Portal de Periódicos da CAPES

Quantification of ADP and ATP receptor expression in human platelets

2003; Elsevier BV; Volume: 1; Issue: 2 Linguagem: Inglês

10.1046/j.1538-7836.2003.00070.x

1538-7933

Lingwei Wang, O. Östberg, A-K Wihlborg, Helén Brogren, Sverker Jern, David Erlinge,

Diabetes Treatment and Management

Journal of Thrombosis and HaemostasisVolume 1, Issue 2 p. 330-336 Free Access Quantification of ADP and ATP receptor expression in human platelets L. Wang, L. Wang Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorO. Östberg, O. Östberg Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorA-K Wihlborg, A-K Wihlborg Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorH. Brogren, H. Brogren Clinical Experimental Research Laboratory, Department of Medicine, Sahlgrenska University Hospital/Östra, Heart and Lung Institute, Göteborg University, Göteborg, SwedenSearch for more papers by this authorS. Jern, S. Jern Clinical Experimental Research Laboratory, Department of Medicine, Sahlgrenska University Hospital/Östra, Heart and Lung Institute, Göteborg University, Göteborg, SwedenSearch for more papers by this authorD. Erlinge, D. Erlinge Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this author L. Wang, L. Wang Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorO. Östberg, O. Östberg Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorA-K Wihlborg, A-K Wihlborg Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this authorH. Brogren, H. Brogren Clinical Experimental Research Laboratory, Department of Medicine, Sahlgrenska University Hospital/Östra, Heart and Lung Institute, Göteborg University, Göteborg, SwedenSearch for more papers by this authorS. Jern, S. Jern Clinical Experimental Research Laboratory, Department of Medicine, Sahlgrenska University Hospital/Östra, Heart and Lung Institute, Göteborg University, Göteborg, SwedenSearch for more papers by this authorD. Erlinge, D. Erlinge Department of Cardiology, Lund University Hospital, Lund;Search for more papers by this author First published: 07 February 2003 https://doi.org/10.1046/j.1538-7836.2003.00070.xCitations: 52 Dr David Erlinge, Department of Cardiology, Lund University Hospital, S-221 85 Lund, Sweden. Tel.: +46 46 2224707; fax: +46 46 2113417; e-mail: david.erlinge@kard.lu.se AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Abstract Summary. The mechanism of ADP-mediated platelet activation has been difficult to unravel due to the large number of receptors for extracellular nucleotides (P2 receptors). mRNA levels in circulating platelets are very low, but have been shown to be translationally active. By optimizing mRNA extraction and using real time (RT)-PCR we were able to establish a protocol for highly sensitive platelet mRNA quantification in human regular blood samples. In platelets from healthy volunteers, only P2X1, P2Y1 and P2Y12 were found in significant levels, with the following order of expression: P2Y12 >> P2X1 > P2Y1. Other P2 receptors (P2Y2, P2Y4, P2Y6, P2Y11, P2Y13, P2X4, P2X7) had very low expression. As a control measurement to exclude contamination, P2 receptors in buffy coat were quantified but had a completely different profile. Incubation in vitro revealed a more rapid degradation rate for P2X1 receptor mRNA than for P2Y1 and P2Y12, indicating that the level of P2X1 may be relatively higher in newly released platelets and in megacaryocytes. In conclusion, we have developed the first protocol for quantifying mRNA expression in human platelets limiting the P2 receptor drug development targets to P2Y12, P2Y1 and P2X1. Furthermore, the method could be used to study platelet expression for any gene in human materials. Platelets play a crucial role in the maintenance of normal hemostasis and are involved in the development of pathological thrombus formation leading to vascular occlusion which is an important mechanism in myocardial infarction and stroke [1, 2]. A large number of endogenous mediators can activate platelets, such as thromboxane A2, adenosine diphosphate (ADP), collagen, von Willebrand factor, thrombin, epinephrine and 5-hydroxitryptamine (5-HT). To get full activation of the platelets, these agonists are dependent on two positive feedback loops: the formation of thromboxane A2 by cyclooxygenase in the platelets and the release of ADP from dense platelet granules. Thromboxane A2 and ADP then activates specific receptors on the extracellular side of the platelet membrane. Therapeutic intervention aimed at the first positive feedback loop by inhibiting cyclooxygenase with aspirin is highly efficient in reducing death and cardiovascular events. However, ADP may be even more important as evidenced by the CAPRIE study, in which the ADP receptor inhibition was more beneficial than aspirin in reducing cardiovascular events [3, 4]. Recently, progress has been made in the understanding of the mechanisms of ADP mediated platelet aggregation, where at least three receptors are considered to be involved; the P2Y12, P2Y1, and P2X1 receptors [5]. The importance of the P2Y12 receptor is proven by the effects of clopidogrel, which after metabolization in the liver, acts as an irreversible antagonist at P2Y12 receptors. Knockout of the P2Y1 receptor in mice has demonstrated its importance for thrombus formation, bleeding time, ADP-stimulated platelet aggregation and importantly, also for collagen, thromboxane and thrombin induced platelet aggregation [6, 7]. With respect to the P2X1 receptor, it was reported that activation by its specific agonist α,β-methylene ATP did not elicit human platelet aggregation or the associated shape change [5]. However, during platelet isolation some ATP release occurs which may desensitize the P2X1 receptor [8], and there is now evidence that, when this is avoided, α,β-methylene ATP evokes a P2X1-receptor-like Ca2+ influx and shape change in platelets [9]. These receptors belong to the large family of P2 purinoceptors, receptors for extracellular nucleotides (ADP, ATP, UTP, UDP) [5, 10]. These P2 receptors include two subgroups: fast, ionotropic P2X receptors and P2Y receptors, which are G protein-coupled receptors. At least seven subtypes of P2X (P2X1−7) and seven subtypes of P2Y (P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12 and P2Y13) have been identified in human tissue. The circulating platelets contain very low amounts of mRNA [11], which is derived from their progenitor cell, the megakaryocyte [12]. Platelets have no ability to produce new mRNA due to their lack of a nucleus. It was recently demonstrated that activated platelets translate constitutive mRNAs into proteins [13-15]. Activation of platelets does not appear to decrease their life span [16-18], and this may be related to functional mRNAs in platelets. So it would be of interest to know the mRNA expression in platelets to better understand their gene regulatory mechanisms. Even though mRNA in platelets has been detected with PCR [19-21], no previous methods for quantification of platelet mRNA has been reported. The mRNA of a gene could reflect two aspects. First, since platelet mRNA has been shown to be translationally active it is likely to regulate protein expression also during the 10-day life span of a circulatory platelet. Second, evaluation of mRNA levels may be used to reflect the level in the megacaryocyte in the bone marrow. It is difficult to isolate and study megacaryocytes from patients. Instead, measurements of circulating platelet mRNA could be used to indirectly study alterations in the megacaryocyte during different pathophysiological situations. The large number of P2 receptors combined with the lack of selective antagonist for most of them prompted us to try to quantify the expression of the most relevant receptor subtypes in human platelets. As far as we know, no one has previously quantified mRNA in human platelets. By optimizing platelet mRNA extraction and using real time (RT)-PCR we were able to establish a protocol for highly sensitive platelet mRNA quantification in regular blood samples. Furthermore, Western blot was used for protein quantification. The results demonstrate highest levels for the P2Y12 receptor, but also expression of P2X1 and P2Y1 receptors. Materials and methods The studies were approved by the local Ethics Committee of the Lund University and were conducted according to the principles of the Declaration of Helsinki. Platelet preparation Thirty-five milliliters of blood was drawn from each of 19 healthy volunteers (who had given informed consent) into EDTA vials, followed by centrifugation at 150 g for 20 min. Supernatant (platelet-rich plasma) was collected without buffy coat and packed erythrocytes. Contaminating leukocytes and erythrocytes were removed by an additional centrifugation for 10 min at 150 g. Platelets were pelleted at 800 g for 15 min. Possible contamination of platelet RNA specimens with leukocyte RNA was ruled out by reverse transcription-PCR amplification (negative) of β2 integrin, which presents in leukocytes but not in platelets, using specific primers (sense primer: CCTCTCTCAGGAGTGCACGA, antisense primer: ACGGTCTTGTCCACGAAGGA). Buffy coat remained after supernatant (platelet-rich plasma) was removed, centrifuged at 1300 g for 15 min, supernatant was discarded and the remaining pellet was used for control experiments. Platelet incubation Human blood for platelet incubation from three healthy volunteers was drawn into syringes containing acid-citrate-dextrose (ACD) anticoagulant and was centrifuged to obtain platelet-rich plasma. Platelet-rich plasma was recentrifuged in the presence of 100 nmol L−1 PGE-1. Platelet pellet was washed by calcium-free saline (145 mmol L−1 NaCl, 5 mmol L−1 KCl, 1 mmol L−1 MgCl2, 10 mmol L−1 Hepes, 10 mmol L−1 glucose, pH 7.35) containing 100 nmol L−1 of PGE-1, and then resuspended in M199 medium (phenol red free; Gibco BRL, Life Technology). Equal volumes of suspensions were incubated at 37 °C for 0 h and 20 h. The platelets were pelleted by centrifugation and the pellets were saved in −70 °C for RNA isolation. RNA and protein extraction Total cellular RNA and protein were extracted using TRIzol reagent (Gibco BRL, Life Technology) according to the supplier's instructions. RNA was dissolved in diethyl-pyrocarbonate (DEPC)-treated water. The RNA concentration was determined spectrophotometrically considering a ratio of optical density (OD)260 : 280 > 1.6 as pure. Thirty-five milliliters of whole blood yielded approximately 12 µg total platelet RNA. Samples were stored at −70 °C until used. The protein pellet was finally washed with 100% ethanol, vacuum dried and resolved in 1% sodium dodecyl sulfate solution. DC Protein Assay (Bio-Rad Laboratories AB, Hercules, CA, USA) was used to detect the protein concentration. Protein samples were stored at −20 °C until used. Quantitative analysis of P2 receptors by real-time reverse transcription polymerase chain reaction TaqMan Reverse Transcription Reagents Kit was used to transcribe mRNA into cDNA. Real-time PCR were performed by means of a PRISM 7700 Sequence Detector as described previously [22]. rRNA was detected according to the product protocol (TaqMan Ribosomal RNA Control Reagents). Oligonucleotide primers and TaqMan probes were designed using the Primer Express software, based on sequences from the GenBank database. Primer and probe sequences have previously been reported in Wang et al. [22] except P2Y12 and P2Y13 (Table 1). Each primer pair was selected so that the amplicon spanned an exon junction if present, to avoid amplification of genomic DNA. Constitutively expressed rRNA and GAPDH were selected as endogenous control to correct for potential variation in RNA loading or efficiency of the amplification reaction. Table 1. Oligonucleotide primers and probes used for real time quantitative PCR Gene/accession Oligonucleotide Sequence Position P2Y12 Sense primer 5′- TCCATTTTGCCCGAATTCC-3′ 829–847 AF313449 Antisense primer 5′-CAGAGTATTTTCAGCAGTGCAGTCA-3′ 902–878 Probe 5′-(FAM)CCTGAGC CAAACCCGGGATGTCT (TAMRA)p-3′ 854–876 P2Y13 Sense primer 5′- CGGTGCCCCAGAGACACT-3′ 40–57 AF406692 Antisense primer 5′-GATGCCGGTCAAGAAAACCA-3′ 114–95 Probe 5′-(FAM)ACAGCTGGTATTCCCAGCCCTCTACACA (TAMRA)p-3′ 66–93 P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2X1, P2X4, P2X7 see Wang et al. [22] Previous analysis showed that amplification efficiencies were almost identical for GADPH and the following receptor mRNAs: P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2X1, P2X4, and P2X7 normalized to GAPDH [22]. We also found that P2Y12 and P2Y13 normalized to GAPDH had identical amplification efficiency as above (data not shown). We further found that P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12, P2Y13, P2X1, P2X4, and P2X7 had almost identical amplification efficiencies when normalized to rRNA (data not shown). To confirm equal amplification efficiencies, we used the criterion of a regression slope of less than 0.1 for each gene normalized to GAPDH or rRNA. This confirms that we could use the comparative CT method for the relative quantification of target without running standard curves on the same plate (Perkin-Elmer Applied Biosystems Inc; User Bulletin no. 2, December 1997). The target gene normalized to GAPDH or rRNA was expressed as ΔCT (CT of target gene minus CT of rRNA or GAPDH). P2Y1 in platelets was arbitrarily chosen to be the calibrator in the comparative analysis and is expressed as ΔCTP2Y1-pl (CT of target minus CT of rRNA or GAPDH for platelet P2Y1). The normalized calibrated value is given by the equation 2 − where ΔΔCT is ΔCT − ΔCTP2Y1–pl (Bulletin no. 2, 1997). To further verify the specificity of PCR assays, the PCR was performed with non-reverse-transcribed total cellular RNA and samples lacking the DNA template. No significant amplifications were obtained in any of these samples (data not shown). We also put one comparable sample in each plate to get comparable data due to two kinds of labeled probes (FAM and VIC) were used. We found that the CT values of GAPDH in platelet samples or in buffy coat samples were similar, but with a difference of approximately two cycles between platelets and buffy coat, while we found similar expression of rRNA in platelets and buffy coat. Therefore, we used both GAPDH and rRNA as endogenous control genes when we compared different gene expression in platelets or buffy coat, but we used only rRNA as control gene when we compared the same gene expression between platelets and buffy coat. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and Western blotting SDS–PAGE and Western blotting were performed as described elsewhere [22]. Briefly protein electrophoresis was performed on 10% Tri-HCl polyacrylamide ready gels and electroblotted onto Hybond-C extra nitrocellulose membranes. Membranes were incubated with rabbit antihuman P2Y1, P2X1 antibodies and negative control (peptide antigen preincubated with the same amount of antibody). Membranes were then incubated with a secondary antibody [antirabbit IgG, horseradish peroxidase (HRP)-linked]. Proteins were visualized by chemiluminescence using the ECL™ Western blotting system and the signals were detected by autoradiography. The signal intensity (integral volume) of the appropriate bands on autoradiogram was analyzed using a Scanner and the Quantity One® software. N-Glycosidase F For removal of all N-linked glycosylations under denaturing conditions, N-Glycosidase F Deglycosylation Kit (Roche Diagnostics, Mannheim, Germany) was used according to the supplier's instructions. Reagents and antibodies Unless otherwise stated, all reagents and drugs were purchased from Sigma Chemical Corp, St. Louis, MI, USA. PCR consumables were purchased from Perkin-Elmer Applied Biosystems Inc, Foster City, CA, USA. Some Western blot reagents were from Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK or Bio-Rad Laboratories, USA. Anti-P2X1 and anti-P2Y1 antibodies were purchased from Alomone Laboratories, Israel. Statistical methods Data are expressed as mean and standard error of the mean (SEM) unless otherwise stated. n indicates the number of subjects tested. Statistical analysis of the normalized CT values (ΔCT) was performed with a one-way anova, followed by a multiple comparison post test (Tukey's test) (different genes in the same tissue) and Student's t-test (the same gene in different tissues) using GraphPad InStat version 3.00 (GraphPad Software Inc., USA). Differences were considered significant at P < 0.05 (two-tailed test). Separate analyses were performed with the two control genes, GAPDH and rRNA. Similar levels of statistical significance were obtained using target gene normalized to either GAPDH or rRNA when we compared different genes in platelets or in buffy coat. rRNA was only chosen to be an endogenous control gene when we compared the same target gene between platelets and buffy coat. Results mRNA quantification In platelets (n = 9), P2Y12, P2X1 and P2Y1 were the most abundantly expressed mRNAs, while P2Y2, P2Y4, P2Y6, P2Y11, P2Y13, P2X4, and P2X7 had extremely low expression levels (Fig. 1a). To illustrate expression of the P2 receptors relative to each other, the P2Y1 receptor was used as a calibrator for the others, i.e. the other receptors were expressed as a ratio of the P2Y1. Among the P2Y1, P2Y12 and P2X1 receptor subtypes the P2Y12 had the highest expression and had significantly higher expression than P2Y1 (P < 0.0001) and P2X1 (P < 0.0001). P2X1 was significant higher than P2Y1 (P < 0.001). Compared with buffy coat, P2X1 in platelets was much higher than that in buffy coat (P < 0.0001) and P2Y1 in platelets was lower than that in buffy coat (P < 0.05). Figure 1Open in figure viewerPowerPoint Bar graphs show expression of P2 receptors normalized to rRNA in platelets (a) and buffy coat (b). P2Y1 in platelets was chosen to be the calibrator. In buffy coat (n = 3), P2Y1, P2Y2, P2Y4, P2Y6, P2Y11, P2Y12, P2Y13, P2X1, P2X4 and P2X7 could be detected, but P2X1, P2X4 and P2X7 were present in low levels (Fig. 1b). In the figure, expressions of the P2 receptors were shown relative to each other and the P2Y1 receptor in the platelets was used as calibrator for the others, i.e. the other receptors were expressed as a ratio of the P2Y1 in platelets. Among the P2 receptor subtypes the P2Y11 had the highest expression and had significantly higher expression than P2Y1 (P < 0.05), P2Y4 (P < 0.05) and P2Y6 (P < 0.05). After 20 h incubation, the total RNA decreased to 78.9 ± 8.9%. We used 1 µg of RNA both from incubation in 0 h and 20 h to do real-time RT-PCR (n = 3, analyzed in triplicate) and the results reported below were similar whether normalized to GAPDH or rRNA (Fig. 2). P2Y12 mRNA levels were unaltered after 20 h incubation compared with 0 h incubation (P > 0.05). P2Y1 levels decreased to 74.5 ± 11.9% after 20 h but there was no significant difference (P > 0.05). P2X1 decreased to 15.4 ± 1.4% after 20 h compared with 0 h (P < 0.01). Figure 2Open in figure viewerPowerPoint Bar graph showing expression of P2 receptors normalized to GAPDH in platelets after incubation for 0 h and 24 h. P2Y1 at 0 h was chosen as the calibrator. Data are expressed as means ± SEM of three separate individuals, each assayed in triplicate. ** indicates significant difference compared with incubation in 0 h (P < 0.01). Western blotting The distribution of the anti-P2X1 receptors in platelets is shown in Western blotting in Fig. 3. In all healthy volunteers, there was a band around 55-kDa in anti-P2X1 membrane and no band in the peptide control membrane (anti-P2X1 antibody preincubated with the same amount of control peptide antigen). That indicated that the 55-kDa band represents the P2X1 receptor. Figure 3Open in figure viewerPowerPoint Western blot of P2X1 subtype in platelets. There was a band around 55-kDa in Platelets. In peptide control membrane (anti-P2X1 antibody preincubated with the same amount of control peptide antigen), no band was found. P1–7 indicates samples from different healthy volunteers. There was a P2Y1 band around 180 kDa (Fig. 4) in all healthy volunteers. No band was found in the peptide control membrane, indicating that the 180-kDa band represents the P2Y1 receptor. The predicted molecular mass of P2Y1 receptor has been reported as 42 kDa [23]. The band size difference has also been found in rat brain membrane and in human platelets by Western blot (Alomone Laboratories, see product certificate). To examine if this indicated oligomerization in platelets, we tried to separate possible protein associations in the molecule by treating samples with Triton X-100 (5%), EDTA (10 mmol L−1), dithiothreitol (20 mmol L−1), or by prolonging incubation time (30 min with 37 °C) in addition to β-mercaptoethanol (5%), but neither of these protocols changed the band size (Fig. 5a). Another possible explanation for increased molecular mass is glycosylation of the receptor in its extracellular domain. Deglycosylation treatment reduced the band size from a 180- to a 150-kDa band (Fig. 5b). Unfortunately, it was impossible to perform Western blotting for the P2Y12 receptor as there were no antibodies available. Figure 4Open in figure viewerPowerPoint Western blot of P2Y1 subtype in platelets. There was a band around 180 kDa in platelets. No band was found in peptide control membrane (anti-P2Y1 antibody preincubated with the same amount of control peptide antigen). P1–7 indicates samples from different healthy volunteers. Figure 5Open in figure viewerPowerPoint Western blot of P2Y1 subtype in platelets with different conditions. (a) Addition of neither Triton X-100, EDTA nor dithiothreitol in addition to β-mercaptoethanol changed the 180-kDa band. (b) A band appeared at around 180 kDa in platelets without N-glycosidase F treatment (P−) and at around 150 kDa in platelets with N-glycosidase F treatment (P+). Data are representative of three independent experiments. 95 °C, 95 °C for 4 min; 37 °C, 37 °C for 30 min; β, β-mercaptoethanol (5%); T, Triton X-100 (5%); E, EDTA (10 mmol L−1); D, dithiothreitol (20 mmol L−1). In this small amount of material, we found no linear relationship between P2Y1, P2Y12, P2X1 gene and P2Y1, P2X1 protein level (data not shown). Discussion In this study, we have developed a method to quantify mRNA expression in circulating human platelets from regular blood samples. The most abundant P2 receptor was P2Y12, followed by P2X1 and P2Y1. Other P2 receptors had very low expression. Protein expression was found for both P2X1 and P2Y1 receptors where the P2Y1 receptor might exist in an oligomerized form. Platelets retain numerous mRNAs from megakaryocytes, these mRNAs are functional and translate to protein by cellular activation [24]. There are some previous studies in which regular RT-PCR has been used to detect mRNA in platelets [19-21], but no-one has been able to set up a quantification method, probably due to the large amount of total RNA needed for previous RNA quantification methods. Realtime PCR is a recent quantitative method with the advantage that extremely low amounts of sample RNA are needed [25]. We first used large quantities of platelets (four units of platelets prepared for patient use), and found that it was possible to quantify the mRNA. However we found evidence of contamination with other cell types, probably white blood cells, and it would never be possible to obtain such a large number of platelets from patients likely to be included in clinical studies. After extensive testing, a simple protocol for platelet mRNA extraction from regular blood samples was developed. One crucial point is the use of EDTA vials. Use of citrate vials resulted in much lower and less pure RNA, probably due to platelet activation during the centrifugation steps. In total, 35 mL of whole blood is needed to give approximately 12 µg of total RNA with a high purity. This is enough to quantify a large number of genes with real-time PCR. The next problem was the risk of contamination. As the platelets contain very low amounts of RNA, even a very small contamination of other cell types could have a great impact on the result. First, we carried out regular RT-PCR for β2 integrin, which is specifically expressed in leukocytes [26], and found that the method did not yield any significant contamination. Second, the P2 receptor subtype expression was quantified in the buffy coat. The expression pattern was strikingly different from the platelets. All the P2Y receptors were expressed with highest levels for P2Y11, while the P2X receptors analyzed were expressed at very low levels (Fig. 1b). In itself, it is an interesting finding that the white cell rich buffy coat has such a dominating P2Y receptor profile and that the P2Y11 receptor is so highly expressed, but it was not the focus of our study. Furthermore, the buffy coat is a mixture of cell types, including different types of white blood cells, erythrocytes and platelets. Platelets in the buffy coat are probably responsible for the high P2Y12 levels. To us, the buffy coat analysis suggested that we could use the P2Y11 receptor expression as a control to exclude contamination of the platelet samples. As seen in Fig. 1(a), almost no expression was found for P2Y11 in platelet mRNA. The finding of P2Y12, P2X1 and P2Y1 receptor mRNA in human platelets strongly supports previous pharmacological studies. The lack of expression of other P2 receptors clarifies the picture and suggests that future efforts to develop new antiplatelet agents should focus on the P2Y12, P2X1 and P2Y1 receptors. The dominating expression of P2Y12 receptor mRNA was impressive. It was fourfold higher than that of P2X1 and 12 times higher than P2Y1. It could indicate that P2Y12 is indeed the most important ADP receptor in platelets, which is supported by the clinical effects of its antagonist clopidogrel. On the other hand there are objections to this assumption. First, it is not certain that the mRNA level correlates linearly with its protein expression, as there may be variations in translational efficiency. Second, the second messenger systems of the subtypes are different. The P2Y1 receptor couples to Gq and mobilizes intracellular calcium ions to mediate platelet shape change and aggregation. P2Y12 is coupled to inhibition of cAMP production by adenylyl cyclase through Gi. Co-activation of P2Y1 and P2Y12 receptors is required for normal ADP-evoked aggregation [27, 28]. It is possible that a fewer number of P2Y1 receptors may have a similar effect on platelet aggregation to a larger number of P2Y12 receptors. The P2X1 receptor was the second most abundantly expressed receptor suggesting that it may be of physiological importance. So far, it has been difficult to demonstrate involvement of P2X1 in platelet aggregation, either by itself or as a potentiator of other agonists. However, this may be dependent on desensitization of the receptor by ATP release during isolation and centrifugation. Some recent studies have been able to demonstrate P2X1-mediated amplification of the responses to both collagen and P2Y receptors [29, 30]. Our findings of high P2X1 expression in platelets together with reports of a patient with bleeding disorder with a dominant-negative mutation in the platelet P2X1 receptor [31, 32], suggests that a synergistic role for this receptor in platelet aggregation merits investigation in more physiological assays. The level of mRNA at a given time-point is dependent on both its synthesis and degradation rates. We therefore examined the mRNA levels both before and after platelet incubation in vitro for 20 h. The P2Y12 receptor mRNA was unchanged in relation to the two reference genes, but P2Y1 was slightly reduced. Surprisingly, the P2X1 receptor mRNA was reduced by as much as 85%. This means that P2X1 has a much shorter half-life in platelets and that the mRNA expression of P2X1 receptors is underestimated in our measurements. Thus, the P2X1 mRNA level may be markedly higher in fresh platelets or megacaryocytes. The P2X1 and P2Y1 receptors were also studied using Western blotting but unfortunately no antibodies were available for the recently cloned P2Y12 receptor. The P2X1 receptor was detected as a strong band in the expected size of approximately 55 kDa in all individuals. However, the P2Y1 receptor which, as calculated from its coding sequence, was expected to be 42 kDa [23], was consistently found as a single band of 180 kDa. This might represent oligomerization of the receptor protein. To separate possible protein associations the samples were treated with Triton X-100 (5%), EDTA (10 mmol L−1), dithiothreitol (20 mmol L−1), or by prolonging incubation time (30 min with 37 °C) in addition to β-mercaptoethanol (5%), but neither of these protocols changed the band size. Another possible explanation for increased molecular mass is glycosylation of the receptor in its extracellular domain. There was a reduction to a 150-kDa band after treatment with the deglycosylation kit, different to the 180-kDa band without deglycosylation, demonstrating that glycosylation occurs; however, this is insufficient to explain the increased molecular weight. Thus, although we do not have direct evidence, these experiments suggest that an oligomerization of the P2Y1 receptor may occur, which may be of importance for its function. However, it is also possible that the antibody recognizes some other protein. In conclusion, we have established the first protocol for quantification of mRNA in human circulating platelets. The method can be used in clinical studies for any cloned gene to study platelet gene expression in, for example, patients with bleeding disorders or cardiovascular disease. Whether the measured mRNA reflects only transcriptional regulation in the megakaryocyte, or whether it is active in regulating protein expression in the circulating platelets, remains to be explored. We found high levels of the P2Y12, P2X1 and P2Y1. This finding may help direct future drug development and possibly be used in individual patients to select the most beneficial therapy. Acknowledgements The study has been supported by the Swedish Heart and Lung Foundation, Franke and Margareta Bergqvist Foundation, the Wiberg Foundation, the Bergwall Foundation, the Zoegas Foundation, the Netpharma foundation, the Tore Nilsson Foundation, and Swedish Medical Research Council Grant 13130 (DE) and 9046 (SJ). References 1 Gachet C. ADP receptors of platelets and their inhibition. Thromb Haemost 2001; 86: 222– 32.CrossrefCASPubMedWeb of Science®Google Scholar 2 Solet DJ, Zacharski LR, Plehn JF. The role of adenosine 5′-diphosphate receptor blockade in patients with cardiovascular disease. Am J Med 2001; 111: 45– 53.CrossrefCASPubMedWeb of Science®Google Scholar 3 Gachet C. Platelet activation by ADP. the role of ADP antagonists. Ann Med 2000; 32 (Suppl. 1): 15– 20.CASPubMedGoogle Scholar 4 A. randomised, blinded, trial of clopidogrel versus aspirin in patients at risk of ischaemic events (CAPRIE). CAPRIE Steering Committee. Lancet 1996; 348: 1329– 39.CrossrefPubMedGoogle Scholar 5 Kunapuli SP. Multiple P2 receptor subtypes on platelets: a new interpretation of their function. Trends Pharmacol Sci 1998; 19: 391– 4.CrossrefCASPubMedWeb of Science®Google Scholar 6 Fabre JE, Nguyen M, Latour A, Keifer JA, Audoly LP, Coffman TM, Koller BH. Decreased platelet aggregation, increased bleeding time and resistance to thromboembolism in P2Y1-deficient mice. Nat Med 1999; 5: 1199– 202.CrossrefCASPubMedWeb of Science®Google Scholar 7 Leon C, Freund M, Ravanat C, Baurand A, Cazenave JP, Gachet C. Key role of the P2Y(1) receptor in tissue factor-induced thrombin- dependent acute thromboembolism: studies in P2Y(1)-knockout mice and mice treated with a P2Y(1) antagonist. Circulation 2001; 103: 718– 23.CrossrefCASPubMedWeb of Science®Google Scholar 8 North RA, Surprenant A. Pharmacology of cloned P2X receptors. Annu Rev Pharmacol Toxicol 2000; 40: 563– 80.CrossrefCASPubMedWeb of Science®Google Scholar 9 Rolf MG, Brearley CA, Mahaut-Smith MP. Platelet shape change evoked by selective activation of P2X1 purinoceptors with alpha,beta-methylene ATP. Thromb Haemost 2001; 85: 303– 8.CrossrefCASPubMedWeb of Science®Google Scholar 10 Cusack NJ, Hourani SM. Platelet P2 receptors: from curiosity to clinical targets. J Auton Nerv Syst 2000; 81: 37– 43.CrossrefCASPubMedWeb of Science®Google Scholar 11 Sottile J, Mosher DF, Fullenweider J, George JN. Human platelets contain mRNA transcripts for platelet factor 4 and actin. Thromb Haemost 1989; 62: 1100– 2.CrossrefCASPubMedWeb of Science®Google Scholar 12 Power CA, Clemetson JM, Clemetson KJ, Wells TN. Chemokine and chemokine receptor mRNA expression in human platelets. Cytokine 1995; 7: 479– 82.CrossrefCASPubMedWeb of Science®Google Scholar 13 Lindemann S, Tolley ND, Dixon DA, McIntyre TM, Prescott SM, Zimmerman GA, Weyrich AS. Activated platelets mediate inflammatory signaling by regulated interleukin 1beta synthesis. J Cell Biol 2001; 154: 485– 90.CrossrefCASPubMedWeb of Science®Google Scholar 14 Weyrich AS, Dixon DA, Pabla R, Elstad MR, McIntyre TM, Prescott SM, Zimmerman GA. Signal-dependent translation of a regulatory protein, Bcl-3, in activated human platelets. Proc Natl Acad Sci USA 1998; 95: 5556– 61.CrossrefCASPubMedWeb of Science®Google Scholar 15 Pabla R, Weyrich AS, Dixon DA, Bray PF, McIntyre TM, Prescott SM, Zimmerman GA. Integrin-dependent control of translation: engagement of integrin alphaIIbbeta3 regulates synthesis of proteins in activated human platelets. J Cell Biol 1999; 144: 175– 84.CrossrefCASPubMedWeb of Science®Google Scholar 16 Michelson AD, Barnard MR, Hechtman HB et al. In vivo tracking of platelets: circulating degranulated platelets rapidly lose surface P-selectin but continue to circulate and function. Proc Natl Acad Sci USA 1996; 93: 11877– 82.CrossrefCASPubMedWeb of Science®Google Scholar 17 Berger G, Hartwell DW, Wagner DD. P-Selectin and platelet clearance. Blood 1998; 92: 4446– 52.CrossrefCASPubMedWeb of Science®Google Scholar 18 Dale GL. Platelet kinetics. Curr Opin Hematol 1997; 4: 330– 4.CrossrefPubMedGoogle Scholar 19 Djaffar I, Vilette D, Bray PF, Rosa JP. Quantitative isolation of RNA from human platelets. Thromb Res 1991; 62: 127– 35.CrossrefCASPubMedWeb of Science®Google Scholar 20 Newman PJ, Gorski J, White GC 2nd, Gidwitz S, Cretney CJ, Aster RH. Enzymatic amplification of platelet-specific messenger RNA using the polymerase chain reaction. J Clin Invest 1988; 82: 739– 43.CrossrefCASPubMedWeb of Science®Google Scholar 21 Leon C, Hechler B, Vial C, Leray C, Cazenave JP, Gachet C. The P2Y1 receptor is an ADP receptor antagonized by ATP and expressed in platelets and megakaryoblastic cells. FEBS Lett 1997; 403: 26– 30.Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 22 Wang L, Karlsson L, Moses S, Hultgårdh-Nilsson A, Andersson M, Borna C, Gudbjartsson T, Jern S, Erlinge D. P2 Receptor profiles in human vascular smooth muscle and endothelial cells. J Cardiovasc Pharmacol 2002; 40: 841– 53.CrossrefCASPubMedWeb of Science®Google Scholar 23 Hoffmann C, Moro S, Nicholas RA, Harden TK, Jacobson KA. The role of amino acids in extracellular loops of the human P2Y1 receptor in surface expression and activation processes. J Biol Chem 1999; 274: 14639– 47.CrossrefCASPubMedWeb of Science®Google Scholar 24 Lindemann S, Tolley ND, Eyre JR, Kraiss LW, Mahoney TM, Weyrich AS. Integrins regulate the intracellular distribution of eukaryotic initiation factor 4E in platelets. A checkpoint for translational control. J Biol Chem 2001; 276: 33947– 51.CrossrefCASPubMedWeb of Science®Google Scholar 25 Higuchi R, Fockler C, Dollinger G, Watson R.Kinetic PCR analysis. Real-time monitoring of DNA amplification reactions. Biotechnology (NY) 1993; 11: 1026– 30. CrossrefPubMedWeb of Science®Google Scholar 26 Sun B, Li J, Okahara K, Kambayashi J. P2X1 purinoceptor in human platelets. Molecular cloning and functional characterization after heterologous expression. J Biol Chem 1998; 273: 11544– 7.CrossrefCASPubMedWeb of Science®Google Scholar 27 Woulfe D, Yang J, Brass L. ADP and platelets: the end of the beginning. J Clin Invest 2001; 107: 1503– 5.CrossrefCASPubMedWeb of Science®Google Scholar 28 Nicholas RA. Identification of the P2Y(12) receptor: a novel member of the P2Y family of receptors activated by extracellular nucleotides. Mol Pharmacol 2001; 60: 416– 20.CASPubMedWeb of Science®Google Scholar 29 Oury C, Toth-Zsamboki E, Thys C, Tytgat J, Vermylen J, Hoylaerts MF. The ATP-gated P2X1 ion channel acts as a positive regulator of platelet responses to collagen. Thromb Haemost 2001; 86: 1264– 71.CrossrefCASPubMedWeb of Science®Google Scholar 30 Vial C, Rolf MG, Mahaut-Smith MP, Evans RJ. A study of P2X(1) receptor function in murine megakaryocytes and human platelets reveals synergy with P2Y receptors. Br J Pharmacol 2002; 135: 363– 72.Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 31 Greco NJ, Tonon G, Chen W, Luo X, Dalal R, Jamieson GA. Novel structurally altered P(2X1) receptor is preferentially activated by adenosine diphosphate in platelets and megakaryocytic cells. Blood 2001; 98: 100– 7.CrossrefCASPubMedWeb of Science®Google Scholar 32 Oury C, Toth-Zsamboki E, Van Geet C et al. A natural dominant negative P2X1 receptor due to deletion of a single amino acid residue. J Biol Chem 2000; 275: 22611– 4.CrossrefCASPubMedWeb of Science®Google Scholar Citing Literature Volume1, Issue2February 2003Pages 330-336 FiguresReferencesRelatedInformation