Portal de Periódicos da CAPES

A Rac1/Phosphatidylinositol 3-Kinase/Akt3 Anti-apoptotic Pathway, Triggered by AlsinLF, the Product of the ALS2 Gene, Antagonizes Cu/Zn-superoxide Dismutase (SOD1) Mutant-induced Motoneuronal Cell Death

2004; Elsevier BV; Volume: 280; Issue: 6 Linguagem: Inglês

10.1074/jbc.m410508200

1083-351X

Kohsuke Kanekura, Yuichi Hashimoto, Yoshiko Kita, Jumpei Sasabe, Sadakazu Aiso, Ikuo Nishimoto, Masaaki Matsuoka,

Mitochondrial Function and Pathology

AlsinLF, the product of the ALS2 gene, inhibits Cu/Zn-superoxide dismutase (SOD1) mutant-induced neurotoxicity via its Rho guanine nucleotide-exchanging factor domain. We here identified Rac1, a Rho family small GTPase, as a target for the Rho guanine nucleotide-exchanging factor activity of alsinLF. Rac1 associates with alsinLF. The amount of the GTP form of Rac1 is up-regulated by enforced overexpression of alsinLF. We further found not only that constitutively active Rac1 suppresses motoneuronal cell death induced by SOD1 mutants but also that the neuroprotective activity of alsinLF was completely inhibited by knocking down the endogenous Rac1 expression with small interfering RNA for Rac1, indicating that Rac1 is the major effector for alsinLF-mediated neuroprotection. Such alsinLF/Rac1-mediated neuroprotection occurs specifically against the SOD1 mutant-induced cell death but not against the cell death induced by any other neurotoxic insults in motoneuronal NSC34 cells. We further demonstrated that the alsinLF/Rac1-mediated neuroprotective signal is transmitted to the phosphatidylinositol 3-kinase/Akt anti-apoptotic axis. Among three Akt family proteins, Akt3 is the major downstream mediator for alsinLF/Rac1-mediated neuroprotection, which is specifically effective against SOD1 mutant-induced neurotoxicity. AlsinLF, the product of the ALS2 gene, inhibits Cu/Zn-superoxide dismutase (SOD1) mutant-induced neurotoxicity via its Rho guanine nucleotide-exchanging factor domain. We here identified Rac1, a Rho family small GTPase, as a target for the Rho guanine nucleotide-exchanging factor activity of alsinLF. Rac1 associates with alsinLF. The amount of the GTP form of Rac1 is up-regulated by enforced overexpression of alsinLF. We further found not only that constitutively active Rac1 suppresses motoneuronal cell death induced by SOD1 mutants but also that the neuroprotective activity of alsinLF was completely inhibited by knocking down the endogenous Rac1 expression with small interfering RNA for Rac1, indicating that Rac1 is the major effector for alsinLF-mediated neuroprotection. Such alsinLF/Rac1-mediated neuroprotection occurs specifically against the SOD1 mutant-induced cell death but not against the cell death induced by any other neurotoxic insults in motoneuronal NSC34 cells. We further demonstrated that the alsinLF/Rac1-mediated neuroprotective signal is transmitted to the phosphatidylinositol 3-kinase/Akt anti-apoptotic axis. Among three Akt family proteins, Akt3 is the major downstream mediator for alsinLF/Rac1-mediated neuroprotection, which is specifically effective against SOD1 mutant-induced neurotoxicity. Amyotrophic lateral sclerosis (ALS) 1The abbreviations used are: ALS, amyotrophic lateral sclerosis; FALS, familial ALS; SOD1, Cu/Zn-superoxide dismutase; APP, amyloid-β precursor protein; FAD, familial Alzheimer's disease; FPD, familial Parkinson's disease; FBS, fetal bovine serum; PI3K, phosphatidylinositol 3-kinase; dnh-, dominant-negative (dn) human; cah-, constitutively active (ca) human; wth, wild-type human; PBD, p21 binding domain; RBD, Rho binding domain; alsinLF, alsin long form; GEF, guanine nucleotide exchange factor; RCC1, regulator of chromosome condensation 1; si-, small interfering; DMEM, Dulbecco's modified Eagle's medium; GST, glutathione S-transferase; HRP, horseradish peroxidase; PS, presenilin; HA, hemagglutinin. is the most common motor neuron disease characterized by progressive loss of both upper and lower motoneurons. Similar to other neurodegenerative diseases, most ALS cases show no genetic linkage, but ∼10% of patients have a hereditary background. From dominantly inherited families, mutations in the Cu/Zn-superoxide dismutase (SOD1) gene were identified as a cause of an autosomal-dominant ALS (1Rosen D.R. Siddique T. Patterson D. Figlewicz D.A. Sapp P. Hentati A. Donaldson D. Goto J. O'Regan J.P. Deng H.X. Rahmani Z. Krizus A. McKennna-Yasek D. Cayabyab A. Gaston S.M. Berger R. Tanzi R.E. Halperin J.J. Van den Herzfeldt B. Bergh R. Hung W.Y. Bird T. Deng G. Mulder D.W. Smyth C. Laing N.G. Soriano E. PericakVance M.A. Haines J. Rouleau G.A. Gusella J.S. Horvitz H.R. Brown Jr., R.H. Nature. 1993; 362: 59-62Crossref PubMed Scopus (5530) Google Scholar), and the discovery gave rise to a breakthrough in the investigation of the intricate pathogenesis of ALS. Coupled with outstanding advances in gene-engineering techniques, various transgenic model mice carrying SOD1 mutants have been produced (2Gurney M.E. Pu H. Chiu A.Y. Dal Canto M.C. Polchow C.Y. Alexander D.D. Caliendo J. Hentati A. Kwon Y.W. Deng H.X. Chen W. Zhai P. Sufit R.L. Siddique T. Science. 1994; 264 (Correction (1995) Science 269, 149): 1772-1775Crossref PubMed Scopus (3476) Google Scholar, 3Gong Y.H. Parsadanian A.S. Andreeva A. Snider W.D. Elliott J.L. J. Neurosci. 2000; 20: 660-665Crossref PubMed Google Scholar, 4Subramaniam J.R. Lyons W.E. Liu J. Bartnikas T.B. Rothstein J. Price D.L. Cleveland D.W. Gitlin J.D. Wong P.C. Nat. Neurosci. 2002; 5: 301-307Crossref PubMed Scopus (218) Google Scholar), and a large quantity of information has been obtained by intensive investigation with in vitro/in vivo models. However, the most essential mechanism of progressive motoneuronal degeneration still remains unclear. In 2001, an autosomal recessive ALS-causative gene, ALS2, was identified from inbred Arabic families (5Hadano S. Hand C.K. Osuga H. Yanagisawa Y. Otomo A. Devon R.S. Miyamoto N. Showguchi-Miyata J. Okada Y. Singaraja R. Figlewicz D.A. Kwiatkowski T. Hosler B.A. Sagie T. Skaug J. Nasir J. Brown Jr., R.H. Scherer S.W. Rouleau G.A. Hayden M.R. Ikeda J.E. Nat. Genet. 2001; 29: 166-173Crossref PubMed Scopus (593) Google Scholar, 6Yang Y. Hentati A. Deng H.X. Dabbagh O. Sasaki T. Hirano M. Hung W.Y. Ouahchi K. Yan J. Azim A.C. Cole N. Gascon G. Yagmour A. Ben-Hamida M. Pericak-Vance M. Hentati F. Siddique T. Nat. Genet. 2001; 29: 160-165Crossref PubMed Scopus (662) Google Scholar). ALS2 encodes not only a large protein called alsin long form (alsinLF) but also alsin short form, an alternatively spliced short form (Fig. 1A). AlsinLF contains three guanine nucleotide exchange factor (GEF) homologous domains consisting of a regulator of chromosome condensation 1 (RCC1), Rho guanine nucleotide exchanging factor (RhoGEF), and vacuolar protein sorting 9 (VPS9) (5Hadano S. Hand C.K. Osuga H. Yanagisawa Y. Otomo A. Devon R.S. Miyamoto N. Showguchi-Miyata J. Okada Y. Singaraja R. Figlewicz D.A. Kwiatkowski T. Hosler B.A. Sagie T. Skaug J. Nasir J. Brown Jr., R.H. Scherer S.W. Rouleau G.A. Hayden M.R. Ikeda J.E. Nat. Genet. 2001; 29: 166-173Crossref PubMed Scopus (593) Google Scholar). All known ALS2 mutations are nucleotide deletions causing a C-terminal truncation of alsinLF (5Hadano S. Hand C.K. Osuga H. Yanagisawa Y. Otomo A. Devon R.S. Miyamoto N. Showguchi-Miyata J. Okada Y. Singaraja R. Figlewicz D.A. Kwiatkowski T. Hosler B.A. Sagie T. Skaug J. Nasir J. Brown Jr., R.H. Scherer S.W. Rouleau G.A. Hayden M.R. Ikeda J.E. Nat. Genet. 2001; 29: 166-173Crossref PubMed Scopus (593) Google Scholar, 6Yang Y. Hentati A. Deng H.X. Dabbagh O. Sasaki T. Hirano M. Hung W.Y. Ouahchi K. Yan J. Azim A.C. Cole N. Gascon G. Yagmour A. Ben-Hamida M. Pericak-Vance M. Hentati F. Siddique T. Nat. Genet. 2001; 29: 160-165Crossref PubMed Scopus (662) Google Scholar, 7Eymard-Pierre E. Lesca G. Dollet S. Santorelli F.M. Di Capua M. Bertini E. Boespflug-Tanguy O. Am. J. Hum. Genet. 2002; 71: 518-527Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar, 8Lesca G. Eymard-Pierre E. Santorelli F.M. Cusmai R. Capua DiM. Valente E.M. Attia-Sobol J. Plauchu H. Leuzzi V. Ponzone A. Boespflug-Tanguy O. Bertini E. Neurology. 2003; 60: 674-682Crossref PubMed Scopus (57) Google Scholar, 9Gros-Louis F. Meijer I.A. Hand C.K. Dube M.P. MacGregor D.L. Seni M.H. Devon R.S. Hayden M.R. Andermann F. Andermann E. Rouleau G.A. Ann. Neurol. 2003; 53: 144-145Crossref PubMed Scopus (98) Google Scholar, 10Devon R.S. Helm J.R. Rouleau G.A. Leitner Y. Lerman-Sagie T. Lev D. Hayden M.R. Clin. Genet. 2003; 64: 210-215Crossref PubMed Scopus (88) Google Scholar). Patients with a C-terminally truncated alsinLF show a variety of infantile-onset motoneuronal disorders, including ALS, which involves both upper and lower motor neurons, and hereditary spastic paraplegia, which involves only upper motor neurons. Motifs in the primary sequence of alsinLF including three GEFs and membrane occupation and recognition nexus (MORN) are thought to be related to signal transduction, protein sorting, and membrane localization (Fig. 1A). The variety and the degree of loss of these functions due to frameshift probably give rise to a variety of pathophysiological disorders in alsin-related motor neuron diseases. We recently demonstrated that alsinLF has neuroprotective activity specifically effective against SOD1 mutant-induced cytotoxicity (11Kanekura K. Hashimoto Y. Niikura T. Aiso S. Matsuoka M. Nishimoto I. J. Biol. Chem. 2004; 279: 19247-19256Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Detailed characterization has indicated that the RhoGEF domain is essential and sufficient for alsinLF-mediated neuroprotection. Considering that RhoGEF is a kind of GTPase regulator that activates Rho-family small G proteins by accelerating the reaction exchanging GDP for GTP, alsinLF-mediated neuroprotection against toxicity by SOD1 mutants has been hypothesized to be mediated by the RhoGEF activity of alsinLF, although target Rho family proteins of alsinLF remain unidentified. Rho family proteins are classified into several major subfamilies such as Rho, Rac, or Cdc42. Rho family proteins play a number of important roles in cell biology including cellular polarity, morphology, chemotaxis, invasion, cell division, cell transformation, metastasis, and cell survival (12Etienne-Manneville S. Hall A. Nature. 2003; 420: 629-635Crossref Scopus (3861) Google Scholar). Especially, it has been generally known that Rho family proteins become pro-apoptotic or anti-apoptotic, depending on the cellular conditions and the cell types. Although there still remain many uncharacterized mechanisms underlying the pro-apoptotic and anti-apoptotic activities of Rho family proteins, several studies have identified pathways leading to cell death or cell survival. Upon stimulation of specific signals, different Rho family proteins might trigger different apoptotic pathways, which have been shown to be partially mediated by c-Jun N-terminal kinase and nuclear factor κB (13Aznar S. Lacal J.C. Cancer Lett. 2001; 165: 1-10Crossref PubMed Scopus (289) Google Scholar). Fas stimuli induce apoptosis via Rho family proteins (14Subauste M.C. Von Herrath M. Benard V. Chamberlain C.E. Chuang T.H. Chu K. Bokoch G.M. Hahn K.M. J. Biol. Chem. 2000; 275: 9725-9733Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). Rac1 participates in serum deprivation-induced apoptosis (15Embade N. Valeron P.F. Aznar S. Lopez-Collazo E. Lacal J.C. Mol. Biol. Cell. 2000; 11: 4347-4358Crossref PubMed Scopus (68) Google Scholar). p75 neurotrophin receptor activates Rac1, which in turn activates c-Jun N-terminal kinase in a nerve growth factor-dependent manner and causes apoptosis in neuronal cells (16Harrington A.W. Kim J.Y. Yoon S.O. J. Neurosci. 2002; 22: 156-166Crossref PubMed Google Scholar). On the other hand, it has been reported that Rac1 antagonizes apoptosis in certain situations (17Nishida K. Kaziro Y. Satoh T. Oncogene. 1999; 18: 407-415Crossref PubMed Scopus (80) Google Scholar, 18Pervaiz S. Cao J. Chao O.S. Chin Y.Y. Clement M.V. Oncogene. 2001; 20: 6263-6268Crossref PubMed Scopus (115) Google Scholar, 19Deshpande S.S. Angkeow P. Huang J. Ozaki M. Irani K. FASEB J. 2000; 14: 1705-1714Crossref PubMed Scopus (204) Google Scholar, 20Murga C. Zohar M. Teramoto H. Gutkind J.S. Oncogene. 2002; 21: 207-216Crossref PubMed Scopus (141) Google Scholar, 21Zhang B. Zhang Y. Shacter E. Mol. Cell. Biol. 2004; 24: 6205-6214Crossref PubMed Scopus (57) Google Scholar). Rac1 protects endothelial cells from tumor necrosis factor-α-induced apoptosis (19Deshpande S.S. Angkeow P. Huang J. Ozaki M. Irani K. FASEB J. 2000; 14: 1705-1714Crossref PubMed Scopus (204) Google Scholar) and tumor cells from apoptosis induced by anti-cancer drugs or the cell surface death receptor, CD95 (18Pervaiz S. Cao J. Chao O.S. Chin Y.Y. Clement M.V. Oncogene. 2001; 20: 6263-6268Crossref PubMed Scopus (115) Google Scholar). Rac1 and RhoG promote cell survival by the activation of phosphatidylinositol 3-kinase (PI3K) and Akt in COS7 cells (20Murga C. Zohar M. Teramoto H. Gutkind J.S. Oncogene. 2002; 21: 207-216Crossref PubMed Scopus (141) Google Scholar). Most recently, Topp et al. (22Topp J.D. Gray N.W. Gerard R.D. Horazdovsky B.F. J. Biol. Chem. 2004; 279: 24612-24623Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar) demonstrated that the Rho-GEF domain of alsinLF has the guanine nucleotide exchanging activity for Rac1 in Sf9 insect cells, although the functional consequence of activation of Rac1 by the RhoGEF domain of alsinLF has not been assessed (22Topp J.D. Gray N.W. Gerard R.D. Horazdovsky B.F. J. Biol. Chem. 2004; 279: 24612-24623Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar). It remains completely unknown whether Rac1, activated by the RhoGEF domain of alsinLF, acts as an effector for alsinLF-mediated protection against SOD1 mutant-induced neuronal cell death. Moreover, even if this is the case, it should be assessed whether Rac1 is the sole mediator for alsinLF-mediated protection of SOD1 mutant-induced neuronal cell death. In this study, we dissected the precise mechanism underlying neuroprotection by alsinLF against SOD1 mutant-induced neurotoxicity. We demonstrated that alsinLF is a Rac1-specific RhoGEF. Most importantly, Rac1, activated by the RhoGEF activity of alsinLF, plays a critical role in alsinLF-mediated neuroprotection against toxicity by SOD1 mutants. We further showed that alsinLF protects neuronal cells via the PI3K/Akt3 pathway. DNA Constructs—The full length of alsinLF cDNA was constructed as described previously (11Kanekura K. Hashimoto Y. Niikura T. Aiso S. Matsuoka M. Nishimoto I. J. Biol. Chem. 2004; 279: 19247-19256Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). T701A-alsinLF, alsinLF with an amino acid substitution of alanine for threonine at the amino acid 701 position, was constructed by site-directed mutagenesis using a sense primer (CTCCACGAGTTAGCTACTGCAGAAAGACGATTC) and an antisense primer (GAATCGTCTTTCTGCAGTAGCTAACTCGTGGAG). Several expression vectors encoding human Rho family proteins such as pEX-V-myc-G12V-Rac1 (constitutively active Rac1), pGEX-2T-RhoA, pGEX-2TK-Rac1, and pGEX-2TK-Cdc42, were kind gifts of Dr. Shu Narumiya at The University of Kyoto (Kyoto, Japan). A human RhoB cDNA, a human Rac2 cDNA, and a human Rac3 cDNA were kindly provided by Dr. Harry Mellor at The University of Bristol (Bristol, UK), Dr. Gary Bokoch at The Scripps Research Institute (La Jolla, CA), and Dr. Nora Heisterkamp at Children's Hospital Los Angeles (Los Angeles, CA), respectively. A human RhoC cDNA was PCR-amplified from cDNAs isolated from the frontal lobe of a human brain cerebrum (BioChain, Hayward, CA) with a sense primer (CGGGATCCATGGCTGCAATCCGAAAGAAGC) and an antisense primer (GGAATTCTCAGAGAATGGGACAGCCCC). A human RhoG cDNA was obtained from a human frontal lobe cDNA library (BioChain) by PCR with a sense primer (CGGGATCCATGCAGAGCATCAAGTGCGTG) and an antisense primer (GGAATTCTCACAAGAGGATGCAGGACC). cDNAs for RhoB, RhoC, RhoG, Rac2, and Rac3 were subcloned into the pGEX vector to produce recombinant proteins. cDNAs encoding Rab5A, Rab5B, and Rab5C were provided by the UMR cDNA Resource Center (www.cdna.org) and subcloned into the pGEX vectors. Dominant-negative and constitutively active mutants of a human Akt1 cDNA were kindly provided by Dr. Yukiko Gotoh at University of Tokyo (Tokyo, Japan). Mouse Akt1 and Akt2 cDNA were kindly provided by Dr. Satoru Sumitani at The University of Osaka (Osaka, Japan). Human and mouse Akt3 cDNAs were kindly provided by Dr. Brian A. Hemmings at The Friedrich Miescher Institut (Basel, Switzerland). Referring to the structure of the constitutively active human Akt1, we constructed a constitutively active mutant of human Akt3 by PCR with a sense primer (GGAATTCACCATGGGGAGTAGCAAGAGCAAGCCTAAGGACCCCAGCCAGCGCAGCGAGGAGGAAGAGATGGATGCCTC) and an antisense primer (GGGGTACCTTCTCGTCCACTTGCAGAGTAG) to delete the N-terminal PH domain and add a myristoylation site to its N terminus. Plasmid-based Small Interfering RNA (siRNA)—Gene silencing was performed according to a plasmid-based siRNA method (23Sui G. Soohoo C. Affar E.B. Gay F. Shi Y. Forrester W.C. Shi Y. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5515-5520Crossref PubMed Scopus (1060) Google Scholar). Plasmid vectors encoding siRNAs were constructed as follows. Two oligonucleotides consisting of a sense fragment and an antisense fragment were synthesized by Invitrogen. Two oligonucleotides were annealed in vitro, and the resultant double-stranded DNA fragments were subcloned into the BamHI-KpnI site of a pRNA-U6.1/Shuttle vector (Genscript, NJ). For silencing of endogenous gene expressions in NSC34 cells, a sense fragment (CGGGATCCCGTTCAGGATACCACTTTGCACGTTGATATCCGCGTGCAAAGTGGTATCCTGAATTTTTTCCAAGGTACCCC) and an antisense fragment (GGGGTACCTTGGAAAAAATTCAGGATACCACTTTGCACGCGGATATCAACGTGCAAAGTGGTATCCTGAACGGGATCCCG) for mouse Rac1, a sense fragment (CGGGATCCCGTCAATCGTATCCTTGTCATCATTGATATCCGTGATGACAAGGATACGATGATTTTTTCCAAGGTACCCC) and an antisense fragment (GGGGTACCTTGGAAAAAATCAATCGTATCCTTGTCATCACGGATATCAATGATGACAAATACGATTGACGGGATCCCGG) for mouse Rac3, a sense fragment (CGGGATCCCATAGTGGCACCATCCTTGATC TTGATATCCGGATCAAGGATGGTGCCACTATTTTTTTCCAAGGTACCCC) and an antisense fragment (GGGGTACCTTGGAAAAAAATAGTGGCACCA TCCTTGATCCGGATATCAAGATCAAGGATGGTGCCACTATGGGATCCCG) for mouse Akt1, a sense fragment (CGGGATCCCGTAATCGAAGTCATTCATGGT CTTGATATCCGGACCATGAATGACTTCGATTATTTTTTCCAAGGTACCCC) and an antisense fragment (GGGGTACCTTGGAAAAAATAATCGAAGTCA TTCATGGTCCGGATATCAAGACCATGAATGACTTCGATTACGGGATCCCG) for mouse Akt2, and a sense fragment (CGGGATCCCGTACATCTTGCCAGTTTACTCCTTGATATCCGGGAGTAAACTGGCAAGATTATTTTTTCCAAGGTACCCC) and an antisense fragment (GGGGTACCTTGGAAAAAATACATCTTGCCAGTTTACTCCCGGATATCAAGGAGTAAACTGGCAAGATGTACGGGATCCCG) for mouse Akt3, were used. Cell Culture, Transfection, and Cell Death Assays—NSC34 cells, one of the best models for primary cultured motor neurons (11Kanekura K. Hashimoto Y. Niikura T. Aiso S. Matsuoka M. Nishimoto I. J. Biol. Chem. 2004; 279: 19247-19256Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 24Cashman N.R. Durham H.D. Blusztajn J.K. Oda K. Tabira T. Shaw I.T. Dahrouge S. Antel J.P. Dev. Dyn. 1992; 194: 209-221Crossref PubMed Scopus (579) Google Scholar, 25Durham H.D. Dahrouge S. Cashman N.R. Neurotoxicology. 1993; 14: 387-395PubMed Google Scholar, 26Oosthuyse B. Moons L. Storkebaum E. Beck H. Nuyens D. Brusselmans K. Van Dorpe J. Hellings P. Gorselink M Heymans S. Theilmeier G. Dewerchin M. Laudenbach V. Vermylen P. Raat H. Acker T. Vleminckx V. Van Den Bosch L. Cashman N. Fujisawa H. Drost M.R. Sciot R. Bruyninckx F. Hicklin D.J. Ince C. Gressens P. Lupu F. Plate K.H. Robberecht W. Herbert J.M. Collen D. Carmeliet P. Nat. Genet. 2001; 28: 131-138Crossref PubMed Scopus (900) Google Scholar, 27Li B. Xu W. Luo C. Gozal D. Liu R. Brain Res. Mol. Brain Res. 2003; 111: 155-164Crossref PubMed Scopus (136) Google Scholar), were kindly provided by Dr. Neil Cashman at The University of Toronto (Toronto, Canada) and cultured in Dulbecco's modified Eagle's medium (DMEM) (Sigma) supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT) and antibiotics. NSC34 cell is a hybrid cell line of motor neurons derived from embryonic mouse spinal cord cells and mouse neuroblastoma with a number of characteristics for primary cultured motor neurons, including generation of action potential, acetylcholine synthesis, storage, and release. For transient transfection, NSC34 cells were seeded in a 6-well plate at 7 × 104 cells/well and cultured in 10% FBS, DMEM for 12–16 h and then transfected with a vector or vectors encoding alsinLF or other genes by lipofection (1 μg DNA, 2 μl of Lipofectamine, 4 μl of PLUS Reagent) in the absence of serum for 3 h. Lipofectamine and PLUS Reagent were purchased from Invitrogen. Transfected NSC34 cells were incubated with DMEM plus 10% FBS. Twenty-four hours after the onset of transfection, their culture media were changed to DMEM plus N2 supplement (Invitrogen), and cells were incubated for additional 48 h. Seventy-two hours after transfection, cell mortality was determined by trypan blue exclusion assay performed as follows. Cells were suspended by gentle pipetting, and 50 μl of 0.4% trypan blue solution (Sigma) was mixed with 200 μl of the cell suspension (final concentration 0.08%) at room temperature. Stained cells were counted within 3 min after the mixture with the trypan blue solution. 100 cells/well were counted for each trypan blue exclusion assay. Mortality of cells was then determined as a percentage of trypan blue-stained cells in total cells. Therefore, cell mortality determined by this method represents the population of dead cells in total cells, including both adhesive and floating cells, at the termination of experiments. It has been established by our previously reported experiments that our cell mortality determined with the trypan blue exclusion assay displays precisely reciprocal results to the WST-8 assay, the most established cell viability assay (11Kanekura K. Hashimoto Y. Niikura T. Aiso S. Matsuoka M. Nishimoto I. J. Biol. Chem. 2004; 279: 19247-19256Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The WST-8 assay was performed with 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt (WST-8) using Cell Counting kit-8 (Wako Pure Chemicals Industries, Osaka, Japan). Seventy-two hours after transfection, cells were suspended by gentle pipetting. One-tenth volume (100 μl) of the cell suspension was incubated with 10 μl of WST-8 solution in a 96-well plate for 2 h at 37 °C. Absorbance of the samples at the 450-nm wavelength was measured by a Wallac 1420 ARVOsx Multi Label Counter. Real-time PCR—To confirm the gene-silencing effect of siRNA, we performed real-time PCR to assess the amount of endogenous mRNA of Rac1, Rac3, Akt1, Akt2, and Akt3. NSC34 cells were transfected with pRNA-U6.1/Shuttle-siRNA for Rac1 (siRac1), siRac3, siAkt1, siAkt2, and siAkt3 as described above. Transfection efficiency was estimated to be about 70% (11Kanekura K. Hashimoto Y. Niikura T. Aiso S. Matsuoka M. Nishimoto I. J. Biol. Chem. 2004; 279: 19247-19256Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Seventy-two hours after transfection, cells were harvested for RNA extraction with ISOGEN reagent (Nippon Gene, Toyama, Japan). The first-strand cDNAs were synthesized using Sensiscript reverse transcriptase (Qiagen, Germany) with 0.5 μg of total RNA. Real-time PCR analysis was performed using a QuantiTect SYBR Green PCR kit (Qiagen) followed by analysis with ABI PRISM7700 Sequence Detection System (Applied Biosystems, Foster City, CA). Five sets of primers, consisting of a sense primer (GTCCCAATACTCCTATCATCCTC) and an antisense primer (GAGCACTCCAGGTATTTGACAG) for mouse Rac1, a sense primer (CCACACACACCCATCCTTCTG) and an antisense primer (GCACTCCAGGTACTTGACGG) for mouse Rac3, a sense primer (CACGCTACTTCCTCCTCAAG) and an antisense primer (CTCTGTCTTCATCAGCTGGC) for mouse Akt1, a sense primer (CCTTCCATGTAGACTCTCCAG) and an antisense primer (CCTCCATCATCTCAGATGTGG) for mouse Akt2, and a sense primer (CATAGGCTATAAGGAGAAACC) and an antisense primer (TTGGATAGCTTCCGTCCAC) for mouse Akt3, were synthesized. Sense and antisense primers for mouse glyceraldehyde 3-phosphate dehydrogenase were 5′-TCCACCACCCTGTTGCTGTA-3′ and 5′-ACCACAGTCCATGCCATCAC-3′, respectively. The data analyses were performed using Sequence Detection System software Version 1.9.1 (Applied Biosystems). To adjust the expression level of each mRNA, that of glyceraldehyde 3-phosphate dehydrogenase mRNA was used as an internal control. Pull-down Assays—For bacterial expression of glutathione S-transferase (GST), GST-fused Rho family proteins or GST-fused Rab5 family proteins, the pGEX vector or pGEX vectors encoding Rho family proteins including RhoA, RhoB, RhoC, RhoG, Rac1, Rac2, Rac3, and Cdc42, and a dominant-negative Rac1 (dnRac1) or Rab5 family proteins including Rab5A, Rab5B, and Rab5C were introduced into Escherichia coli. Expressions of GST, GST-Rho family proteins, or GST-Rab5 family proteins were induced by incubating with 0.2 mm isopropyl-1-thio-β-d-galactopyranoside at 30 °C for 4 h. Bacterial cells, centrifuged and resuspended in phosphate-buffered saline, were lysed with lysozyme (1 mg/ml) and sonicated in the presence of Triton X-100 (final 0.1%). GST-Rho family proteins or GST-Rab5 family proteins were then precipitated with glutathione-Sepharose beads (Amersham Biosciences) at 4 °C for 6 h. The beads were washed three times with phosphate-buffered saline. To remove preloaded nucleotides, GST-Rho family proteins or GST-Rab5 family proteins bound to glutathione-Sepharose beads were incubated with cell lysis buffer A (20 mm Tris-HCl, pH 7.5, 100 mm NaCl, 2 mm EDTA, 1 mm dithiothreitol, 0.5% Triton X-100, 0.2% sodium deoxycholate, protease inhibitors) plus 10 mm EDTA at room temperature for 1 h. Beads were then incubated with 1% bovine serum albumin-containing phosphate-buffered saline for 3 h at 4 °C. After incubation, the beads were washed with cell lysis buffer A. To prepare cell lysates containing alsinLF or T701A-alsinLF for pull-down assays, NSC34 cells, seeded at 7 × 105 cells/dish in a 10-cm culture dish, were transfected with 10 μg of plasmids encoding alsinLF or T701A-alsinLF. Cells were cultured in 10% FBS-DMEM for 48 h after transfection and then harvested for lysis with the cell lysis buffer A. After a cycle of freeze-thaw was performed, lysates were centrifuged to remove cellular debris. Supernatants were then precleaned with recombinant GST beads at 4 °C for 3 h. Precleared cell lysates (100 μg/sample) were incubated with 10 μl of GST-beads or GST-Rho family beads or GST-Rab5 family beads for 30 min at room temperature. Beads were then washed four times with the cell lysis buffer before immunoblot analysis with anti-Myc antibody. To detect activated Rac1 (GTP-Rac1), activated Cdc42 (GTP-Cdc42), and activated RhoA (GTP-RhoA), we performed a pull-down assay as follows. Chinese hamster ovary cells, seeded onto 10-cm dish at 4 × 106 cells/dish 12–16 h before transfection, were transfected with the pEF1/MycHis vector, pEF1/MycHis-alsinLF, and pEF1/MycHis-T701A-alsinLF. Forty-eight hours after transfection, cells were washed twice with ice-cold Tris-buffered saline. Cells were then lysed with ice-cold lysis buffer B (25 mm HEPES, pH 7.5, 150 mm NaCl, 1 mm EDTA, 10 mm MgCl2, 1.0% TritonX-100, protease inhibitors, 25 mm sodium fluoride, and 1 mm sodium orthovanadate). After sonication for a few seconds, cell lysates were centrifuged. Precleared lysates were then mixed and incubated with agarose beads conjugating the GST-tagged p21 binding domain of human PAK1 (GST-PBD) or the GST-tagged Rho binding domain of mouse Rhotekin (GST-RBD) (Upstate Biotech. Charlottesville, VA) for 45 min at 4 °C. GTP-Rac1/GTP-Cdc42 were precipitated with the former beads, whereas GTP-RhoA was precipitated with the latter beads. The beads were then washed three times with the lysis buffer B before immunoblot analysis with antibodies to Rac1, Cdc42, or RhoA. Establishment of NSC34 Cell Line Stably Expressing Human Akt3— NSC34 cells were transfected with pcDNA3.1(–)/MycHis-wild-type human Akt3 (wthAkt3) and cultured in DMEM medium supplemented with 10% FBS, antibiotics, and 1 mg/ml of G418 sulfate (Sigma). After a 2-week culture, G418-resistant colonies were collected, and single cell clones were obtained by limited dilution (NSC34-wthAkt3). Immunoblot Analysis—Cell lysates (20 μg/lane) or pulled-down precipitates were subject to SDS-PAGE, and separated proteins were transferred onto polyvinylidene difluoride membranes. For detection of Myc-tagged proteins, membranes were probed with the primary anti-Myc monoclonal antibody (Biomol, Plymouth Meeting, PA) and the secondary antibody, horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG polyclonal antibody (Bio-Rad) followed by visualization of the immunoreactive bands with ECL (Amersham Biosciences). For detection of endogenous Rac1, Cdc42, or RhoA, membranes were probed with the primary anti-Rac1 monoclonal antibody (BD Biosciences), rabbit anti-Cdc42 polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA), or rabbit anti-RhoA polyclonal antibody (Santa Cruz) and the secondary antibodies HRP-conjugated goat anti-mouse IgG polyclonal antibody (Bio-Rad) or HRP-conjugated goat anti-rabbit IgG polyclonal antibody (Bio-Rad). For detection of actin, amyloid-β precursor protein (APP), SOD1, presenilin1 (PS1), or presenilin2 (PS2) membranes were probed with rabbit anti-actin polyclonal antibody (Sigma), anti-APP monoclonal antibody (22C11) (Chemicon, Temecula, CA), anti-human SOD1 monoclonal antibody (Medical & Biological Laboratories, Nagoya, Japan), rat anti-PS1 antibody (Chemicon), or rabbit anti-PS2 antibody (Cell Signaling, Beverly, MA). His6/Xpress-tagged α-synuclein was detected with anti-Xpress (Invitrogen) antibody or HRP-conjugated anti-HisG antibody (Invitrogen). For detection of Myc/His6-tagged Akt1 derivatives and Myc/His6-tagged Akt3, membranes were probed with anti-Myc antibody or anti-His6 antibody. For detection of HA-tagged mouse Akt i