Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Recessive Mutations in the Gene Encoding the Tight Junction Protein Occludin Cause Band-like Calcification with Simplified Gyration and Polymicrogyria

2010; Elsevier BV; Volume: 87; Issue: 3 Linguagem: Inglês

10.1016/j.ajhg.2010.07.012

ISSN

1537-6605

Autores

Mary O’Driscoll, Sarah B. Daly, Jill Urquhart, Graeme Black, Daniela T. Pilz, Knut Brockmann, Meriel McEntagart, Ghada M. H. Abdel‐Salam, Maha S. Zaki, Nicole I. Wolf, Roger L. Ladda, Susan L. Sell, Stefano D’Arrigo, Waney Squier, William B. Dobyns, John H. Livingston, Yanick J. Crow,

Tópico(s)

Parathyroid Disorders and Treatments

Resumo

Band-like calcification with simplified gyration and polymicrogyria (BLC-PMG) is a rare autosomal-recessive neurological disorder showing highly characteristic clinical and neuroradiological features. Affected individuals demonstrate early-onset seizures, severe microcephaly, and developmental arrest with bilateral, symmetrical polymicrogyria (PMG) and a band of gray matter calcification on brain imaging; as such, the disorder can be considered as a “pseudo-TORCH” syndrome. By using autozygosity mapping and copy number analysis we identified intragenic deletions and mutations in OCLN in nine patients from six families with BLC-PMG. The OCLN gene encodes occludin, an integral component of tight junctions. Neuropathological analysis of an affected individual showed similarity to the mouse model of occludin deficiency with calcification predominantly associated with blood vessels. Both intracranial calcification and PMG are heterogeneous in etiology. Neuropathological and clinical studies of PMG have suggested that in utero ischemic or vascular insults may contribute to this common cortical abnormality. Tight junctions are functional in cerebral blood vessels early in fetal development and continue to play a vital role in maintenance of the blood-brain barrier during postnatal life. We provide evidence that the tight junction protein occludin (encoded by the OCLN gene) is involved in the pathogenesis of malformations of cortical development. Band-like calcification with simplified gyration and polymicrogyria (BLC-PMG) is a rare autosomal-recessive neurological disorder showing highly characteristic clinical and neuroradiological features. Affected individuals demonstrate early-onset seizures, severe microcephaly, and developmental arrest with bilateral, symmetrical polymicrogyria (PMG) and a band of gray matter calcification on brain imaging; as such, the disorder can be considered as a “pseudo-TORCH” syndrome. By using autozygosity mapping and copy number analysis we identified intragenic deletions and mutations in OCLN in nine patients from six families with BLC-PMG. The OCLN gene encodes occludin, an integral component of tight junctions. Neuropathological analysis of an affected individual showed similarity to the mouse model of occludin deficiency with calcification predominantly associated with blood vessels. Both intracranial calcification and PMG are heterogeneous in etiology. Neuropathological and clinical studies of PMG have suggested that in utero ischemic or vascular insults may contribute to this common cortical abnormality. Tight junctions are functional in cerebral blood vessels early in fetal development and continue to play a vital role in maintenance of the blood-brain barrier during postnatal life. We provide evidence that the tight junction protein occludin (encoded by the OCLN gene) is involved in the pathogenesis of malformations of cortical development. Band-like calcification with simplified gyration and polymicrogyria (BLC-PMG) is a rare autosomal-recessive neurological condition demonstrating clinical and neuroradiological features that may be interpreted as sequelae of congenital infection, a so-called pseudo-TORCH syndrome (MIM 251290). We have previously described 12 affected children from 5 families with this disorder.1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar, 2Abdel-Salam G.M. Zaki M.S. Saleem S.N. Gaber K.R. Microcephaly, malformation of brain development and intracranial calcification in sibs: Pseudo-TORCH or a new syndrome.Am. J. Med. Genet. A. 2008; 146A: 2929-2936Crossref PubMed Scopus (20) Google Scholar, 3Abdel-Salam G.M. Zaki M.S. Band-like intracranial calcification (BIC), microcephaly and malformation of brain development: A distinctive form of congenital infection like syndromes.Am. J. Med. Genet. A. 2009; 149A: 1565-1568Crossref PubMed Scopus (10) Google Scholar Patients experienced early-onset seizures, severe progressive microcephaly, and developmental arrest. This patient cohort was collated on the basis of the pattern of gray matter calcification and cortical malformation. CT and MR imaging showed a prominent band of cortical gray matter calcification as well as calcification in the cerebellum and basal ganglia (Figure 1, Figure 2). Brain imaging also showed characteristic bilateral, symmetrical, predominantly fronto-parietal PMG. Intracranial calcification (ICC) is a finding common to a heterogeneous group of genetic syndromes, as well as a prominent manifestation of intrauterine infection, in particular with congenital cytomegalovirus (CMV). These phenotypes are typically defined, not by the pattern of ICC, but by the presence of other clinical features. The combination of ICC and PMG suggests congenital CMV infection during mid-gestation.4Boppana S.B. Fowler K.B. Vaid Y. Hedlund G. Stagno S. Britt W.J. Pass R.F. Neuroradiographic findings in the newborn period and long-term outcome in children with symptomatic congenital cytomegalovirus infection.Pediatrics. 1997; 99: 409-414Crossref PubMed Scopus (199) Google Scholar, 5Noyola D.E. Demmler G.J. Nelson C.T. Griesser C. Williamson W.D. Atkins J.T. Rozelle J. Turcich M. Llorente A.M. Sellers-Vinson S. et al.Houston Congenital CMV Longitudinal Study GroupEarly predictors of neurodevelopmental outcome in symptomatic congenital cytomegalovirus infection.J. Pediatr. 2001; 138: 325-331Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar However, in BLC-PMG, the ICC is seen in a uniform, semicontinuous ribbon or band on CT brain, unlike the patterning typical of CMV infection. PMG is an increasingly recognized and common malformation of cortical development associated with a growing number of syndromes and consistent cytogenetic abnormalities.6Jansen A. Andermann E. Genetics of the polymicrogyria syndromes.J. Med. Genet. 2005; 42: 369-378Crossref PubMed Scopus (108) Google Scholar, 7Dobyns W.B. Mirzaa G. Christian S.L. Petras K. Roseberry J. Clark G.D. Curry C.J. McDonald-McGinn D. Medne L. Zackai E. et al.Consistent chromosome abnormalities identify novel polymicrogyria loci in 1p36.3, 2p16.1-p23.1, 4q21.21-q22.1, 6q26-q27, and 21q2.Am. J. Med. Genet. A. 2008; 146A: 1637-1654Crossref PubMed Scopus (75) Google Scholar, 8Robin N.H. Taylor C.J. McDonald-McGinn D.M. Zackai E.H. Bingham P. Collins K.J. Earl D. Gill D. Granata T. Guerrini R. et al.Polymicrogyria and deletion 22q11.2 syndrome: Window to the etiology of a common cortical malformation.Am. J. Med. Genet. A. 2006; 140: 2416-2425Crossref PubMed Scopus (114) Google Scholar Mutations in several genes have been identified as associated with PMG,9Roll P. Rudolf G. Pereira S. Royer B. Scheffer I.E. Massacrier A. Valenti M.P. Roeckel-Trevisiol N. Jamali S. Beclin C. et al.SRPX2 mutations in disorders of language cortex and cognition.Hum. Mol. Genet. 2006; 15: 1195-1207Crossref PubMed Scopus (216) Google Scholar, 10Baala L. Briault S. Etchevers H.C. Laumonnier F. Natiq A. Amiel J. Boddaert N. Picard C. Sbiti A. Asermouh A. et al.Homozygous silencing of T-box transcription factor EOMES leads to microcephaly with polymicrogyria and corpus callosum agenesis.Nat. Genet. 2007; 39: 454-456Crossref PubMed Scopus (139) Google Scholar, 11Passemard S. Titomanlio L. Elmaleh M. Afenjar A. Alessandri J.L. Andria G. de Villemeur T.B. Boespflug-Tanguy O. Burglen L. Del Giudice E. et al.Expanding the clinical and neuroradiologic phenotype of primary microcephaly due to ASPM mutations.Neurology. 2009; 73: 962-969Crossref PubMed Scopus (79) Google Scholar, 12Valente E.M. Marsh S.E. Castori M. Dixon-Salazar T. Bertini E. Al-Gazali L. Messer J. Barbot C. Woods C.G. Boltshauser E. et al.Distinguishing the four genetic causes of Jouberts syndrome-related disorders.Ann. Neurol. 2005; 57: 513-519Crossref PubMed Scopus (83) Google Scholar, 13Mitchell T.N. Free S.L. Williamson K.A. Stevens J.M. Churchill A.J. Hanson I.M. Shorvon S.D. Moore A.T. van Heyningen V. Sisodiya S.M. Polymicrogyria and absence of pineal gland due to PAX6 mutation.Ann. Neurol. 2003; 53: 658-663Crossref PubMed Scopus (128) Google Scholar, 14Brooks A.S. Bertoli-Avella A.M. Burzynski G.M. Breedveld G.J. Osinga J. Boven L.G. Hurst J.A. Mancini G.M. Lequin M.H. de Coo R.F. et al.Homozygous nonsense mutations in KIAA1279 are associated with malformations of the central and enteric nervous systems.Am. J. Hum. Genet. 2005; 77: 120-126Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 15Keren B. Suzuki O.T. Gérard-Blanluet M. Brémond-Gignac D. Elmaleh M. Titomanlio L. Delezoide A.L. Passos-Bueno M.R. Verloes A. CNS malformations in Knobloch syndrome with splice mutation in COL18A1 gene.Am. J. Med. Genet. A. 2007; 143A: 1514-1518Crossref PubMed Scopus (29) Google Scholar, 16Graham Jr., J.M. Hennekam R. Dobyns W.B. Roeder E. Busch D. MICRO syndrome: An entity distinct from COFS syndrome.Am. J. Med. Genet. A. 2004; 128A: 235-245Crossref PubMed Scopus (48) Google Scholar, 17Hevner R.F. The cerebral cortex malformation in thanatophoric dysplasia: Neuropathology and pathogenesis.Acta Neuropathol. 2005; 110: 208-221Crossref PubMed Scopus (79) Google Scholar, 18Geerdink N. Rotteveel J.J. Lammens M. Sistermans E.A. Heikens G.T. Gabreëls F.J. Mullaart R.A. Hamel B.C. MECP2 mutation in a boy with severe neonatal encephalopathy: Clinical, neuropathological and molecular findings.Neuropediatrics. 2002; 33: 33-36Crossref PubMed Scopus (55) Google Scholar, 19Abdollahi M.R. Morrison E. Sirey T. Molnar Z. Hayward B.E. Carr I.M. Springell K. Woods C.G. Ahmed M. Hattingh L. et al.Mutation of the variant alpha-tubulin TUBA8 results in polymicrogyria with optic nerve hypoplasia.Am. J. Hum. Genet. 2009; 85: 737-744Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar underlining the heterogeneous etiology of this malformation. The importance of ischemic or vascular insults, occurring at around 5 months of gestation, in the pathogenesis of PMG has been suggested on the basis of animal models,20Dvorák K. Feit J. Migration of neuroblasts through partial necrosis of the cerebral cortex in newborn rats-contribution to the problems of morphological development and developmental period of cerebral microgyria. Histological and autoradiographical study.Acta Neuropathol. 1977; 38: 203-212Crossref PubMed Scopus (169) Google Scholar, 21Ferrer I. A Golgi analysis of unlayered polymicrogyria.Acta Neuropathol. 1984; 65: 69-76Crossref PubMed Scopus (68) Google Scholar, 22Ferrer I. Catalá I. Unlayered polymicrogyria: Structural and developmental aspects.Anat. Embryol. (Berl.). 1991; 184: 517-528Crossref PubMed Scopus (47) Google Scholar, 23Suzuki M. Choi B.H. Repair and reconstruction of the cortical plate following closed cryogenic injury to the neonatal rat cerebrum.Acta Neuropathol. 1991; 82: 93-101Crossref PubMed Scopus (44) Google Scholar twin studies,24Barth P.G. van der Harten J.J. Parabiotic twin syndrome with topical isocortical disruption and gastroschisis.Acta Neuropathol. 1985; 67: 345-349Crossref PubMed Scopus (51) Google Scholar, 25Graff-Radford N.R. Bosch E.P. Stears J.C. Tranel D. Developmental Foix-Chavany-Marie syndrome in identical twins.Ann. Neurol. 1986; 20: 632-635Crossref PubMed Scopus (83) Google Scholar, 26Van Bogaert P. Donner C. David P. Rodesch F. Avni E.F. Szliwowski H.B. Congenital bilateral perisylvian syndrome in a monozygotic twin with intra-uterine death of the co-twin.Dev. Med. Child Neurol. 1996; 38: 166-170Crossref PubMed Scopus (50) Google Scholar in utero insults,27Richman D.P. Stewart R.M. Caviness Jr., V.S. Cerebral microgyria in a 27-week fetus: An architectonic and topographic analysis.J. Neuropathol. Exp. Neurol. 1974; 33: 374-384Crossref PubMed Scopus (120) Google Scholar and case studies of affected patients.28Williams R.S. Ferrante R.J. Caviness Jr., V.S. The cellular pathology of microgyria. A Golgi analysis.Acta Neuropathol. 1976; 36: 269-283Crossref PubMed Scopus (60) Google Scholar The site of PMG is most commonly within the territory of the middle cerebral artery, lending further weight to a vascular etiology.29Reutens D.C. Berkovic S.F. Kalnins R.M. McKelvie P. Saling M.M. Fabinyi G.C. Localised neuronal migration disorder and intractable epilepsy: A prenatal vascular aetiology.J. Neurol. Neurosurg. Psychiatry. 1993; 56: 314-316Crossref PubMed Scopus (17) Google Scholar, 30Raybaud C. Di Rocco C. Brain malformation in syndromic craniosynostoses, a primary disorder of white matter: A review.Childs Nerv. Syst. 2007; 23: 1379-1388Crossref PubMed Scopus (68) Google Scholar, 31McBride M.C. Kemper T.L. Pathogenesis of four-layered microgyric cortex in man.Acta Neuropathol. 1982; 57: 93-98Crossref PubMed Scopus (80) Google Scholar Here, we report mutations in the OCLN gene (MIM 602876) encoding the tight junction protein occludin in nine patients with BLC-PMG. Occludin is expressed as an integral component of the tight junction in all epithelia as well as endothelia in the brain.32Furuse M. Hirase T. Itoh M. Nagafuchi A. Yonemura S. Tsukita S. Tsukita S. Occludin: A novel integral membrane protein localizing at tight junctions.J. Cell Biol. 1993; 123: 1777-1788Crossref PubMed Scopus (2042) Google Scholar, 33Virgintino D. Errede M. Robertson D. Capobianco C. Girolamo F. Vimercati A. Bertossi M. Roncali L. Immunolocalization of tight junction proteins in the adult and developing human brain.Histochem. Cell Biol. 2004; 122: 51-59Crossref PubMed Scopus (104) Google Scholar The Ocln knockout mouse model has a complex phenotype including abnormalities of salivary glands, gastric epithelium, bone, testes, and ICC.34Saitou M. Furuse M. Sasaki H. Schulzke J.D. Fromm M. Takano H. Noda T. Tsukita S. Complex phenotype of mice lacking occludin, a component of tight junction strands.Mol. Biol. Cell. 2000; 11: 4131-4142Crossref PubMed Scopus (855) Google Scholar The human phenotype reported here is confined to the brain, suggesting, as in the mouse model, functional redundancy of occludin in other tissue types. We postulate that absence of occludin in the developing brain33Virgintino D. Errede M. Robertson D. Capobianco C. Girolamo F. Vimercati A. Bertossi M. Roncali L. Immunolocalization of tight junction proteins in the adult and developing human brain.Histochem. Cell Biol. 2004; 122: 51-59Crossref PubMed Scopus (104) Google Scholar and subsequent abnormal blood-brain barrier (BBB) function35Hirase T. Staddon J.M. Saitou M. Ando-Akatsuka Y. Itoh M. Furuse M. Fujimoto K. Tsukita S. Rubin L.L. Occludin as a possible determinant of tight junction permeability in endothelial cells.J. Cell Sci. 1997; 110: 1603-1613Crossref PubMed Google Scholar results in cortical malformation.Figure 2Selected MRI Images from a Single Affected Individual with BLC-PMGShow full captionSerial MRI images age 2 weeks (A–C) and 9 months (D–F) from F085a1 with an age-appropriate control (G–I) showing progressive cerebral atrophy. T1 (A, D) and T2 (B, E) weighted axial images also show the severe reduction in cerebral volume, deep cortical (black arrowheads) and basal ganglia (arrow) calcification, and bilateral fronto-parietal PMG (white arrowheads) seen in other affected individuals.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Serial MRI images age 2 weeks (A–C) and 9 months (D–F) from F085a1 with an age-appropriate control (G–I) showing progressive cerebral atrophy. T1 (A, D) and T2 (B, E) weighted axial images also show the severe reduction in cerebral volume, deep cortical (black arrowheads) and basal ganglia (arrow) calcification, and bilateral fronto-parietal PMG (white arrowheads) seen in other affected individuals. Affected individuals were recruited into our ongoing study of patients with ICC. Further patients were ascertained on the basis of highly concordant clinical and neuroradiological phenotypes. Written informed consent was obtained for all participants and the study has full ethical approval from the Leeds Multi-center Research Ethics Committee (Reference number 07/Q1206/7). Ten affected individuals from six families with the typical BLC-PMG phenotype are described (Table 1 and Table S1 available online). Four families, all from the Middle East, were consanguineous. In two other families, originating from the UK and from Mexico, the parents were not known to be related. The clinical details of affected individuals from families F275,3Abdel-Salam G.M. Zaki M.S. Band-like intracranial calcification (BIC), microcephaly and malformation of brain development: A distinctive form of congenital infection like syndromes.Am. J. Med. Genet. A. 2009; 149A: 1565-1568Crossref PubMed Scopus (10) Google Scholar F312,1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar and F3751Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar have been previously reported. Information on the clinical phenotype for families F085, F351, and F386 are available in Table S1 including the sibling from F386 in whom genetic testing was not performed. In brief, affected individuals were severely microcephalic, developed seizures within 4 months of birth, and demonstrated minimal developmental progress and a spastic tetraparesis. Birth occipito-frontal circumference (OFC) ranged from +1 SD to −3 SD with early and sustained progression (−2.5 SD to −8 SD on review) in all patients in whom follow-up information was available1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar, 3Abdel-Salam G.M. Zaki M.S. Band-like intracranial calcification (BIC), microcephaly and malformation of brain development: A distinctive form of congenital infection like syndromes.Am. J. Med. Genet. A. 2009; 149A: 1565-1568Crossref PubMed Scopus (10) Google Scholar (Table S1). CSF analysis performed on affected individuals from families F085, F312, F351, F375, and F386 was normal except for raised protein levels (Table 2). CSF interferon alpha levels were measured in a single patient and were found to be normal. One patient (F351) had mild hepatomegaly but testing for congenital infections was normal at birth. Further testing at 4 months showed CMV IgG in serum and positive CMV PCR in urine but not in blood or CSF. Her mother had raised serum CMV IgG. As previously reported,1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar both siblings from F375 had positive CMV serology, indicative of postnatal infection in the elder sibling, but all remaining patients had negative neonatal CMV serology (Table S1). Mutation testing for the four known genes causing Aicardi-Goutieres syndrome (MIM 225750) was negative in F351. No health concerns were reported in any of the parents.Table 1Details of Families with BLC-PMG and OCLN Mutations Described in This ReportFamilyAncestryTestedNucleotide AlterationExonAmino Acid AlterationParental ConsanguinityF085Turkish2A46,XY, arr 5q13.2(68,839,890x2, 68,840,602-68,844,536x0, 68,852,777x2)3 (& 4?)p.Lys18_Glu243?deletion of transmembrane domainsyesF275Egyptian1A46,XY, arr 5q13.2(68,839,890x2, 68,840,602-68,844,536x0, 68,852,777x2)3 (& 4?)p.Lys18_Glu243?deletion of transmembrane domainsyesF312British2Ac.512 dupA3p.Tyr171XnoM, Fc.656T>C3p.Phe219SernoF351Saudi1A, M, Fc.1037+5G>Aintron 5-6alteration of donor splice siteyesF375Turkish2A, M, Fc.171_193 del ATGGACCTCTCCTCCAGGAGTG3p.Trp58PhefsX9deletion of first 8 amino acids of conserved Marvel domainyesF386Mexican1A, M, Fc.51-?_730-?del3p.Lys18_Glu243?deletion of transmembrane domainsnoNomenclature according to current ISCN70Shaffer L.G. Slovak M.L. Campbell L.J. An International System for Human Cytogenetic Nomenclature. S Karger, Basel2009Google Scholar and HGVS standards.Abbreviations: A, affected; M, mother; F, father. Open table in a new tab Table 2Results of Cerebrospinal Fluid Analysis for Five Children with BLC-PMG Including Three Measurements from F085a1PatientF085a1 (1)F085a1 (2)F085a1 (3)F085a2F312a1F375a1F386a1Age1 month3 months4 months6 months1 weekunknown3 daysWhite cell count9/μL (0–5/μL)4/μL (0–5/μL)2/μL (0-5/μL)1/μL (0-5/μL)1/μL (0-5/μL)normal (value not available)2/μL (0-5/μL)Protein1021 mg/L (100–200 mg/L)824 mg/L (100–200 mg/L)666 mg/L (100–200 mg/L)631 mg/L (100–200 mg/L)60 mg/L (40–400 mg/L)700 mg/L (100–200 mg/L)1260 mg/L (200–600 mg/L)Glucose3 mmol/L (2.2–3.9 mmol/L)2.7 mmol/L (2.2–3.9 mmol/L)-64 mg/dL (40–70 mg/dL)--79 mg/dL (50–80 mg/dL)Lactate1.1 mmol/L (<2.1 mmol/L)1.3 mmol/L (<2.1 mmol/L)1.5 mmol/L (<2.1 mmol/L)1.0 mmol/L (<2.1 mmol/L)2.2 mmol/L (<2.1 mmol/L)--CSF IFNαnormal------Serum IFNαnormal------CSF IgG--26.6 mg/L37.8 mg/L---Oligoclonal bands--negativenegative---Normal values for each measurement are in parentheses. Cerebrospinal fluid (CSF) protein levels were raised in 4 of 5 individuals. Serial measurement of CSF protein in F085a1 showed a reduction in protein concentration over a 3 month period. All other measurements were normal. IFNα, interferon alpha; IgG, immunoglobulin G. Open table in a new tab Nomenclature according to current ISCN70Shaffer L.G. Slovak M.L. Campbell L.J. An International System for Human Cytogenetic Nomenclature. S Karger, Basel2009Google Scholar and HGVS standards. Abbreviations: A, affected; M, mother; F, father. Normal values for each measurement are in parentheses. Cerebrospinal fluid (CSF) protein levels were raised in 4 of 5 individuals. Serial measurement of CSF protein in F085a1 showed a reduction in protein concentration over a 3 month period. All other measurements were normal. IFNα, interferon alpha; IgG, immunoglobulin G. The CT and MRI scans of affected individuals were reviewed for the presence of cortical, basal ganglia, and brainstem calcification and for cortical abnormality. Images from families F275, F312, and F375 were presented in the original case reports.1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar, 3Abdel-Salam G.M. Zaki M.S. Band-like intracranial calcification (BIC), microcephaly and malformation of brain development: A distinctive form of congenital infection like syndromes.Am. J. Med. Genet. A. 2009; 149A: 1565-1568Crossref PubMed Scopus (10) Google Scholar Selected images of both siblings in F085, the affected child in F351, and two affected siblings in F386 are shown in Figure 1, Figure 2. All demonstrated bilateral symmetrical PMG in a perisylvian and temporal distribution with severe loss of cerebral volume, simplified gyration, and wide sylvian fissures. Calcification was present bilaterally in the deep cortical gray matter with variable calcification in the pons, thalami, and globus pallidus. Serial scans at 2 weeks and 9 months of age in a single affected individual from F085 show evidence of progressive atrophy (Figure 2). Postmortem analysis of a single patient with BLC-PMG (F312a1) showed widespread gliosis, white matter loss, calcification, and perisylvian predominant PMG within the cerebral cortex as previously described.1Briggs T.A. Wolf N.I. D'Arrigo S. Ebinger F. Harting I. Dobyns W.B. Livingston J.H. Rice G.I. Crooks D. Rowland-Hill C.A. et al.Band-like intracranial calcification with simplified gyration and polymicrogyria: A distinct “pseudo-TORCH” phenotype.Am. J. Med. Genet. A. 2008; 146A: 3173-3180Crossref PubMed Scopus (33) Google Scholar In light of the molecular findings, neuropathological samples from this patient were re-evaluated to determine the pattern of calcification (Figure 3). Mineral deposition, presumed to be calcification, was most prominent in the deep cerebral and cerebellar cortex, frequently surrounding small blood vessels. Calcification was noted in cells in close apposition to endothelia, which may represent pericytes or astrocytes. Unlike endothelial cells, brain-derived pericytes do not express the marker CD31 (PECAM-1).36Shimizu F. Sano Y. Maeda T. Abe M.A. Nakayama H. Takahashi R. Ueda M. Ohtsuki S. Terasaki T. Obinata M. Kanda T. Peripheral nerve pericytes originating from the blood-nerve barrier expresses tight junctional molecules and transporters as barrier-forming cells.J. Cell. Physiol. 2008; 217: 388-399Crossref PubMed Scopus (81) Google Scholar Figure 3 also shows sections from the cerebral cortex and cerebellum stained with CD31. These demonstrate endothelia adjacent to, but not incorporated within, areas of calcification. Blood vessels without associated calcification were also seen. No evidence of neuronal overmigration was apparent and the pial surface was intact. Widespread gliosis and centri-lobular sclerosis was also evident in the cerebellum, but the pattern of calcification differed from that seen in the cortex. Calcification surrounded blood vessels of varying sizes and was commonly globular rather than laminar in appearance. It was present in other cells closely allied to blood vessels, which may represent pericytes. Calcification was also present in Purkinje cells. Genomic DNA was extracted from lymphocytes from affected individuals, parents, and siblings by standard techniques. A genome-wide SNP microarray by means of the Affymetrix Human SNP Array 6.0 (Affymetrix, High Wycombe, Buckinghamshire, UK) was performed in six affected individuals according to the manufacturer's instructions. Copy number analysis was performed with Chromosome Analysis Suite (ChAS; Affymetrix). Regions of homozygosity were identified via AutoSNPa software37Carr I.M. Flintoff K.J. Taylor G.R. Markham A.F. Bonthron D.T. Interactive visual analysis of SNP data for rapid autozygosity mapping in consanguineous families.Hum. Mutat. 2006; 27: 1041-1046Crossref PubMed Scopus (133) Google Scholar with NCBI build 36 (hg18). Mutation analysis was performed by direct sequencing of purified genomic PCR products. Primers were designed for individual exons and intron boundaries of OCLN with Primer3Plus and the reference sequence NM_002358.2. PCR was performed on genomic DNA with Abgene ReddyMix PCR Mastermix and sequencing was performed with BigDye terminator cycle sequencer system v3.1 (primer sequences available in Table S2 and experimental conditions available on request). All eight coding exons and flanking intronic boundaries of OCLN were screened in affected individuals and the relevant exons were sequenced in both parents where available. A 6.5 Mb region of shared homozygosity was identified in six affected individuals from consanguineous families (F085, F275, F351, and F375) on chromosome 5q13 (Figure 4). The region contained 1317 SNPs and was flanked by SNPs rs1423233 (position 67,827,934) and rs7711157 (position 74,275,250). The BLC-PMG critical interval contained approximately 65 genes. Detailed analysis of SNP and copy number probes within this region identified a deletion of three contiguous copy number probes: CN1139669 (position 68,840,602), CN1139670 (position 68,844,101), and CN303606 (position 68,844,536) in both affected individuals from family F085 (Figure 5). The probes were located within intron 2–3 and intron 3–4 of the OCLN gene. Probes on either side of this putative intragenic deletion (CN1139668 and CN1139671) were present on both alleles, as were 10 other probes (one SNP and nine copy number probes) mapping within the OCLN gene. A duplication of exons 6–9 of OCLN is located approximately 1.5 Mb downstream on 5q13. No SNP or copy number probes are annotated within this region. Mutations in OCLN were identified in nine individuals from six families (Table 1 and Figure 5, Figure 6). Homozygous deletions of copy number probes within exons 3 and 4 of OCLN were detected by microarray analysis in three affected individuals from two consanguineous families (F085 and F275). These two families are not known to be related, one originating from Egypt and the other from Turkey. A homozygous deletion of exon 3 was found in a single affected individual from a nonconsanguineous native Mexican family via PCR and sequencing (F386). A full-length PCR product corresponding to exon 3 was obtained from DNA from both parents. DNA from his affected sibling was not available for analysis. A homozygous 22 base pair frameshift deletion of exon 3 (c.171_193 delATGGACCTCTCCTCCAGGAGTG) wa

Referência(s)