google Scholar) using 1 ng of the plasmid pDTHcDNA1 as a template. The primary reaction was performed with a 5′ external sense DTH oligonucleotide primer (OTH1′, 5′-TTCGCCCTAAAGACTTGTGC) and an internal mutagenesis antisense DTH primer with two mismatches (OTHm1, 5′-CGGCCATCATATGGTTTTGTGTG; mismatches are bold, and the NdeI site is underlined). The product of this PCR, a double-stranded 442-bp DNA segment intermediate, was purified and used as a “megaprimer” in a second similar PCR with a 3′ external antisense DTH primer (OTH2, 5′-CAACAAAATCTCGTCCTCGGTGAGACC). The final 645-bp amplification product was digested with XbaI and XhoI and inserted to replace the corresponding nonmutated segment in pDTHcDNA1 and pDTHcDNA2. Finally, NdeI-BclI cDNA segments containing the coding sequence of the DTH isoforms Type I and Type II were ligated to the vector pET-11a previously digested with NdeI and BamHI to generate the recombinant expression vectors pEDTHI and pEDTHII, respectively. To replace Ser32 with Arg in both DTH isoforms, a mutagenesis DTH sense primer was synthesized (OTHm2, 5′CGCCGTCGCCGCCTGGTGGAT). A double-stranded 131-bp DNA segment intermediate was amplified from pDTHcDNA1 with the primers OTH2 and OTHm2. This mutated 131-bp segment and the 442-bp segment obtained previously with the primers OTH1′ and OTHm1 were joined by a second PCR. The final doubly mutated 645-bp amplification product was used as described for the previous constructions to generate the recombinant expression vectors pEDTHI(S32R) and pEDTHII(S32R). All mutations were checked by PCR and confirmed by double-stranded DNA sequencing. DTH expression vectors were introduced by electroporation into E. coliBL21(DE3) cells (Novagen), which do not express the lon andompT proteases (23Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6320) Google Scholar). Fresh cultures inoculated with a 1:100 dilution of a 10–11 h preculture were grown in M9ZB (23Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6320) Google Scholar) plus 100 μg/ml carbenicillin for 3.5 h at 37 °C. Cells were centrifuged and resuspended in the same volume of fresh medium. A 1-liter culture in M9ZB plus 100 μg/ml carbenicillin was inoculated with 10 ml of these cells and grown for 2 h at 37 °C with vigorous shaking until A 600 was equal to 0.4–0.5. To minimize the formation of inclusion bodies, the culture was then transferred at 18 °C with gentle shaking (125 rpm). DTH expression was induced 30 min later by adding isopropyl β-d-thiogalactopyranoside to 1 mm. After overnight (13–14 h) incubation at 18 °C, cells were harvested by centrifugation at 5000 × g for 15 min. Weighted pellets (5.9–6.2 g) were washed once in ice-cold 0.3 msucrose, 0.1 mm EDTA, and 50 mm Tris-HCl, pH 7.5. Cells were then resuspended at 0.15–0.20 g/ml in the same ice-cold buffer supplemented with 0.5 mm dithiothreitol, 5 μm leupeptin, 1 μm pepstatin, 0.5 mm phenylmethylsulfonylfluoride, 0.1 mg/ml lysozyme, and 0.1 mg/ml DNase. Cell lysis was completed by sonication or by using a French press and checked by microscope examination. Insoluble proteins were removed by centrifugation at 27,000 × g for 60 min at 4 °C, and the clear supernatant (bacterial soluble extract) was complemented with glycerol to 10% (v/v) and either stored at −80 °C or used immediately for DTH purification. The procedure used to purify the Drosophila tyrosine hydroxylase isoforms expressed in E. coli was adapted from the method employed by Daubner et al. (19Daubner S.C. Lohse D.L. Fitzpatrick P.F. Protein Sci. 1993; 2: 1452-1460Crossref PubMed Scopus (72) Google Scholar) to purify the recombinant COOH-terminal domain of rat TH. All the enzyme purification steps were carried out at 4 °C. The soluble extract from 6 g of cells expressing either DTH I or DTH II was applied to an XK16 column packed with 16 ml of DEAE-Sepharose Fast Flow (Amersham Pharmacia Biotech) in column buffer (50 mm Tris-HCl, pH 7.5, 10% glycerol (v/v), 0.1 mm EDTA, 0.5 mm dithiothreitol, 0.5 μm leupeptin, 0.1 μm pepstatin). After washing with 40 ml of column buffer at 0.5 ml/min, the bound proteins were eluted by a 60-ml linear gradient of 0–0.675 m KCl in the same buffer. TH activity was assayed, and the fractions corresponding to the peak of enzyme activity at about 0.4 mKCl were pooled. Enzymes were then concentrated and further purified by ammonium sulfate fractionation. Proteins precipitating between 32 and 40% saturation for DTH Type I and between 20 and 32% saturation for DTH Type II were collected. The precipitate was solubilized in 40 ml of column buffer and applied to a Mono-Q HR 5/5 column equilibrated in the same buffer. After washing, the enzyme was eluted by a 30-ml linear gradient of 0–0.85 m KCl at 0.5 ml/min. Fractions containing the highest TH activity were pooled. Protein concentrations were determined using the method of Bradford (25Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (222903) Google Scholar) with bovine serum albumin as a standard. Protein electrophoresis was performed on 10% polyacrylamide gels in the presence of 0.1% SDS-PAGE followed by Coomassie Blue staining. Molecular weights were estimated by comparison with protein standards (Perfect Protein Markers, Novagen). For Western blot experiments, proteins from unstained gels were transferred to a nitrocellulose sheet. The membrane was preincubated for 1 h in 10% nonfat dry milk in TBS (0.1% Tween 20, 500 mm NaCl, 20 mm Tris-HCl, pH 7.4) and then washed three times for 10 min in TBS. Drosophila tyrosine hydroxylase was probed with a 1:5000 dilution of an affinity purified rabbit polyclonal anti-rat TH antibody (Pel-Freez Biologicals) or a 1:1000 dilution of a rat polyclonal antibody to Drosophila TH Type II-specific exons C and D raised in the laboratory of Dr. Jay Hirsh (University of Virginia). The antibodies were preadsorbed on bacterial proteins and incubated with the blot for 1 h at 25 °C. The membrane was washed as above and then incubated for 1 h with a 1:5000 dilution of goat anti-rabbit or anti-rat IgG conjugated with horseradish peroxidase (Jackson ImmunoResearch). Immunoreactive bands were visualized by chemiluminescence with the ECL reagent (Amersham Pharmacia Biotech). To remove bound antibodies, the membrane was blocked in 5% nonfat dry milk in TBS for 10 min, incubated for 30 min at 80 °C in stripping buffer (100 mmβ-mercaptoethanol, 2% SDS, 62.5 mm Tris-HCl, pH 6.8), and washed three times for 10 min at room temperature in TBS. Tyrosine hydroxylase activity was assayed by measuring the enzymatic release of tritium froml-[3,5-3H]tyrosine. For kinetic studies, the standard conditions for the assay were 50 mm K-Hepes, 50 μml-tyrosine, 2.5 μCi/mll-[3,5-3H]tyrosine (50 Ci/mmol, Amersham), 20 μm BH4, 10 μm ferrous ammonium sulfate, 15 mm β-mercaptoethanol, 0.07 mg/ml catalase (Sigma), with 0.1–0.5 μg of purified DTH at pH 7.0 in a volume of 0.1 ml. After a 2–3-min equilibration of the mixture at the assay temperature (25 or 29 °C), the reaction was started by the addition of BH4. Assays were stopped by the addition of 1 ml of 7.5% activated charcoal (Darco G60, Fluka) suspension in 1 N HCl as described by Reinhard et al. (26Reinhard Jr., J.F. Smith G.K. Nichol C.A. Life Sci. 1986; 39: 2185-2189Crossref PubMed Scopus (204) Google Scholar). The charcoal was sedimented, and an aliquot (100 μl) of the supernatant containing the tritiated water was mixed with 4 ml of Ready Safe scintillant (Beckman). Controls were obtained without BH4. To stay under initial velocity conditions, reactions were quenched after 2 min, and the amount of enzyme assayed was kept below 0.5 unit. One unit of enzyme produces 1 μmol of ortho-diphenoll-dihydroxyphenylalanine/min at 25 °C. Under these conditions, assays were linear with time and with the amount of enzyme. Linearity was not conserved with larger amounts of enzyme and longer reaction times (15 min) probably because of O2 consumption. Stocks of ferrous ammonium sulfate were stored in aliquots at −20 °C and not reused after thawing (27Fitzpatrick P.F. Biochem. Biophys. Res. Commun. 1989; 161: 211-215Crossref PubMed Scopus (62) Google Scholar). Michaelis-Menten constants were determined from Lineweaver-Burk curves analyzed by the least squares curve fitting method with the MacCurveFit software (Kevin Raner). To determine the pH dependence of DTH activity, the assay buffer K-Hepes was replaced by a constant ionic strength buffer (50 mm sodium acetate, 50 mm Mes, 100 mm Tris-HCl) (28Ellis K.J. Morrison J.F. Methods Enzymol. 1982; 87: 405-426Crossref PubMed Scopus (662) Google Scholar, 29Fitzpatrick P.F. J. Biol. Chem. 1988; 263: 16058-16062Abstract Full Text PDF PubMed Google Scholar). To determine the effect of dopamine on enzyme activity, DTH was pre-incubated with dopamine for 5 min at 25 °C in the assay mixture before the reaction was started. Most experiments were conducted in parallel for the two isoforms to compare DTH activity and regulation in closely similar conditions. All data are the mean of duplicate or triplicate determinations. Recombinant DTH isoforms were phosphorylated by the catalytic subunit of PKA. Either the purified isoforms or the soluble extracts from DTH-expressing E. coli cells were used. The conditions of phosphorylation were 5–15 min at 30 °C in 25 mm Hepes, pH 7.0, 10 mmMgCl2, 2 mm ATP, 2.5 mm spermidine, 0.5 mm EDTA, 0.5 mm EGTA, 0.025 units/μl PKA catalytic subunit (New England Biolabs) in a volume of 25 μl. Nonphosphorylated controls were made without PKA. TH activity was then immediately assayed as described above. Alternatively, DTH isoforms were phosphorylated in the presence of 0.02 mm ATP and 0.4 mCi/ml [γ-32P]ATP (NEN Life Science Products). After 5 min at 30 °C, the reactions were stopped by 1 volume of SDS sample buffer and a 2-min heating at 90 °C. Proteins were separated on 10% SDS-PAGE, and the gels were dried and exposed for autoradiography. The predicted structure of the two Drosophilatyrosine hydroxylase isoforms is presented in Fig.1. The positions of the regulatory and catalytic domains are deduced from corresponding sequences in the vertebrate TH protein (17Ledley F.D. DiLella A.G. Kwok S.C.M. Woo S.L.C. Biochemistry. 1985; 24: 3389-3394Crossref PubMed Scopus (101) Google Scholar, 18Abate C. Smith J.A. Joh T.H. Biochem. Biophys. Res. Commun. 1988; 151: 1446-1453Crossref PubMed Scopus (37) Google Scholar, 19Daubner S.C. Lohse D.L. Fitzpatrick P.F. Protein Sci. 1993; 2: 1452-1460Crossref PubMed Scopus (72) Google Scholar, 20Ribeiro P. Wang Y.H. Citron B.A. Kaufman S. J. Mol. Neurosci. 1993; 4: 125-139Crossref PubMed Scopus (33) Google Scholar, 21Walker S.J. Liu X. Roskoski R. Vrana K.E. Biochim. Biophys. Acta. 1994; 1206: 113-119Crossref PubMed Scopus (31) Google Scholar). The two Drosophila enzymes only differ by the insertion of an acidic 71-amino acid segment in the regulatory domain of DTH II. Enzymatic and regulatory properties of both DTH enzymes were analyzed in controlled conditions after expression in E. coliBL21(DE3) cells (23Studier F.W. Rosenberg A.H. Dunn J.J. Dubendorff J.W. Methods Enzymol. 1990; 185: 60-89Crossref PubMed Scopus (6320) Google Scholar) and purification. The prokaryotic expression system has been used previously to express and characterize several TH isoforms from human and rat (21Walker S.J. Liu X. Roskoski R. Vrana K.E. Biochim. Biophys. Acta. 1994; 1206: 113-119Crossref PubMed Scopus (31) Google Scholar, 30Le Bourdellès B. Horellou P. Le Caer J.-P. Denèfle P. Latta M. Haavik J. Guibert B. Mayaux J.-F. Mallet J. J. Biol. Chem. 1991; 266: 17124-17130Abstract Full Text PDF PubMed Google Scholar, 31Ribeiro P. Wang Y. Citron B.A. Kaufman S. Proc. Natl Acad. Sci. U. S. A. 1992; 89: 9593-9597Crossref PubMed Scopus (47) Google Scholar, 32Daubner S.C. Lauriano C. Haycock J.W. Fitzpatrick P.F. J. Biol. Chem. 1992; 267: 12639-12646Abstract Full Text PDF PubMed Google Scholar, 33Alterio J. Ravassard P. Haavik J. Le Caer J.P. Biguet N.F. Waksman G. Mallet J. J. Biol. Chem. 1998; 273: 10196-10201Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). As an advantage, the TH protein produced in bacteria is essentially an unphosphorylated apoenzyme that contains a very low amount of bound iron (34Haavik J. Le Bourdelles B. Martinez A. Flatmark T. Mallet J. Eur. J. Biochem. 1991; 199: 371-378Crossref PubMed Scopus (101) Google Scholar) and no catecholamines. It is thus best suited to study the effect of phosphorylation and modulators on enzymatic activity. In cells transformed with the recombinant expression vectors pEDTHI and pEDTHII (see “Experimental Procedures”), the addition of isopropyl β-d-thiogalactopyranoside induced an efficient biosynthesis of DTH I and DTH II proteins, which migrated with an apparent molecular mass of 58 and 79 kDa, respectively, on SDS-PAGE (Fig. 2 A). For DTH I, this estimation is in agreement with the molecular mass predicted from the coding sequence of the cDNA (57,862 Da). In contrast, the apparent molecular mass of DTH II was higher than expected, because the sequence predicts a protein of 65,996 Da. A minor band at 62 kDa is also detected specifically in the DTH II-expressing cells after induction; it is probably a degradation product. Treatment with a high salt or alkaline pH before electrophoresis did not modify the migration of DTH II (not shown), suggesting that this aberrant migration is not because of protein interactions. Such an anomalous mobility in SDS gels is not unusual with very hydrophilic proteins. The acidic segment in the regulatory domain of DTH II may prevent regular binding of SDS molecules and thus delay migration of the protein. The nature of the recombinant proteins synthesized in E. coli was further checked on Western blots probed with an affinity-purified antibody to rat TH and an antibody raised to the specific acidic domain of DTH II. Fig. 2 B (left panel) shows that both induced peptides are recognized by the antibody to rat TH, confirming that these molecules are TH proteins. In addition, the antibody to DTH II recognizes, as expected, the larger protein only (Fig. 2 B, right panel). A band migrating at the same apparent molecular weight was detected with this antibody on a Western blot of proteins extracted fromDrosophila heads (not shown), demonstrating that the native and recombinant DTH II proteins migrate identically on SDS-PAGE. We found that DTH expression has to be induced at a low temperature (18 °C) to recover soluble and active proteins. For both isoforms, a tyrosine hydroxylase enzymatic activity was detected in the bacterial soluble extract from the induced cells, which was strictly dependent on the presence of iron and a reduced pteridine co-substrate in the assay mixture. No TH enzymes (Fig. 2 B, lanes ø) or TH activity were detected in control cells transformed with the nonrecombinant vector pET-11a. Purification of DTH isoforms was carried out by ion exchange fractionation and ammonium sulfate precipitation followed by Mono-Q fractionation. The final fractions obtained were considerably enriched (Fig. 2 C), although the enzymes were not purified to homogeneity. We estimated that TH activity was enriched approximately 11-fold for DTH I and 15-fold for DTH II in the purified fractions as compared with the bacterial soluble extracts (TableI).Table IPurification of the recombinant Drosophila TH isoformsEnzymeFractionTotal proteinTotal activityaTH activity was determined in standard conditions at 25 °C.Specific activitymgnmol dopa/minnmol dopa/ min/mg proteinDTH IbFrom 6 g of cells.Cell lysate4406,86515.6Mono-Q9.61,586165.2DTH IIbFrom 6 g of cells.Cell lysate45211,56625.6Mono-Q7.52,882384.3a TH activity was determined in standard conditions at 25 °C.b From 6 g of cells. Open table in a new tab Kinetic analysis of DTH enzymatic activity was performed on these purified fractions. Both Drosophila TH isoforms showed a similar temperature dependence; enzymatic activity is highest at 25–29 °C and is reduced to about 30% of the optimum at 37 °C (not shown). Therefore reactions were conducted at 25 °C, which is the regular environmental temperature for Drosophila. Conditions were determined (see “Experimental Procedures”) in which the rate of tyrosine hydroxylation is linear with time and enzyme quantity (Fig. 3). In these conditions, the specific activity of purified DTH II was found to be about twice the specific activity of purified DTH I (Table I). The Michaelis constants of the DTH enzymes for l-tyrosine and the co-substrate BH4 are presented in TableII. The two isoforms differ in theirK m value for BH4, which was found to be reproducibly 1.5-fold lower for DTH II. BH4 has an inhibitory effect on DTH I and II activities but at higher levels (400 μm and above) (not shown). The kinetic data obtained for the recombinant Drosophila enzymes are comparable to the values obtained for vertebrate TH expressed in E. coli (32Daubner S.C. Lauriano C. Haycock J.W. Fitzpatrick P.F. J. Biol. Chem. 1992; 267: 12639-12646Abstract Full Text PDF PubMed Google Scholar,33Alterio J. Ravassard P. Haavik J. Le Caer J.P. Biguet N.F. Waksman G. Mallet J. J. Biol. Chem. 1998; 273: 10196-10201Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar).Table IIApparent Michaelis constants of recombinant Drosophila TH isoformsK mBH4aDetermined at 50 μm tyrosine, 6–90 μm BH4.TyrbDetermined at 20 μm BH4, 20–150 μm l-tyrosine.μmDTH I22.7cThe difference between the K m values for BH4 is statistically significant (p < 0.025, as determined by the independent Student's t test). ± 3.448.5 ± 11.8DTH II14.8cThe difference between the K m values for BH4 is statistically significant (p < 0.025, as determined by the independent Student's t test). ± 2.256.4 ± 7.4Results represent the mean ± S.E. of four independent determinations under standard conditions (pH 7 and 25 °C).a Determined at 50 μm tyrosine, 6–90 μm BH4.b Determined at 20 μm BH4, 20–150 μm l-tyrosine.c The difference between the K m values for BH4 is statistically significant (p < 0.025, as determined by the independent Student's t test). Open table in a new tab Results represent the mean ± S.E. of four independent determinations under standard conditions (pH 7 and 25 °C). Ano
Referência(s)