Portal de Periódicos da CAPES

A Mutation in Yeast TOP2 Homologous to a Quinolone-resistant Mutation in Bacteria

1995; Elsevier BV; Volume: 270; Issue: 35 Linguagem: Inglês

10.1074/jbc.270.35.20359

1083-351X

Yuchu Hsiung, Sarah H. Elsea, Neil Osheroff, John L. Nitiss,

Plant Disease Resistance and Genetics

In prokaryotic type II topoisomerases (DNA gyrases), mutations that result in resistance to quinolones frequently occur at Ser83 or Ser83 of the gyrA subunit. Mutations to Trp, Ala, and Leu have been identified, all of which confer high levels of quinolone resistance. Extensive segments of DNA gyrase are homologous to eukaryotic topoisomerase II, and Ser741 of yeast TOP2 is homologous to Ser83 of prokaryotic DNA gyrA. Introduction of the Ser741→ Trp mutation into yeast TOP2 confers resistance to 6,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acid (CP-115,953), a fluoroquinolone with substantial activity against eukaryotic topoisomerase II, whereas changing Ser741 to either Leu or Ala does not change sensitivity to quinolones. Interestingly, Ser741→ Trp in the yeast TOP2 also confers hypersensitivity to etoposide. Sensitivity to intercalating anti-topoisomerase II agents such as amsacrine is not changed by any of the three mutations. The topoisomerase II protein carrying the Ser741→ Trp mutation was overexpressed and purified. The purified mutant enzyme had enhanced levels of etoposide stabilized covalent complex as compared with the wild type enzyme and reduced cleavage with CP-115,953. Unlike the wild type enzyme, etoposide-stabilized cleavage is not readily reversible by heat. We suggest that Ser741 is near a binding site for both quinolones and etoposide and that the Ser741→ Trp mutation leads to a more stable ternary complex between etoposide, DNA, and the mutant enzyme. In prokaryotic type II topoisomerases (DNA gyrases), mutations that result in resistance to quinolones frequently occur at Ser83 or Ser83 of the gyrA subunit. Mutations to Trp, Ala, and Leu have been identified, all of which confer high levels of quinolone resistance. Extensive segments of DNA gyrase are homologous to eukaryotic topoisomerase II, and Ser741 of yeast TOP2 is homologous to Ser83 of prokaryotic DNA gyrA. Introduction of the Ser741→ Trp mutation into yeast TOP2 confers resistance to 6,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acid (CP-115,953), a fluoroquinolone with substantial activity against eukaryotic topoisomerase II, whereas changing Ser741 to either Leu or Ala does not change sensitivity to quinolones. Interestingly, Ser741→ Trp in the yeast TOP2 also confers hypersensitivity to etoposide. Sensitivity to intercalating anti-topoisomerase II agents such as amsacrine is not changed by any of the three mutations. The topoisomerase II protein carrying the Ser741→ Trp mutation was overexpressed and purified. The purified mutant enzyme had enhanced levels of etoposide stabilized covalent complex as compared with the wild type enzyme and reduced cleavage with CP-115,953. Unlike the wild type enzyme, etoposide-stabilized cleavage is not readily reversible by heat. We suggest that Ser741 is near a binding site for both quinolones and etoposide and that the Ser741→ Trp mutation leads to a more stable ternary complex between etoposide, DNA, and the mutant enzyme. INTRODUCTIONDNA topoisomerases play essential roles in a wide range of DNA metabolic processes(1Cozzarelli N.C. Wang J.C. DNA Topology and Its Biological Effects. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1990Google Scholar). Studies in both prokaryotic and eukaryotic cells have demonstrated their importance in transcription, DNA replication, and chromosome segregation(2Wang J.C. Biochim. Biophys. Acta. 1987; 909: 1-9Crossref PubMed Scopus (300) Google Scholar). The type II topoisomerases, which make transient double strand breaks and change the linking number of DNA in steps of two, play key roles in chromosome structure. In eukaryotic cells, these enzymes are essential for the chromosome condensation/decondensation process critical for the normal progression through mitosis(3Holm C. Goto T. Wang J.C. Botstein D. Cell. 1985; 41: 553-563Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 4Uemura T. Ohkura H. Adachi Y. Morino K. Shiozaki K. Yanagida M. Cell. 1987; 50: 917-925Abstract Full Text PDF PubMed Scopus (572) Google Scholar). The ability of the enzyme to pass two DNA strands and change linking number in steps of two uniquely allows this class of enzyme to segregate fully replicated DNA molecules prior to cell division (reviewed in (5Nitiss J.L. Adv. Pharmacol. 1994; 29A: 103-134Crossref PubMed Scopus (49) Google Scholar) and (6Holm C. Cell. 1994; 77: 955-957Abstract Full Text PDF PubMed Scopus (92) Google Scholar)).Type II topoisomerases have also been identified as a major target of chemotherapeutic agents that are specifically active against prokaryotic cells (7Neu H.C. Adv. Pharmacol. 1994; 29A: 227-262Crossref PubMed Scopus (17) Google Scholar) or against rapidly proliferating cancer cells (8D'Arpa P. Liu L.F. Biochim. Biophys. Acta. 1989; 989: 163-177PubMed Google Scholar). Fluoroquinolone antibiotics, such as norfloxacin and ciprofloxacin, along with their less active congeners nalidixic and oxolinic acid are antibacterial agents that target DNA gyrase(9Drlica K. Franco R.J. Biochemistry. 1988; 27: 2253-2259Crossref PubMed Scopus (270) Google Scholar), whereas a variety of DNA-intercalating agents such as anilinoacridines, ellipticines, and mitoxantrone and nonintercalating agents such as epipodophyllotoxins are active against eukaryotic topoisomerase II and are clinically important anti-cancer agents(10Liu L.F. Annu. Rev. Biochem. 1989; 58: 351-375Crossref PubMed Scopus (1913) Google Scholar, 11Beck W.T. Danks M.K. Semin. Cancer Biol. 1991; 2: 235-244PubMed Google Scholar).Recently, it has been shown that 6,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acid (CP-115,953), 1The abbreviations used are: CP-115,9536,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acidYPDAyeast extract/peptone/dextrose/adenine mediumSC-URAsynthetic complete medium minus uracil. a fluoroquinolone closely related to ciprofloxacin, is highly toxic to mammalian cells in culture and active against topoisomerase II in vitro(12Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Moynihan M. Sutcliffe J.A. Osheroff N. J. Biol. Chem. 1991; 266: 14585-14592Abstract Full Text PDF PubMed Google Scholar, 13Elsea S.H. McGuirk P.R. Gootz T.D. Moynihan M. Osheroff N. Antimicrob. Agents Chemother. 1993; 37: 2179-2186Crossref PubMed Scopus (62) Google Scholar, 14Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Osheroff N. Antimicrob. Agents Chemother. 1992; 36: 751-756Crossref PubMed Scopus (96) Google Scholar). Genetic studies in yeast demonstrated that topoisomerase II is the primary physiological target for quinolone cytotoxicity(15Elsea S.H. Osheroff N. Nitiss J.L. J. Biol. Chem. 1992; 267: 13150-13153Abstract Full Text PDF PubMed Google Scholar). Unlike etoposide, which stabilizes cleavage mainly by inhibiting the religation reaction of topoisomerase II, CP-115,953 stabilizes cleavage by enhancing the forward rate of cleavage(12Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Moynihan M. Sutcliffe J.A. Osheroff N. J. Biol. Chem. 1991; 266: 14585-14592Abstract Full Text PDF PubMed Google Scholar). Therefore, fluoroquinolones are nonintercalating anti-topoisomerase II agents with a different biochemical mechanism of action than etoposide. Although the action of quinolone-based drugs differs from agents such as etoposide, the ultimate mechanism of cell-killing, enhanced levels of the covalent complex is the same(15Elsea S.H. Osheroff N. Nitiss J.L. J. Biol. Chem. 1992; 267: 13150-13153Abstract Full Text PDF PubMed Google Scholar, 16Osheroff N. Corbett A. Chem. Res. Toxicol. 1993; 6: 585-597Crossref PubMed Scopus (220) Google Scholar).In Escherichia coli, mutations that lead to quinolone resistance are most often found in gyrA, the structural gene for the DNA gyrase A subunit, although changes that lead to quinolone resistance have also been found in the gyrB subunit. Ser83 of gyrA is the amino acid most frequently mutated in strains with high levels of quinolone resistance(17Reece R.J. Maxwell A. Crit. Rev. Biochem. Mol. Biol. 1991; 26: 335-375Crossref PubMed Scopus (544) Google Scholar). Among the substitutions noted in quinolone-resistant mutants are mutations of Ser83 to Ala, Leu, or Trp, with higher levels of resistance in strains carrying Ser83→ Trp or Ser83→ Leu mutations. It has recently been reported that gyrase protein with the Ser83→ Trp mutation in gyrA has greatly reduced binding of ciprofloxacin compared with the wild type protein, further demonstrating the importance of this region of the protein(18Willmott C.J. Maxwell A. Antimicrob. Agents Chemother. 1993; 37: 126-127Crossref PubMed Scopus (206) Google Scholar).These findings have led us to examine the effects of mutations in the yeast TOP2 gene that change Ser741, the amino acid that is homologous to Ser83 in gyrA of E. coli, on the yeast type II enzyme for sensitivity to quinolones as well as other topoisomerase II inhibitors. We have found that the Ser741→ Trp mutation results in resistance to quinolones that act against eukaryotic topoisomerase II. In addition, this mutation causes hypersensitivity to etoposide. Overexpression, purification, and characterization of yeast topoisomerase II carrying the Ser741→ Trp demonstrated that the protein is relatively insensitive to fluoroquinolones and is hypersensitive to etoposide. Our results demonstrate that Ser741 of yeast TOP2 plays a critical role in the action of some anti-topoisomerase II agents and may be directly involved in the interactions of the eukaryotic enzyme with etoposide.MATERIALS AND METHODSYeast StrainsThe yeast strains used to examine drug sensitivity were all derived from JN362a (a ura3-52 leu2 trp1 his7 ade1-2 ISE2). Isogenic derivatives of JN362a carrying TOP2 mutations were constructed as described previously(19Liu X.-Y. Hsiung Y. Jannatipour M. Yeh Y. Nitiss J.L. Cancer Res. 1994; 54: 2943-2951PubMed Google Scholar). Briefly, the strain was transformed with Asp718-digested pMJ2 carrying mutations constructed by oligonucleotide directed mutagenesis, and the transformants were selected on SC-URA medium(20Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1979Google Scholar). pMJ2 carries the 3′ portion of the yeast TOP2 gene (4.1-kilobase BglII/BglII fragment) in a yeast integrating plasmid, which has the yeast URA3 gene as a selectable marker. Strains carrying mutations of Ser741→ Trp, Ser741→ Leu, and Ser741→ Ala were constructed. The strains carrying top2 mutations were then converted to rad52- by one-step gene disruption using pSM20, which carries a LEU2 disruption of the RAD52 gene(21Schild D.B. Konforti B. Perez C. Gish W. Mortimer R.K. Curr. Genet. 1983; 7: 85-92Crossref PubMed Scopus (38) Google Scholar). All yeast transformations were carried out using the modified lithium acetate protocol of Schiestl and Gietz(22Schiestl R.H. Gietz R.D. Curr. Genet. 1989; 16: 339-346Crossref PubMed Scopus (1766) Google Scholar).PlasmidsThe plasmid pMJ2 has been previously described (19Liu X.-Y. Hsiung Y. Jannatipour M. Yeh Y. Nitiss J.L. Cancer Res. 1994; 54: 2943-2951PubMed Google Scholar). Point mutations were constructed in pMJ2 using the method of Kunkel et al.(23Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4543) Google Scholar) with the Muta-Gene kit (Bio-Rad) following the supplier's instructions. E. coli strain DH5α was used for propagation of plasmids. The mutations at Ser741 of the yeast TOP2 gene were constructed in pMJ2 using the following mutagenic oligonucleotides: GGTGAGCAGTGGTTGGCACAA for Ser741→ Trp, GGTGAGCAGGCGTTGGCACAA for Ser741 [arrow] Ala, and GGTGAGCAGCTGTTGGCACAA for Ser741→ Leu. The bold letters indicate the changes from the wild type yeast TOP2 sequence(24Giaever G. Lynn R. Goto T. Wang J.C. J. Biol. Chem. 1986; 261: 12448-12454Abstract Full Text PDF PubMed Google Scholar). All mutations were verified by DNA sequencing.In order to construct a plasmid for overexpressing the Ser741→ Trp mutant topoisomerase II, plasmid pMJ2-S∗W and YEpTOP2-PGAL1 (25Worland S. Wang J.C. J. Biol. Chem. 1989; 264: 4412-4416Abstract Full Text PDF PubMed Google Scholar) were digested with KpnI and AvrII. The 2.2-kilobase fragment from pMJ2-S∗W and the 11.5-kilobase fragment from YEpTOP2-PGAL1 were gel purified, ligated, and transformed into E. coli DH5α competent cells. Plasmids that had an identical restriction pattern to YEpTOP2-PGAL1 were identified, and the presence of the Ser741→ Trp mutation in YEpTOP2-PGAL1 was confirmed by DNA sequencing. The plasmid carrying the mutation was designated YEptop2-S∗W-PGAL1.Measurements of Drug Sensitivity in YeastEtoposide was obtained from Sigma, amsacrine was a gift from Dr. Steve Member of Bristol Myer Laboratories, and CP-115,953 was the gift of Drs. P. R. McGuirk and T. D. Gootz of Pfizer Laboratories. Etoposide and amsacrine were dissolved in dimethyl sulfoxide, and CP-115,953 was dissolved as a 25 mM solution in 0.1 N NaOH and diluted to a 5 mM stock with 10 mM Tris-HCl, pH 8.0. All drugs were stored at −80°C in dark. Drug sensitivity measurements were carried out as described previously(19Liu X.-Y. Hsiung Y. Jannatipour M. Yeh Y. Nitiss J.L. Cancer Res. 1994; 54: 2943-2951PubMed Google Scholar). Briefly, cells growing in yeast extract/peptone/dextrose/adenine (YPDA) medium at were adjusted to 2 × 106 cells/ml. Drugs or drug solvent was added, and aliquots of samples were removed at the indicated times, diluted, and plated to YPDA medium solidified with 1.6% agar. The minimum lethal concentrations shown in Table 1were determined by examining drug sensitivity as described above and determining the drug concentration required to reduce viability below 100% (i.e. the number of viable cells at T = 0) at 8 and 24 h. Drug concentrations from 1 to 100 μg/ml (or 1-50 μM for CP-115,953) were examined. We also determined IC50 concentrations by growing the cells to stationary phase in the presence of various drug concentrations and then plating dilutions to YPDA plates. The IC50 is the drug concentration that reduces the number of colonies by 50% compared with cells grown to stationary phase in the absence of drug.Tabled 1 Open table in a new tab Overexpression and Purification of Yeast Topoisomerase IIWild type yeast TOP2 and Ser741→ Trp proteins were overexpressed using YEpTOP2-PGAL1 or YEptop2-S∗W-PGAL1 using yeast strain JEL1 (26Lindsley J.E. Wang J.C. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 10485-10489Crossref PubMed Scopus (117) Google Scholar) and purified to homogeneity by a modification of the procedure of Worland and Wang(25Worland S. Wang J.C. J. Biol. Chem. 1989; 264: 4412-4416Abstract Full Text PDF PubMed Google Scholar). The detailed procedure has been described elsewhere(27Elsea S.H. Hsiung Y. Nitiss J.L. Osheroff N. J. Biol. Chem. 1995; 270: 1913-1920Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). Topoisomerase II reactions were carried out as described previously using either supercoiled pBR322 to monitor ATPdependent relaxation or kinetoplast DNA isolated from Crithidia fasiculata to monitor decatenation(19Liu X.-Y. Hsiung Y. Jannatipour M. Yeh Y. Nitiss J.L. Cancer Res. 1994; 54: 2943-2951PubMed Google Scholar, 27Elsea S.H. Hsiung Y. Nitiss J.L. Osheroff N. J. Biol. Chem. 1995; 270: 1913-1920Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar).Quantitation of Drug-stabilized CleavageQuantitation of DNA cleavage was determined using a modified version of the K+/SDS method(28Jannatipour M. Liu Y.-X. Nitiss J.L. J. Biol. Chem. 1993; 268: 18586-18592Abstract Full Text PDF PubMed Google Scholar). The substrate was pUC18 DNA that was end-labeled by filling in the EcoRI-digested plasmid with α-32P-labeled dATP using the Klenow fragment of E. coli DNA polymerase I. The specific activity of the labeled DNA was typically 1-3 × 106 cpm/μg of DNA, and 5-10 × 105 cpm were added per reaction. The amount of drug-stabilized cleavage was determined in triplicate for each drug concentration. Each cleavage reaction contained 8 units (80 ng) of topoisomerase II. Independent determination of cleavage with the same batch of labeled substrate showed levels of cleavage with a standard error of no more than 10%.DISCUSSIONAcquired drug resistance by mutation of the drug target likely represents a contributor to the failure of drug treatment for both antibacterial and anti-cancer drugs. This has been clearly demonstrated with quinolone antibiotics, where mutations in the structural genes of bacterial DNA gyrase are frequently observed in quinolone-resistant clinical isolates(7Neu H.C. Adv. Pharmacol. 1994; 29A: 227-262Crossref PubMed Scopus (17) Google Scholar). In this report, we have demonstrated that mutations in yeast TOP2 at a position homologous to Ser83 of gyrA gives rise to fluoroquinolone resistance. The same mutation also generates hypersensitivity to another class of drugs, epipodophyllotoxins. Our results suggest that in some contexts, it may be possible to overcome acquired drug resistance due to a mutation in the drug target by use of a different class of drugs that act against the same target.We constructed several changes at Ser741 in the yeast TOP2 gene of Saccharomyces cerevisiae and have demonstrated that mutation of Ser741→ Trp of yeast topoisomerase II confers hypersensitivity to etoposide and resistance to quinolone CP-115,953 in vivo. In agreement with the in vivo results, the Ser741→ Trp protein has increased drug-stabilized cleavage in response to etoposide and decreased drug stabilized cleavage when treated with the fluoroquinolone CP-115,953. The results of Maxwell and Willmott strongly suggest that Ser83 of gyrA is critical for the binding of quinolones to gyrase(18Willmott C.J. Maxwell A. Antimicrob. Agents Chemother. 1993; 37: 126-127Crossref PubMed Scopus (206) Google Scholar). We reasoned that the homology between gyrase and eukaryotic topoisomerases (32Lynn R. Giaever G. Goto T. Wang J.C. Science. 1986; 233: 647-649Crossref PubMed Scopus (102) Google Scholar) suggested that the equivalent amino acid would be important, at least for the action of fluoroquinolones that have activity against eukaryotic topoisomerase II. However, the homology between yeast TOP2 and gyrA does not result in a perfect correspondence in sensitivity to fluoroquinolones. Most notably, the Ser741→ Leu mutant is not resistant to CP-115,953, nor is it etoposide-hypersensitive. By contrast, a Ser83→ Leu mutation in gyrA results in almost the same level of quinolone resistance as Ser83→ Trp.Although there are likely to be several ways that alterations in TOP2 lead to a drug-resistant protein, it would seem that there are only a limited number of ways where mutations could generate drug hypersensitivity. Because the Ser741→ Trp protein has essentially wild type activity and because the drug hypersensitivity is specific for epipodophyllotoxins (i.e. sensitivity to intercalating drugs is not affected by the mutant protein), the simplest explanation is that the protein's affinity for epipodophyllotoxins is affected. The increased stability of the etoposide-stabilized covalent complex at 65°C also supports the hypothesis that the drug hypersensitivity is due to a more stable interaction between the mutant TOP2 protein and etoposide. The nature of the covalent interaction is unlikely to be qualitatively different with the Ser741→ Trp protein because the covalent complex formed in the absence of drug or in the presence of CP-115,953 is fully heat-reversible. Because gyrA protein carrying a Ser83→ Trp mutation has reduced fluoroquinolone binding(17Reece R.J. Maxwell A. Crit. Rev. Biochem. Mol. Biol. 1991; 26: 335-375Crossref PubMed Scopus (544) Google Scholar, 18Willmott C.J. Maxwell A. Antimicrob. Agents Chemother. 1993; 37: 126-127Crossref PubMed Scopus (206) Google Scholar), Ser83 either is part of a domain of gyrase that binds to quinolones or is fairly close to the quinolone binding site. Our results would suggest that the domain including Ser741 in yeast TOP2 interacts with both fluoroquinolones and epipodophyllotoxins. This result is consistent with recently reported results that suggest that fluoroquinolones and etoposide can compete for binding to topoisomerase II(33Corbett A.H. Hong D. Osheroff N. J. Biol. Chem. 1993; 268: 14394-14398Abstract Full Text PDF PubMed Google Scholar). A simple interpretation is that the two agents share (at least in part) the domain required for drug/protein interactions. Our results suggest that Ser741 may be a key part of that domain. Drug binding assays with eukaryotic topoisomerase II have yet to be reported, however, so we have not been able to directly demonstrate the roles of specific domains in interaction with etoposide or other topoisomerase II agents.It should be possible to design etoposide derivatives that generate covalent complexes that behave like the TOP2 Ser741→ Trp-etoposide-DNA complexes with the wild type protein. Because other agents such as clerocidin have been described that can generate heat stable complexes(34Kawada S. Yamashita Y. Fujii N. Nakano H. Cancer Res. 1991; 51: 2922-2925PubMed Google Scholar), we suggest that such agents have a high enough affinity for topoisomerase II such that at 65°C the covalent complex is still favored. It will be of considerable interest to determine whether agents that form such stable cleavage complexes might result in more effective antibacterial or anti-cancer agents. INTRODUCTIONDNA topoisomerases play essential roles in a wide range of DNA metabolic processes(1Cozzarelli N.C. Wang J.C. DNA Topology and Its Biological Effects. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1990Google Scholar). Studies in both prokaryotic and eukaryotic cells have demonstrated their importance in transcription, DNA replication, and chromosome segregation(2Wang J.C. Biochim. Biophys. Acta. 1987; 909: 1-9Crossref PubMed Scopus (300) Google Scholar). The type II topoisomerases, which make transient double strand breaks and change the linking number of DNA in steps of two, play key roles in chromosome structure. In eukaryotic cells, these enzymes are essential for the chromosome condensation/decondensation process critical for the normal progression through mitosis(3Holm C. Goto T. Wang J.C. Botstein D. Cell. 1985; 41: 553-563Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 4Uemura T. Ohkura H. Adachi Y. Morino K. Shiozaki K. Yanagida M. Cell. 1987; 50: 917-925Abstract Full Text PDF PubMed Scopus (572) Google Scholar). The ability of the enzyme to pass two DNA strands and change linking number in steps of two uniquely allows this class of enzyme to segregate fully replicated DNA molecules prior to cell division (reviewed in (5Nitiss J.L. Adv. Pharmacol. 1994; 29A: 103-134Crossref PubMed Scopus (49) Google Scholar) and (6Holm C. Cell. 1994; 77: 955-957Abstract Full Text PDF PubMed Scopus (92) Google Scholar)).Type II topoisomerases have also been identified as a major target of chemotherapeutic agents that are specifically active against prokaryotic cells (7Neu H.C. Adv. Pharmacol. 1994; 29A: 227-262Crossref PubMed Scopus (17) Google Scholar) or against rapidly proliferating cancer cells (8D'Arpa P. Liu L.F. Biochim. Biophys. Acta. 1989; 989: 163-177PubMed Google Scholar). Fluoroquinolone antibiotics, such as norfloxacin and ciprofloxacin, along with their less active congeners nalidixic and oxolinic acid are antibacterial agents that target DNA gyrase(9Drlica K. Franco R.J. Biochemistry. 1988; 27: 2253-2259Crossref PubMed Scopus (270) Google Scholar), whereas a variety of DNA-intercalating agents such as anilinoacridines, ellipticines, and mitoxantrone and nonintercalating agents such as epipodophyllotoxins are active against eukaryotic topoisomerase II and are clinically important anti-cancer agents(10Liu L.F. Annu. Rev. Biochem. 1989; 58: 351-375Crossref PubMed Scopus (1913) Google Scholar, 11Beck W.T. Danks M.K. Semin. Cancer Biol. 1991; 2: 235-244PubMed Google Scholar).Recently, it has been shown that 6,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acid (CP-115,953), 1The abbreviations used are: CP-115,9536,8-difluoro-7-(4′-hydroxyphenyl)-1-cyclopropyl-4-quinolone-3-carboxylic acidYPDAyeast extract/peptone/dextrose/adenine mediumSC-URAsynthetic complete medium minus uracil. a fluoroquinolone closely related to ciprofloxacin, is highly toxic to mammalian cells in culture and active against topoisomerase II in vitro(12Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Moynihan M. Sutcliffe J.A. Osheroff N. J. Biol. Chem. 1991; 266: 14585-14592Abstract Full Text PDF PubMed Google Scholar, 13Elsea S.H. McGuirk P.R. Gootz T.D. Moynihan M. Osheroff N. Antimicrob. Agents Chemother. 1993; 37: 2179-2186Crossref PubMed Scopus (62) Google Scholar, 14Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Osheroff N. Antimicrob. Agents Chemother. 1992; 36: 751-756Crossref PubMed Scopus (96) Google Scholar). Genetic studies in yeast demonstrated that topoisomerase II is the primary physiological target for quinolone cytotoxicity(15Elsea S.H. Osheroff N. Nitiss J.L. J. Biol. Chem. 1992; 267: 13150-13153Abstract Full Text PDF PubMed Google Scholar). Unlike etoposide, which stabilizes cleavage mainly by inhibiting the religation reaction of topoisomerase II, CP-115,953 stabilizes cleavage by enhancing the forward rate of cleavage(12Robinson M.J. Martin B.A. Gootz T.D. McGuirk P.R. Moynihan M. Sutcliffe J.A. Osheroff N. J. Biol. Chem. 1991; 266: 14585-14592Abstract Full Text PDF PubMed Google Scholar). Therefore, fluoroquinolones are nonintercalating anti-topoisomerase II agents with a different biochemical mechanism of action than etoposide. Although the action of quinolone-based drugs differs from agents such as etoposide, the ultimate mechanism of cell-killing, enhanced levels of the covalent complex is the same(15Elsea S.H. Osheroff N. Nitiss J.L. J. Biol. Chem. 1992; 267: 13150-13153Abstract Full Text PDF PubMed Google Scholar, 16Osheroff N. Corbett A. Chem. Res. Toxicol. 1993; 6: 585-597Crossref PubMed Scopus (220) Google Scholar).In Escherichia coli, mutations that lead to quinolone resistance are most often found in gyrA, the structural gene for the DNA gyrase A subunit, although changes that lead to quinolone resistance have also been found in the gyrB subunit. Ser83 of gyrA is the amino acid most frequently mutated in strains with high levels of quinolone resistance(17Reece R.J. Maxwell A. Crit. Rev. Biochem. Mol. Biol. 1991; 26: 335-375Crossref PubMed Scopus (544) Google Scholar). Among the substitutions noted in quinolone-resistant mutants are mutations of Ser83 to Ala, Leu, or Trp, with higher levels of resistance in strains carrying Ser83→ Trp or Ser83→ Leu mutations. It has recently been reported that gyrase protein with the Ser83→ Trp mutation in gyrA has greatly reduced binding of ciprofloxacin compared with the wild type protein, further demonstrating the importance of this region of the protein(18Willmott C.J. Maxwell A. Antimicrob. Agents Chemother. 1993; 37: 126-127Crossref PubMed Scopus (206) Google Scholar).These findings have led us to examine the effects of mutations in the yeast TOP2 gene that change Ser741, the amino acid that is homologous to Ser83 in gyrA of E. coli, on the yeast type II enzyme for sensitivity to quinolones as well as other topoisomerase II inhibitors. We have found that the Ser741→ Trp mutation results in resistance to quinolones that act against eukaryotic topoisomerase II. In addition, this mutation causes hypersensitivity to etoposide. Overexpression, purification, and characterization of yeast topoisomerase II carrying the Ser741→ Trp demonstrated that the protein is relatively insensitive to fluoroquinolones and is hypersensitive to etoposide. Our results demonstrate that Ser741 of yeast TOP2 plays a critical role in the action of some anti-topoisomerase II agents and may be directly involved in the interactions of the eukaryotic enzyme with etoposide.