Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Apoptosis Induced by the Kinase Inhibitor BAY 43-9006 in Human Leukemia Cells Involves Down-regulation of Mcl-1 through Inhibition of Translation

2005; Elsevier BV; Volume: 280; Issue: 42 Linguagem: Inglês

10.1074/jbc.m506551200

ISSN

1083-351X

Autores

Mohamed Rahmani, Eric Maynard Davis, Cheryl Bauer, Paul Dent, Steven Grant,

Tópico(s)

Protein Kinase Regulation and GTPase Signaling

Resumo

BAY 43-9006 is a kinase inhibitor that induces apoptosis in a variety of tumor cells. Here we report that treatment with BAY 43-9006 results in marked cytochrome c and AIF release into the cytosol, caspase-9, -8, -7, and -3 activation, and apoptosis in human leukemia cells (U937, Jurkat, and K562). Pronounced apoptosis was also observed in blasts from patients with acute myeloid leukemia. These events were accompanied by ERK1/2 inactivation and caspase-independent down-regulation of Mcl-1. Inducible expression of a constitutively active MEK1 construct did not prevent Mcl-1 down-regulation, suggesting that this event is not related to MEK/ERK pathway inactivation. Furthermore, BAY 43-9006 did not induce major changes in Mcl-1 mRNA levels monitored by real-time PCR or Mcl-1 promoter activity demonstrated by luciferase reporter assays, but it did enhance Mcl-1 down-regulation in actinomycin D-treated cells. Inhibition of protein synthesis by cycloheximide or proteasome function with MG132 and pulse-chase studies with [35S]methionine demonstrated that BAY 43-9006 did not diminish Mcl-1 protein stability, nor did it enhance Mcl-1 ubiquitination, but instead markedly attenuated Mcl-1 translation in association with the rapid and potent dephosphorylation of the eIF4E translation initiation factor. Finally, ectopic expression of Mcl-1 in leukemic cells markedly inhibited BAY 43-9006-mediated cytochrome c cytosolic release, caspase-9, -7, and -3 activation, as well as cell death, indicating that Mcl-1 operates upstream of cytochrome c release and caspase activation. Together, these findings demonstrate that BAY 43-9006 mediates cell death in human leukemia cells, at least in part, through down-regulation of Mcl-1 via inhibition of translation. BAY 43-9006 is a kinase inhibitor that induces apoptosis in a variety of tumor cells. Here we report that treatment with BAY 43-9006 results in marked cytochrome c and AIF release into the cytosol, caspase-9, -8, -7, and -3 activation, and apoptosis in human leukemia cells (U937, Jurkat, and K562). Pronounced apoptosis was also observed in blasts from patients with acute myeloid leukemia. These events were accompanied by ERK1/2 inactivation and caspase-independent down-regulation of Mcl-1. Inducible expression of a constitutively active MEK1 construct did not prevent Mcl-1 down-regulation, suggesting that this event is not related to MEK/ERK pathway inactivation. Furthermore, BAY 43-9006 did not induce major changes in Mcl-1 mRNA levels monitored by real-time PCR or Mcl-1 promoter activity demonstrated by luciferase reporter assays, but it did enhance Mcl-1 down-regulation in actinomycin D-treated cells. Inhibition of protein synthesis by cycloheximide or proteasome function with MG132 and pulse-chase studies with [35S]methionine demonstrated that BAY 43-9006 did not diminish Mcl-1 protein stability, nor did it enhance Mcl-1 ubiquitination, but instead markedly attenuated Mcl-1 translation in association with the rapid and potent dephosphorylation of the eIF4E translation initiation factor. Finally, ectopic expression of Mcl-1 in leukemic cells markedly inhibited BAY 43-9006-mediated cytochrome c cytosolic release, caspase-9, -7, and -3 activation, as well as cell death, indicating that Mcl-1 operates upstream of cytochrome c release and caspase activation. Together, these findings demonstrate that BAY 43-9006 mediates cell death in human leukemia cells, at least in part, through down-regulation of Mcl-1 via inhibition of translation. The Ras/Raf/mitogen-activated protein kinase (MEK) 2The abbreviations used are: MEKmitogen-activated protein kinase/extracellular signal-regulated kinase kinaseERKextracellular signal-regulated kinaseAMLacute myeloid leukemiaMcl-1myeloid cell leukemia-1PARPpoly(ADP-ribose) polymerasez-VAD-FMKbenzyloxycarbonyl-VAD-fluoromethyl ketoneHAhemagglutininJNKc-Jun N-terminal kinasemTORmammalian target of rapamycinCAconstitutively activeAIFapoptosis inducing factorFABFrench-American-British. /extracellular-signal-regulated kinase (ERK) cascade plays a critical role in relaying signals from cell surface receptors to various cytoplasmic and nuclear proteins involved in diverse biological process such as cell growth, transformation, differentiation, and apoptosis (1Chang F. Steelman L.S. Lee J.T. Shelton J.G. Navolanic P.M. Blalock W.L. Franklin R.A. McCubrey J.A. Leukemia. 2003; 17: 1263-1293Crossref PubMed Scopus (615) Google Scholar). Aberrant activation of this pathway has been implicated in the development of many tumor types, and constitutive activation of this pathway has been observed in ∼30% of all human cancer. The serine/threonine Raf kinase family, which consists of three proteins, C-Raf (also referred to as Raf-1), B-Raf, and A-Raf, is an essential component of this pathway (1Chang F. Steelman L.S. Lee J.T. Shelton J.G. Navolanic P.M. Blalock W.L. Franklin R.A. McCubrey J.A. Leukemia. 2003; 17: 1263-1293Crossref PubMed Scopus (615) Google Scholar, 2Sridhar S.S. Hedley D. Siu L.L. Mol. Cancer Ther. 2005; 4: 677-685Crossref PubMed Scopus (222) Google Scholar). Strikingly, B-Raf-activating mutations have been observed in ∼70% of malignant melanomas (3Davies H. Bignell G.R. Cox C. Stephens P. Edkins S. Clegg S. Teague J. Woffendin H. Garnett M.J. Bottomley W. Davis N. Dicks E. Ewing R. Floyd Y. Gray K. Hall S. Hawes R. Hughes J. Kosmidou V. Menzies A. Mould C. Parker A. Stevens C. Watt S. Hooper S. Wilson R. Jayatilake H. Gusterson B.A. Cooper C. Shipley J. Hargrave D. Pritchard-Jones K. Maitland N. Chenevix-Trench G. Riggins G.J. Bigner D.D. Palmieri G. Cossu A. Flanagan A. Nicholson A. Ho J.W. Leung S.Y. Yuen S.T. Weber B.L. Seigler H.F. Darrow T.L. Paterson H. Marais R. Marshall C.J. Wooster R. Stratton M.R. Futreal P.A. Nature. 2002; 417: 949-954Crossref PubMed Scopus (8559) Google Scholar, 4Pollock P.M. Harper U.L. Hansen K.S. Yudt L.M. Stark M. Robbins C.M. Moses T.Y. Hostetter G. Wagner U. Kakareka J. Salem G. Pohida T. Heenan P. Duray P. Kallioniemi O. Hayward N.K. Trent J.M. Meltzer P.S. Nat. Gene. 2003; 33: 19-20Crossref PubMed Scopus (1401) Google Scholar) and at lower frequencies in a number of other human cancer types, including colorectal (3Davies H. Bignell G.R. Cox C. Stephens P. Edkins S. Clegg S. Teague J. Woffendin H. Garnett M.J. Bottomley W. Davis N. Dicks E. Ewing R. Floyd Y. Gray K. Hall S. Hawes R. Hughes J. Kosmidou V. Menzies A. Mould C. Parker A. Stevens C. Watt S. Hooper S. Wilson R. Jayatilake H. Gusterson B.A. Cooper C. Shipley J. Hargrave D. Pritchard-Jones K. Maitland N. Chenevix-Trench G. Riggins G.J. Bigner D.D. Palmieri G. Cossu A. Flanagan A. Nicholson A. Ho J.W. Leung S.Y. Yuen S.T. Weber B.L. Seigler H.F. Darrow T.L. Paterson H. Marais R. Marshall C.J. Wooster R. Stratton M.R. Futreal P.A. Nature. 2002; 417: 949-954Crossref PubMed Scopus (8559) Google Scholar, 5Rajagopalan H. Bardelli A. Lengauer C. Kinzler K.W. Vogelstein B. Velculescu V.E. Nature. 2002; 418: 934Crossref PubMed Scopus (1087) Google Scholar), ovarian, and papillary thyroid carcinomas (3Davies H. Bignell G.R. Cox C. Stephens P. Edkins S. Clegg S. Teague J. Woffendin H. Garnett M.J. Bottomley W. Davis N. Dicks E. Ewing R. Floyd Y. Gray K. Hall S. Hawes R. Hughes J. Kosmidou V. Menzies A. Mould C. Parker A. Stevens C. Watt S. Hooper S. Wilson R. Jayatilake H. Gusterson B.A. Cooper C. Shipley J. Hargrave D. Pritchard-Jones K. Maitland N. Chenevix-Trench G. Riggins G.J. Bigner D.D. Palmieri G. Cossu A. Flanagan A. Nicholson A. Ho J.W. Leung S.Y. Yuen S.T. Weber B.L. Seigler H.F. Darrow T.L. Paterson H. Marais R. Marshall C.J. Wooster R. Stratton M.R. Futreal P.A. Nature. 2002; 417: 949-954Crossref PubMed Scopus (8559) Google Scholar, 6Singer G. Oldt III, R. Cohen Y. Wang B.G. Sidransky D. Kurman R.J. Shih I. J. Natl. Cancer Inst. 2003; 95: 484-486Crossref PubMed Scopus (724) Google Scholar, 7Cohen Y. Xing M. Mambo E. Guo Z. Wu G. Trink B. Beller U. Westra W.H. Ladenson P.W. Sidransky D. J. Natl. Cancer Inst. 2003; 95: 625-627Crossref PubMed Scopus (799) Google Scholar). Moreover, overexpression of constitutively active c-Raf is sufficient to induce transformation of NIH 3T3 cells (8Kerkhoff E. Rapp U.R. Mol. Cell. Biol. 1997; 17: 2576-2586Crossref PubMed Scopus (152) Google Scholar). Increased Raf/MEK/ERK activity has also been observed in a variety of leukemias, including acute myeloid leukemia (AML) and chronic myeloid leukemia (9Kang C.D. Yoo S.D. Hwang B.W. Kim K.W. Kim D.W. Kim C.M. Kim S.H. Chung B.S. Leuk. Res. 2000; 24: 527-534Crossref PubMed Scopus (93) Google Scholar, 10Okuda K. Matulonis U. Salgia R. Kanakura Y. Druker B. Griffin J.D. Exp. Hematol. 1994; 22: 1111-1117PubMed Google Scholar). In addition, constitutive activation of this pathway diminishes apoptosis in hematopoietic cells (11Hoyle P.E. Moye P.W. Steelman L.S. Blalock W.L. Franklin R.A. Pearce M. Cherwinski H. Bosch E. McMahon M. McCubrey J.A. Leukemia. 2000; 14: 642-656Crossref PubMed Scopus (87) Google Scholar) and abrogates the cytokine dependence of several human and murine cytokine-dependent hematopoietic cells lines (e.g. TF-1, FDC-P1, and FL5.12) (12Blalock W.L. Pearce M. Steelman L.S. Franklin R.A. McCarthy S.A. Cherwinski H. McMahon M. McCubrey J.A. Oncogene. 2000; 19: 526-536Crossref PubMed Scopus (73) Google Scholar). Conversely, inhibition of this pathway by pharmacologic MEK inhibitors such as PD98059 or U0126 enhances apoptosis induction by a variety of agents, including paclitaxel (13Poruchynsky M.S. Giannakakou P. Ward Y. Bulinski J.C. Telford W.G. Robey R.W. Fojo T. Biochem. Pharmacol. 2001; 62: 1469-1480Crossref PubMed Scopus (48) Google Scholar) UCN01 (14Dai Y. Yu C. Singh V. Tang L. Wang Z. McInistry R. Dent P. Grant S. Cancer Res. 2001; 61: 5106-5115PubMed Google Scholar), STI571 (15Yu C. Krystal G. Varticovksi L. McKinstry R. Rahmani M. Dent P. Grant S. Cancer Res. 2002; 62: 188-199PubMed Google Scholar), proteasome inhibitors (16Orlowski R.Z. Small G.W. Shi Y.Y. J. Biol. Chem. 2002; 277: 27864-27871Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar), and lovastatin (17Wu J. Wong W.W. Khosravi F. Minden M.D. Penn L.Z. Cancer Res. 2004; 64: 6461-6468Crossref PubMed Scopus (209) Google Scholar). For these reasons, disrupting the Ras/Raf/MEK/ERK pathway represents an attractive anticancer strategy, particularly in leukemia cells. mitogen-activated protein kinase/extracellular signal-regulated kinase kinase extracellular signal-regulated kinase acute myeloid leukemia myeloid cell leukemia-1 poly(ADP-ribose) polymerase benzyloxycarbonyl-VAD-fluoromethyl ketone hemagglutinin c-Jun N-terminal kinase mammalian target of rapamycin constitutively active apoptosis inducing factor French-American-British. BAY 43-9006, a novel bi-aryl urea, has shown promising preclinical activity against a variety of tumor cell types and is currently undergoing phase II/III clinical evaluation (18Strumberg D. Seeber S. Onkologie. 2005; 28: 101-107Crossref PubMed Scopus (50) Google Scholar, 19Ahmad T. Eisen T. Clin. Cancer Res. 2004; 10: 6388S-6392SCrossref PubMed Scopus (252) Google Scholar, 20Kramer B.W. Gotz R. Rapp U.R. BMC Cancer. 2004; 4: 24Crossref PubMed Scopus (40) Google Scholar). Although it was initially developed as a specific inhibitor of C-Raf and B-Raf, subsequent studies revealed that this compound also inhibits several other important tyrosine kinases involved in tumor progression, including vascular epidermal growth factor receptor-2, vascular epidermal growth factor receptor-3, platelet-derived growth factor receptor-β, Flt3, and c-Kit (21Wilhelm S.M. Carter C. Tang L. Wilkie D. McNabola A. Rong H. Chen C. Zhang X. Vincent P. McHugh M. Cao Y. Shujath J. Gawlak S. Eveleigh D. Rowley B. Liu L. Adnane L. Lynch M. Auclair D. Taylor I. Gedrich R. Voznesensky A. Riedl B. Post L.E. Bollag G. Trail P.A. Cancer Res. 2004; 64: 7099-7109Crossref PubMed Scopus (3633) Google Scholar). Interestingly, BAY 43-9006 has been shown to inhibit C-Raf and wild type as well as mutant V600E B-Raf kinase activities in vitro and to diminish MEK/ERK activation in various tumor cell lines, including those harboring mutant Ras or B-Raf (21Wilhelm S.M. Carter C. Tang L. Wilkie D. McNabola A. Rong H. Chen C. Zhang X. Vincent P. McHugh M. Cao Y. Shujath J. Gawlak S. Eveleigh D. Rowley B. Liu L. Adnane L. Lynch M. Auclair D. Taylor I. Gedrich R. Voznesensky A. Riedl B. Post L.E. Bollag G. Trail P.A. Cancer Res. 2004; 64: 7099-7109Crossref PubMed Scopus (3633) Google Scholar, 22Karasarides M. Chiloeches A. Hayward R. Niculescu-Duvaz D. Scanlon I. Friedlos F. Ogilvie L. Hedley D. Martin J. Marshall C.J. Springer C.J. Marais R. Oncogene. 2004; 23: 6292-6298Crossref PubMed Scopus (376) Google Scholar, 23Sharma A. Trivedi N.R. Zimmerman M.A. Tuveson D.A. Smith C.D. Robertson G.P. Cancer Res. 2005; 65: 2412-2421Crossref PubMed Scopus (281) Google Scholar). Several studies have shown that myeloid cell leukemia-1 (Mcl-1), a Bcl-2 family member, plays a pivotal role in cell survival, particularly in hematopoietic cells. For example, depletion of Mcl-1 using antisense oligonucleotides rapidly triggers apoptosis in U937 cells (24Moulding D.A. Giles R.V. Spiller D.G. White M.R. Tidd D.M. Edwards S.W. Blood. 2000; 96: 1756-1763Crossref PubMed Google Scholar). Moreover, inducible deletion of Mcl-1 in mice resulted in loss of early bone marrow progenitor populations, including hematopoietic stem cells (25Opferman J.T. Iwasaki H. Ong C.C. Suh H. Mizuno S. Akashi K. Korsmeyer S.J. Science. 2005; 307: 1101-1104Crossref PubMed Scopus (489) Google Scholar). Deletion of Mcl-1 during early lymphocyte differentiation also increased apoptosis and arrested development at the pro-B-cell and double-negative T-cell stages. In addition, specific ablation of Mcl-1 in peripheral B- and T-cell populations resulted also in their rapid loss (26Opferman J.T. Letai A. Beard C. Sorcinelli M.D. Ong C.C. Korsmeyer S.J. Nature. 2003; 426: 671-676Crossref PubMed Scopus (691) Google Scholar). On the other hand, selective overexpression of Mcl-1 in hematopoietic tissues of transgenic mice promotes the survival of hematopoietic cells and enhances the outgrowth of myeloid cell lines (27Zhou P. Qian L. Bieszczad C.K. Noelle R. Binder M. Levy N.B. Craig R.W. Blood. 1998; 92: 3226-3239Crossref PubMed Google Scholar). Finally, overexpression of Mcl-1 protects cells from apoptosis induced by a variety of agents, including UV, tumor necrosis factor-related apoptosis-inducing ligand, etoposide, staurosporine, actinomycin D, among others (28Nijhawan D. Fang M. Traer E. Zhong Q. Gao W. Du F. Wang X. Genes Dev. 2003; 17: 1475-1486Crossref PubMed Scopus (526) Google Scholar, 29Weng C. Li Y. Xu D. Shi Y. Tang H. J. Biol. Chem. 2005; 280: 10491-10500Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar, 30Zhang B. Gojo I. Fenton R.G. Blood. 2002; 99: 1885-1893Crossref PubMed Scopus (352) Google Scholar, 31Zhou P. Qian L. Kozopas K.M. Craig R.W. Blood. 1997; 89: 630-643Crossref PubMed Google Scholar). Such evidence suggests that Mcl-1 may play a critical role in the survival of leukemia and possibly other malignant hematopoietic cells. Interestingly, expression of Mcl-1 has been shown to be dependent upon an intact MEK/ERK pathway in both hematopoietic (32Huang H.M. Huang C.J. Yen J.J. Blood. 2000; 96: 1764-1771Crossref PubMed Google Scholar) and nonhematopoietic cells (33Leu C.M. Chang C. Hu C. Oncogene. 2000; 19: 1665-1675Crossref PubMed Scopus (94) Google Scholar). Currently, the one or more mechanisms by which BAY 43-9006 induces cell death in human leukemia cells remain to be fully elucidated. Here we report that BAY 43-9006 potently induces mitochondrial injury and apoptosis in these cells in association with a pronounced and MEK/ERK-independent reduction in Mcl-1 expression. Moreover, prevention of BAY 43-9006-mediated Mcl-1 down-regulation by ectopic expression of an Mcl-1 construct substantially diminishes BAY 43-9006-induced mitochondrial injury and apoptosis. Finally, the present results indicate that BAY 43-9006 down-regulates Mcl-1 expression through inhibition of translation, rather than through a transcriptional, post-translational, or caspase-dependent mechanism. Cells—The human leukemia U937, Jurkat, and K562 cells were cultured as previously reported (34Rahmani M. Yu C. Reese E. Ahmed W. Hirsch K. Dent P. Grant S. Oncogene. 2003; 22: 6231-6242Crossref PubMed Scopus (94) Google Scholar). U937 cells stably overexpressing Mcl-1 were kindly provided by Dr. Ruth Craig (Dartmouth Medical School, Hanover). These cells were obtained by transfecting U937 cells with a pCEP4-Mcl-1construct that encodes for the 40-kDa Mcl-1 protein. Stable single cell clones were selected in the presence of 400 μg/ml hygromycin. Thereafter, cells from each clone were analyzed for Mcl-1 expression by Western blot. A Tet-On Jurkat cell line inducibly expressing constitutively active MEK1 under doxycycline control was previously described (34Rahmani M. Yu C. Reese E. Ahmed W. Hirsch K. Dent P. Grant S. Oncogene. 2003; 22: 6231-6242Crossref PubMed Scopus (94) Google Scholar). Isolation of Patient-derived Leukemic Blasts—Leukemic blasts were obtained with informed consent from the peripheral blood of several patients with acute myeloblastic leukemia (AML), FAB subtype M2. These studies have been sanctioned by the Investigational Review Board of Virginia Commonwealth University/Medical College of Virginia, and all patients provided informed consent. In each case, the percentage of blasts in the peripheral blood was >70%. Blood was collected into heparinized syringes, diluted 1:3 with RMPI 1640 medium, and transferred as an overlayer to centrifuge tubes containing 10 ml of Ficoll-Hypaque (specific gravity, 1.077–1.081). After centrifugation at room temperature for 30 min, the interface layer, containing predominantly leukemic blasts, was extracted with a sterile Pasteur pipette, suspended in RPMI medium, and washed three times. Leukemic blasts, which displayed >90% viability by trypan blue exclusion, were then diluted into RPMI medium containing 10% fetal calf serum at a concentration of 106 cells/ml, and exposed to drugs as described in the case of continuously cultured cell lines. Reagents—BAY 43-9006 (Bayer, West Haven, CT) was provided by Dr. John Wright, Cancer Treatment and Evaluation Program, NCI, National Institutes of Health (Bethesda, MD). It was dissolved in Me2SO, and aliquots were maintained at –80 °C. MG132 was purchased from Calbiochem; cycloheximide and actinomycin D were purchased from Sigma. SB202190 was purchased from Alexis Corp. (San Diego, CA). Rapamycin and U0126 were purchased from Cell Signaling Technology (Beverly, MA). The broad spectrum cell-permeable caspase inhibitor, z-VAD-FMK was purchased from Enzyme Systems Products (Livermore, CA). All reagents were prepared and used as recommended by their suppliers. Assessment of Apoptosis—Apoptotic cells were routinely identified by Annexin V-fluorescein isothiocyanate staining as previously described (35Rahmani M. Dai Y. Grant S. Exp. Cell Res. 2002; 277: 31-47Crossref PubMed Scopus (52) Google Scholar). Briefly, 105 cells were collected, washed in cold phosphate-buffered saline, and then resuspended in binding buffer (10 mm Hepes/NaOH, pH 7.4, 140 mm NaCl, 2.5 mm CaCl2) containing fluorescein-labeled annexin V (BD Pharmingen) and propidium iodide. Samples were incubated for 15 min and then analyzed by flow cytometer (BD Biosciences FACScan). Quantitative Real-time PCR—U937 cells were left untreated or treated with 10 μm BAY 43-9006 for the indicated period after which they were lysed and total RNA was extracted using the RNeasy mini kit (Qiagen). Quantitative real-time PCR analysis was carried out on the ABI Prism® 7900 Sequence Detection System (Applied Biosystems, Foster City, CA) using the TaqMan® One Step PCR Master Mix Reagents Kit (polynucleotide: 4309169) as recommended by the manufacturer. The cycling conditions were: 48 °C/30 min; 95 °C/10 min; and 40 cycles of 95 °C/15 s and 60 °C/1 min. The cycle threshold was determined to provide the optimal standard curve values (0.98–1.0). The probes (5′-TCAAGTGTTTAGCCACAAAGGCACCAAAAG-3′) and Mcl-1-specific primers (forward, GGGCAGGATTGTGACTCTCATT; reverse, 5′-GATGCAGCTTTCTTGGTTTATGG-3′) were designed using the Primer Express® 2.0 version. The probes were labeled at the 5′-end with 6-carboxyfluoresceine and at the 3′-end with 6-carboxytetramethylrhodamine. Ribosomal RNA (18 S rRNA) was used as endogenous control. Each sample was tested in triplicate, and the Mcl-1 mRNA level was normalized to that of 18 S rRNA. Transient Transfection and Reporter Gene Assay—K562 cells were transiently transfected using Amaxa nucleofector™ (Koeln, Germany) as previously described (36Dai Y. Rahmani M. Corey S.J. Dent P. Grant S. J. Biol. Chem. 2004; 279: 34227-34239Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). Constitutively active MNK1 T332D and eIF4E (wild type) were kindly provided by Dr. J. A. Cooper (Fred Hutchinson Cancer Research Center, Seattle, WA) (37Waskiewicz A.J. Johnson J.C. Penn B. Mahalingam M. Kimball S.R. Cooper J.A. Mol. Cell. Biol. 1999; 19: 1871-1880Crossref PubMed Scopus (405) Google Scholar). PcDNA3.1-Mcl-1 was a generous gift from Dr. R. W. Craig. Empty vector pcDNA3.1 was purchased from Invitrogen. Reporter gene assays were carried out as previously described (38Rahmani M. Reese E. Dai Y. Bauer C. Kramer L.B. Huang M. Jove R. Dent P. Grant S. Mol. Pharmacol. 2005; 67: 1166-1176Crossref PubMed Scopus (72) Google Scholar). Briefly, cells were cotransfected with a –203/+10-Mcl-1-pGL2 plasmid (39Croxton R. Ma Y. Cress W.D. Oncogene. 2002; 21: 1563-1570Crossref PubMed Scopus (22) Google Scholar) in which firefly luciferase is driven by the –203 to +10 element of the Mcl-1 gene promoter, or the pGL2-basic empty vector (Promega, Madison, WI) and pRL-TK-luc plasmid encoding for Renilla luciferase. Cells were incubated for 6 h and then treated with BAY 43-9006 for an additional 20 h, after which the activity of firefly and Renilla luciferases was measured using the Dual-Luciferase reporter assay system (Promega). Values for firefly luciferase activity were normalized to those obtained for Renilla luciferase activity. Immunoprecipitation and Immunoblotting—For immunoprecipitation, cells were lysed in buffer containing 20 mm Tris (pH 7.5), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, antiproteases (10 μg/ml of leupeptin and aprotinin, 1 mm phenylmethylsulfonyl fluoride), and 1% Triton X-100 after which 500 μg of protein lysate was subjected to immunoprecipitation using the designated antibodies. Immunoblotting was performed using the immunoprecipitates or the whole cells lysates as previously described in detail (35Rahmani M. Dai Y. Grant S. Exp. Cell Res. 2002; 277: 31-47Crossref PubMed Scopus (52) Google Scholar). The primary antibodies used in this study were as follows: caspase-3, Bax, caspase-7, Bcl-2, and Mcl-1 (BD Pharmingen); Caspase-8 (Alexis Corp.); poly(ADP-ribose) polymerase (PARP, Biomol Research Laboratories, Plymouth Meeting, PA); Bcl-xL XIAP, total and Phospho-ERK1/2 (Thr-202/Tyr-204), ubiquitin, cleaved caspase-9, cleaved caspase-3, phospho-4EBP1 (Ser-65), phospho-eIF4E (Ser-209), phospho-eIF4G (Ser-1108), phospho-p90RSK (Ser-380), phospho-p70S6K (Thr-389), phospho-p38 (Thr-180/Tyr-182), and phospho-JNK1 (Thr-183/Tyr-185) (Cell Signaling Technology); eIF4G (BD Transduction Laboratories); Bim, HA, cytochrome c, AIF, total and phosphorylated Bcr-abl, eIF4E, p70S6K, myc, JNK1, and p38 (Santa Cruz Biotechnology, Santa Cruz, CA); and Bak and α-tubulin (Calbiochem). Mcl-1 Protein Stability—U937 cells were washed in phosphate-buffered saline and cultured at a density of 5 × 106 cells, in methionine-free RPMI for 15 min, then labeled with 100 μCi/ml [35S]methionine (ICN, Biomedicals, Inc., Irvine, CA) for 60 min. Cells were then washed in phosphate-buffered saline and cultured in complete RPMI containing fetal bovine serum and excess of cold methionine (10 mm) and cysteine (5 mm) for the indicated periods in the presence or absence of BAY 43-9006 with or without the proteasome inhibitor MG132. At the end of the indicated intervals, 107 cells were collected and subsequently subjected to immunoprecipitation using Mcl-1 antibodies as described above. The immunoprecipitates were subjected to SDS-PAGE followed by autoradiography. m7-GTP-Sepharose Chromatography—Following stimulation, cells were lysed in lysis buffer as indicated above. 500 μg of protein lysates was incubated with 50 μl of m7-GTP-Sepharose beads (Amersham Biosciences) for 2 h at 4°C after which the beads were washed three times and boiled in Laemmli buffer for 5 min, and following centrifugation, the supernatants containing the proteins were subjected to Western blot analysis. Subcellular Fractionation—Leukemic cells (4 × 106) were lysed using digitonin buffer (35Rahmani M. Dai Y. Grant S. Exp. Cell Res. 2002; 277: 31-47Crossref PubMed Scopus (52) Google Scholar), after which cytosolic and membrane fractions were separated by centrifugation, solubilized in Laemmli buffer, and boiled for 5 min. Proteins were analyzed by Western blot to evaluate cytochrome c release into the cytosol. Statistical Analysis—The significance of differences between experimental conditions was determined using the Student's t test for unpaired observations. Treatment with BAY 43-9006 Results in a Marked Induction of Mitochondrial Injury and Apoptosis in Human Leukemia Cells—To characterize the effects of BAY 43-9006 in U937 cells, dose-response and time-course studies were performed (Fig. 1). As shown in Fig. 1A, exposure of U937 cells to increasing concentrations of BAY 43-9006 for 24 h revealed a moderate induction of apoptosis at concentration as low as 5 μm as indicated by annexin V analysis. Higher concentration of BAY 43-9006 resulted in more pronounced cell death (e.g. 80% at 15 μm). Virtually identical results were obtained in Jurkat lymphoid leukemia cells (Fig. 1B). Exposure of U937 cells to 10 μm BAY 43-9006 at varying intervals resulted in induction of apoptosis that was detected as early as 4 h after drug treatment. Longer exposure intervals resulted in a marked increase in cell death (e.g. 55 and 70% at 24 and 48 h, respectively). Essentially equivalent findings were observed when Jurkat cells were examined (data not shown). Furthermore, exposure to BAY 43-9006 resulted in a release of cytochrome c and AIF into the cytosol (Fig. 1D) accompanied by cleavage of caspases-7, -8, -9, and -3 as well as PARP (Fig. 1E). These events were readily apparent after 8 h of treatment and became more pronounced after 20 h. Together, these findings indicate that BAY 43-9006 results in a striking induction of caspase activation, mitochondrial injury, and apoptosis in human myeloid and lymphoid leukemic cells. Exposure of U937 Cells to BAY 43-9006 Is Associated with a Decrease in ERK Phosphorylation—Dose-response studies (Fig. 2) revealed that exposure of U937 cells to BAY 43-9006 at concentration as low as 5 μm resulted in a discernable decrease in ERK phosphorylation as early as half an hour after beginning of exposure, and this decrease persisted at 4 and 8 h of drug administration. Exposure to 7.5 and 10 μm BAY 43-9006 produced even more pronounced reductions in ERK phosphorylation. In contrast, total levels of ERK were unchanged. These findings confirm that, as previously described in other cell types (21Wilhelm S.M. Carter C. Tang L. Wilkie D. McNabola A. Rong H. Chen C. Zhang X. Vincent P. McHugh M. Cao Y. Shujath J. Gawlak S. Eveleigh D. Rowley B. Liu L. Adnane L. Lynch M. Auclair D. Taylor I. Gedrich R. Voznesensky A. Riedl B. Post L.E. Bollag G. Trail P.A. Cancer Res. 2004; 64: 7099-7109Crossref PubMed Scopus (3633) Google Scholar, 22Karasarides M. Chiloeches A. Hayward R. Niculescu-Duvaz D. Scanlon I. Friedlos F. Ogilvie L. Hedley D. Martin J. Marshall C.J. Springer C.J. Marais R. Oncogene. 2004; 23: 6292-6298Crossref PubMed Scopus (376) Google Scholar) BAY 43-9006 inactivates ERK in human leukemia cells. Treatment of U937 Cells with BAY 43-9006 Results in Rapid Decrease in Mcl-1 Protein Level and Late Bcl-2, Bax, and XIAP Cleavage—In view of the critical role that Bcl-2 family proteins play in apoptosis regulation (40Chao D.T. Korsmeyer S.J. Annu. Rev. Immunol. 1998; 16: 395-419Crossref PubMed Scopus (1539) Google Scholar, 41Gross A. McDonnell J.M. Korsmeyer S.J. Genes Dev. 1999; 13: 1899-1911Crossref PubMed Scopus (3286) Google Scholar), expression of these proteins was monitored in U937 cells following treatment of cells with BAY 43-9006 (10 μm) for varying intervals (Fig. 3A). After 20 h of treatment, a decline in protein levels of Bcl-xL, Bak, Bim, as well as cleavage of Bcl-2, Bax, and XIAP were detected, however, no major changes were observed at earlier intervals. The finding that these changes were detected after caspase activation argues against the possibility of a primary role for these phenomena in BAY 43-9006-mediated cell death. In addition, no change in Bid protein level was noted. In striking contrast, levels of the anti-apoptotic protein Mcl-1 protein declined rapidly (e.g. over 2 h) following treatment with BAY 43-9006, and by 8 h expression was essentially absent (Fig. 3A). Further analysis revealed that treatment with BAY 43-9006 for 4 h resulted in the dose-dependent down-regulation of Mcl-1, which roughly paralleled the extent of lethality (Fig. 3B). Furthermore, the pan-caspase inhibitor z-VAD-FMK was ineffective in preventing down-regulation of Mcl-1 protein following 4 or 8 h of treatment with BAY 43-9006. In contrast, late changes in expression of other Bcl-2 family members in cells exposed to BAY 43-9006 were clearly diminished by z-VAD-FMK (data not shown). Similar results were obtained in Jurkat cells (data not shown). Together, these finding

Referência(s)