Portal de Periódicos da CAPES

Post-Transcriptional Regulation of UV Induced TNF-α Expression

1998; Elsevier BV; Volume: 110; Issue: 4 Linguagem: Inglês

10.1046/j.1523-1747.1998.00154.x

1523-1747

Martin Leverkus, Mina Yaar, Mark S. Eller, Emily H. Tang, Barbara A. Gilchrest,

Indoor Air Quality and Microbial Exposure

Ultraviolet (UV) irradiation exerts multiple effects on skin cells, including the induction of several cytokines involved in immunomodulation. Specifically, UV irradiation has been shown to upregulate the level of tumor necrosis factor-α (TNF-α) mRNA in keratinocytes. To determine whether the induction of TNF-α mRNA is regulated by transcriptional or post-transcriptional mechanisms, we examined cells of keratinocytic lineage (SCC12F) for steady state level, transcription rate, and stability of TNF-α mRNA after UV irradiation. Within 4 h there was a 20–40-fold induction of TNF-α mRNA that persisted at lower levels through 48 h. Consistently, TNF-α protein secretion increased at 24 and 48 h after UV irradiation. UV irradiation increased the half-life of TNF-α mRNA from ≈35 min to ≈10 h. Conversely, the transcription rate of the TNF-α gene increased bl 2-fold at the time of peak mRNA steady state levels. Thus, post-transcriptional mechanisms play a major role in UV induced TNF-α transcript level. Ultraviolet (UV) irradiation exerts multiple effects on skin cells, including the induction of several cytokines involved in immunomodulation. Specifically, UV irradiation has been shown to upregulate the level of tumor necrosis factor-α (TNF-α) mRNA in keratinocytes. To determine whether the induction of TNF-α mRNA is regulated by transcriptional or post-transcriptional mechanisms, we examined cells of keratinocytic lineage (SCC12F) for steady state level, transcription rate, and stability of TNF-α mRNA after UV irradiation. Within 4 h there was a 20–40-fold induction of TNF-α mRNA that persisted at lower levels through 48 h. Consistently, TNF-α protein secretion increased at 24 and 48 h after UV irradiation. UV irradiation increased the half-life of TNF-α mRNA from ≈35 min to ≈10 h. Conversely, the transcription rate of the TNF-α gene increased bl 2-fold at the time of peak mRNA steady state levels. Thus, post-transcriptional mechanisms play a major role in UV induced TNF-α transcript level. Ultraviolet (UV) irradiation exerts multiple effects on skin cells, including the induction of several cytokines like tumor necrosis factor-α (TNF-α) (Kock et al., 1990Kock A. Schwarz T. Kirnbauer R. Urbanski A. Perry P. Ansel J.C. Luger T.A. Human keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light.J Exp Med. 1990; 172: 1609-1614Crossref PubMed Scopus (611) Google Scholar), interleukin (IL)-1 (Blanton et al., 1989Blanton R.A. Kupper T.S. McDougall J.K. Dower S. Regulation of interleukin 1 and its receptor in human keratinocytes.Proc Natl Acad Sci USA. 1989; 86: 1273-1277Crossref PubMed Scopus (99) Google Scholar), IL-6 (Kirnbauer et al., 1991Kirnbauer R. Kock A. Neuner P. et al.Regulation of epidermal cell interleukin-6 production by UV light and corticosteroids.J Invest Dermatol. 1991; 96: 484-489Abstract Full Text PDF PubMed Google Scholar), and IL-10 (Enk et al., 1995Enk C.D. Sredni D. Blauvelt A. Katz S.I. Induction of IL-10 gene expression in human keratinocytes by UVB exposure in vivo and in vitro.J Immunol. 1995; 154: 4851-4856PubMed Google Scholar). The exact mechanism by which UV irradiation leads to cytokine induction and release by keratinocytes is still unknown. One hypothesis suggests that DNA damage constitutes a signal leading to the activation of transcription factors that upregulate cytokine gene transcription. This hypothesis is supported by the observation that persistence of damaged DNA in repair-deficient cells from patients with xeroderma pigmentosum leads to higher activation of UV-inducible gene expression than is observed in cells with normal DNA repair capability (Stein et al., 1989Stein B. Rahmsdorf H.J. Steffen A. Litfin M. Herrlich P. UV-induced DNA damage is an intermediate step in UV-induced expression of human immunodeficiency virus type 1, collagenase, c-fos, and metallothionein.Mol Cell Biol. 1989; 9: 5169-5181Crossref PubMed Scopus (444) Google Scholar); however, recent observations suggest that the UV response is mediated at least in part by direct activation of transcription factors like AP-1 and NF-κB in the absence of a nucleus (Devary et al., 1993Devary Y. Rosette C. DiDonato J.A. Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal.Science. 1993; 261: 1442-1445Crossref PubMed Scopus (566) Google Scholar; Simon et al., 1994Simon M.M. Aragane Y. Schwarz A. Luger T.A. Schwarz T. UVB light induces nuclear factor kappa B (NF kappa B) activity independently from chromosomal DNA damage in cell-free cytosolic extracts.J Invest Dermatol. 1994; 102: 422-427Abstract Full Text PDF PubMed Google Scholar); and direct activation of cell surface receptors by UV irradiation has also been reported (Rosette and Karin, 1996Rosette C. Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors.Science. 1996; 274: 1194-1197Crossref PubMed Scopus (926) Google Scholar). Although transcriptional activation is of major importance to the total UV response (Devary et al., 1991Devary Y. Gottlieb R.A. Lau L.F. Karin M. Rapid and preferential activation of the c-jun gene during the mammalian UV response.Mol Cell Biol. 1991; 11: 2804-2811Crossref PubMed Scopus (590) Google Scholar, Devary et al., 1992Devary Y. Gottlieb R.A. Smeal T. Karin M. The mammalian ultraviolet response is triggered by activation of Src tyrosine kinases.Cell. 1992; 71: 1081-1091Abstract Full Text PDF PubMed Scopus (789) Google Scholar), the contribution of post-transcriptional mechanisms to the modulation of gene expression (Carter and Malter, 1991Carter B.Z. Malter J.S. Regulation of mRNA stability and its relevance to disease.Lab Invest. 1991; 65: 610-621PubMed Google Scholar; Beelman and Parker, 1995Beelman C.A. Parker R. Degradation of mRNA in eukaryotes.Cell. 1995; 81: 179-183Abstract Full Text PDF PubMed Scopus (558) Google Scholar) and the induction of cytokines (June et al., 1989June C.H. Jackson K.M. Ledbetter J.A. Leiden J.M. Lindsten T. Thompson C.B. Two distinct mechanisms of interleukin-2 gene expression in human T lymphocytes.J Autoimmunol. 1989; 2: 55-65Crossref PubMed Scopus (30) Google Scholar; Lindstein et al., 1989Lindstein T. June C.H. Ledbetter J.A. Stella G. Thompson C.B. Regulation of lymphokine messenger RNA stability by a surface-mediated T cell activation pathway.Science. 1989; 244: 339-343Crossref PubMed Scopus (791) Google Scholar) is also well established. TNF-α is a multifunctional cytokine that has an important role in the pathogenesis of inflammation (Vassalli, 1992Vassalli P. The pathophysiology of tumor necrosis factors.Ann Rev Immunol. 1992; 10: 411-452Crossref PubMed Scopus (1761) Google Scholar; Bazzoni and Beutler, 1996Bazzoni F. Beutler B. The tumor necrosis factor ligand and receptor families.NE J Med. 1996; 334: 1717-1725Crossref PubMed Scopus (1059) Google Scholar), lymphocyte activation (Kinkhabwala et al., 1990Kinkhabwala M. Sehajpal P. Skolnik E. et al.A novel addition to the T cell repertory. Cell surface expression of tumor necrosis factor/cachectin by activated normal human T cells.J Exp Med. 1990; 171: 941-946Crossref PubMed Scopus (116) Google Scholar; Santis et al., 1992aSantis A.G. Campanero M.R. Alonso J.L. Sanchez-madrid F. Regulation of tumor necrosis factor (TNF) -alpha synthesis and TNF receptors expression in T lymphocytes through the CD2 activation pathway.Eur J Immunol. 1992; 22: 3155-3160Crossref PubMed Scopus (19) Google Scholar, Santis et al., 1992bSantis A.G. Campanero M.R. Alonso J.L. et al.Tumor necrosis factor-alpha production induced in T lymphocytes through the AIM/CD69 activation pathway.Eur J Immunol. 1992; 22: 1253-1259Crossref PubMed Scopus (84) Google Scholar), and apoptosis (Zheng et al., 1995Zheng L. Fisher G. Miller R.E. Peschon J. Lynch D.H. Lenardo M.J. Induction of apoptosis in mature T cells by tumour necrosis factor.Nature. 1995; 377: 348-351Crossref PubMed Scopus (1032) Google Scholar). TNF-α is produced by a wide variety of cells including macrophages, natural killer cells, and T lymphocytes (Kinkhabwala et al., 1990Kinkhabwala M. Sehajpal P. Skolnik E. et al.A novel addition to the T cell repertory. Cell surface expression of tumor necrosis factor/cachectin by activated normal human T cells.J Exp Med. 1990; 171: 941-946Crossref PubMed Scopus (116) Google Scholar; Bazzoni and Beutler, 1996Bazzoni F. Beutler B. The tumor necrosis factor ligand and receptor families.NE J Med. 1996; 334: 1717-1725Crossref PubMed Scopus (1059) Google Scholar). In macrophages, lipopolysaccharide stimulates TNF-α gene transcription at least partly by initiating translocation of NF-κB to the nucleus and by releasing the translational blockade that restricts TNF-α biosynthesis (Shakhov et al., 1990Shakhov A.N. Collart M.A. Vassalli P. Nedospasov S.A. Jongeneel C.V. Kappa B- type enhancers are involved in lipopolysaccharide-mediated transcriptional activation of the tumor necrosis factor alpha gene in primary macrophages.J Exp Med. 1990; 171: 35-47Crossref PubMed Scopus (713) Google Scholar); however, in astrocytes, it was shown that the TNF-α mRNA level is regulated by both transcriptional and post-transcriptional mechanisms (Lieberman et al., 1990Lieberman A.P. Pitha P.M. Shin M.L. Protein kinase regulates tumor necrosis factor mRNA stability in virus-stimulated astrocytes.J Exp Med. 1990; 172: 989-992Crossref PubMed Scopus (53) Google Scholar). Thus, different stimuli appear to induce TNF-α production via different regulatory mechanisms. Keratinocytes produce TNF-α after stimulation with lipopolysaccharide, nickel, skin irritants, or UV irradiation (Kock et al., 1990Kock A. Schwarz T. Kirnbauer R. Urbanski A. Perry P. Ansel J.C. Luger T.A. Human keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light.J Exp Med. 1990; 172: 1609-1614Crossref PubMed Scopus (611) Google Scholar; Lisby et al., 1995Lisby S. Muller K.M. Jongeneel C.V. Saurat J.H. Hauser C. Nickel and skin irritants up-regulate tumor necrosis factor-alpha mRNA in keratinocytes by different but potentially synergistic mechanisms.Int Immunol. 1995; 7: 343-352Crossref PubMed Scopus (72) Google Scholar). TNF-α was shown to contribute to the induction of apoptosis of keratinocytes after UV irradiation (Schwarz et al., 1995Schwarz A. Bhardwaj R. Aragane Y. et al.Ultraviolet-B-induced apoptosis of keratinocytes: evidence for partial involvement of tumor necrosis factor-alpha in the formation of sunburn cells.J Invest Dermatol. 1995; 104: 922-927Abstract Full Text PDF PubMed Scopus (245) Google Scholar), and is important for elicitation of contact hypersensitivity reactions in the skin (Piguet et al., 1991Piguet P.F. Grau G.E. Hauser C. Vassalli P. Tumor necrosis factor is a critical mediator in hapten induced irritant and contact hypersensitivity reactions.J Exp Med. 1991; 173: 673-679Crossref PubMed Scopus (293) Google Scholar). UV irradiation upregulates TNF-α mRNA levels (Kock et al., 1990Kock A. Schwarz T. Kirnbauer R. Urbanski A. Perry P. Ansel J.C. Luger T.A. Human keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light.J Exp Med. 1990; 172: 1609-1614Crossref PubMed Scopus (611) Google Scholar), but the mechanism of this upregulation is not known. We now report that in the keratinocyte cell line SCC12F, UV irradiation enhances the stability of TNF-α mRNA ≈18-fold within 4 h of UV irradiation, and that mRNA transcription at that time is also increased, but less than 2-fold. These data suggest that a post-transcriptional modification is the main regulatory mechanism responsible for the strong induction of TNF-α in the epidermis after UV irradiation. Adenine was obtained from Sigma (St. Louis, MO). F-12 Nutrient Mixture was obtained from Gibco (Gaithersburg, MD). Actinomycin D was obtained from Sigma. SCC12F cells were kindly provided by Dr. Rheinwald (Division of Dermatology, Brigham and Women’s Hospital, Boston, MA) (Rheinwald et al., 1983Rheinwald J.G. Jermaine E. Beckett M.A. Human Carcinogenesis. Academic Press, New York1983: 85-96Google Scholar) and were maintained in a 75:25 mixture of Dulbecco’s modified Eagle’s medium and F-12 Nutrient Mixture containing 10% fetal bovine serum, 1.8 mM adenine, and 10 ng epidermal growth factor per ml. Cultures were maintained at 37°C in 7% CO2 and supplied with fresh medium twice weekly. UV irradiation was performed as described before (Wintzen et al., 1996Wintzen M. Yaar M. Burbach J.P. Gilchrest B.A. Proopiomelanocortin gene product regulation in keratinocytes.J Invest Dermatol. 1996; 106: 673-678Crossref PubMed Scopus (121) Google Scholar). Cells were irradiated with UV doses of 5–30 mJ per cm2 as metered at 285 ± 5 nm, in phosphate-buffered saline through the plastic petri dish cover. After irradiation, cells were provided fresh medium. Sham irradiated cultures were handled identically, except that they were shielded with aluminum foil during the irradiation. By visual inspection using phase microscopy, ≈10–20% of irradiated cells at 24 h and 25–40% at 48 h were rounded or detached from the dish surface. Total cellular RNA was collected with Tri-Reagent (Molecular Research Center, Cincinnati, OH) and RNA isolation was carried out according to the manufacturer’s instructions. For mRNA stability experiments, 5 μg actinomycin D per ml was added to the culture medium and total cellular RNA was collected before and up to 8 h after addition. RNA, 5–30 μg, was electrophoresed over a 1% agarose/formaldehyde gel and transferred to a nylon membrane (Hybond N, Amersham, Arlington Heights, IL). Hybridization with 32P-labeled TNF-α or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA was performed as described (Leverkus et al., 1997Leverkus M. Yaar M. Gilchrest B.A. Fas/Fas Ligand Interaction contributes to UV- induced apoptosis in human keratinocytes.Exp Cell Res. 1997; 232: 255-262Crossref PubMed Scopus (170) Google Scholar). Blots were autoradiographed with intensifying screens at –70°C using Kodak X-Omatic AR films. TNF-α transcription was determined using a nuclear run-on assay modified from Niles and Loewy, 1989Niles R.M. Loewy B.P. Induction of protein kinase C in mouse melanoma cells by retinoic acid.Cancer Res. 1989; 49: 4483-4487PubMed Google Scholar. Paired cultures of SCC12F cells were plated at 7.5 × 105 cells per 100 mm dish and were UV (30 mJ per cm2) or sham irradiated 24 h later. TNF-α transcription was examined 4 h after UV irradiation at the time of maximal TNF-α mRNA induction. Nuclei were isolated using lysis buffer (10 mM Tris, pH 7.6, 10 mM NaCl, 3 mM MgCl2, 0.5% Nonidet P-40). For each in vitro transcription reaction, a total of 107 nuclei obtained from multiple identical tissue culture dishes were incubated with the reaction mixture containing 160 uCi of 32P-UTP (3000 Ci per mmol, New England Nuclear, Boston, MA) and unlabeled nucleotides (1 mM adenosine triphosphate, 1 mM guanosine triphosphate, 1 mM cytidine triphosphate, and 1.3 μM UTP) for 30 min at 30°C. The reaction was terminated by adding DNase I (Worthington Biochemical, Freehold, NJ) (0.1 μg per ul) at 30°C for 10 min, followed by proteinase K (Sigma) (0.4 μg per ul) digestion at 37°C for 30 min. Nuclear RNA was extracted using phenol/chloroform (1:1 vol). The RNA in the aqueous phase was precipitated by adding cold 5% trichloroacetic acid, and the pellet was resuspended in 3 M LiCl and 6 M urea. Nuclear RNA was then pelleted, dissolved in eluting buffer (10 mM Tris, 5 mM ethylenediamine tetraacetic acid, and 1% sodium dodecyl sulfate), and further pelleted by adding 3 M NaAc and ethanol. The final pellet was dissolved in 100 μl of RNase-free H2O. TNF-α and β-actin cDNA sequences were generated as described below. Each cDNA was denatured at 100°C for 10 min in 100 mM Tris (pH 7.6) and 50 mM ethylenediamine tetraacetic acid, and was applied to a slot-blot (10 μg per slot) onto a nitrocellulose filter (Schleicher & Schuell, Keene, NH). The filter was incubated in prehybridization solution [10 mM N-tris (Hydroxymethyl)-methyl-2-aminoethanesulfonic acid (Sigma), 300 mM NaCl, 10 mM ethylenediamine tetraacetic acid, 0.05% PPi, 50 μg salmon sperm DNA per ml, 2 × Denhardts, 0.2% sodium dodecyl sulfate] at 65°C for 16–24 h. Hybridization with radiolabeled nuclear RNA was performed by introducing equal counts of radiolabeled nuclear RNA (3–4 × 106 cpm per ml) in the hybridization solution [10 mM N-tris (Hydroxymethyl)-methyl-2-aminoethanesulfonic acid, 300 mM NaCl, 10 mM ethylenediamine tetraacetic acid, 0.2% sodium dodecyl sulfate] for 72 h at 65°C. The filters were then washed twice with 2 × sodium citrate/chloride buffer at 65°C for 30 min and treated with RNase A (Sigma) (10 mg per ml in 2 × sodium citrate/chloride buffer) at 37°C for 30 min. The filter was exposed to Kodak X-Omat film at –70°C for 10–14 d. Each band on the autoradiogram was quantitated using a densitometer (see below). TNF-α cDNA was generated by PstI digestion of pcDV1 vector (American Type Culture Collection, ATCC #39894) containing TNF-α cDNA. The 1.1 kb fragment was purified and used for northern blot hybridization and nuclear run-on assays. β-actin cDNA was generated by EcoRI digestion of plasmid HHCI89 containing β-actin cDNA (ATCC #65129). The specific probe for GAPDH was generated by polymerase chain reaction. Primers for human GAPDH were GTCATCATCTCTGCCCCCTC and AGCCCCGCGGCCATCACGCC, amplifying a fragment of the human GAPDH cDNA (bp 1050–1300) (Tso et al., 1985Tso J.Y. Sun X.H. Kao T.H. Reece K.S. Wu R. Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene.Nuc Acid Res. 1985; 13: 2485-2502Crossref PubMed Scopus (1742) Google Scholar). The identity of the resulting product with the published GAPDH cDNA was confirmed by sequencing (Applied Biosystems 373 A, fluorescence based sequencer). Autoradiograms were scanned in a Computerized Densitometer (Molecular Dynamics). Bands were manually defined, and band intensity was determined using the MD Image Quant 3.2 program. Due to the low level of baseline expression of TNF-α mRNA in control cells, northern blots were also intentionally exposed for 4–5 d in order to obtain densitometric values for control samples above background levels. Medium from SCC12F cultures was collected 24 and 48 h after UV irradiation. Medium was centrifuged at 5000 ×g to eliminate detached cells and cell debris and clear supernatant was transferred to fresh tubes and frozen at –70°C until further analysis. Aliquots of supernatants of duplicate cultures were assayed for TNF-α by enzyme linked immunosorbent assay in duplicates (Biosource International, Camarillo, CA) and absorbance was measured at 450 nm. SCC12F cells were UV or sham irradiated with 30 mJ per cm2 and total cellular RNA was harvested before and at different times after irradiation and processed for northern blotting. TNF-α mRNA was induced as early as 1 h post-irradiation, with maximal induction 4 h after irradiation. TNF-α mRNA levels remained elevated through 8–16 h after irradiation and subsequently declined. Peak induction was at least 20-fold, and in some cultures up to 40-fold, above sham irradiated cells (Figure 1a). Increased TNF-α mRNA level was detectable up to 48 h post-irradiation (Figure 1a). TNF-α mRNA induction was dose dependent with higher levels observed at 30 mJ per cm2 as compared with 20 mJ per cm2 (Figure 1b). No difference in mRNA induction was observed between 30 mJ per cm2 and 40 mJ per cm2 (Figure 1b). Therefore, 30 mJ per cm2 was used in all subsequent experiments. To investigate if UV irradiation induces TNF-α secretion, SCC12F cells were UV or sham irradiated with 5–30 mJ per cm2, a dose that falls within the physiologic range of UV irradiation and is approximately equivalent to 2–10 minimal erythemal doses representing a moderate to severe sunburn (Johnson, 1984Johnson B. Reactions of normal skin to solar irradiation.in: Jarrett A. Physiology and Pathophysiology of the Skin. Academic Press, London1984: 2414-2492Google Scholar; Garmyn et al., 1992Garmyn M. Yaar M. Boileau N. Backendorf C. Gilchrest B.A. Effect of aging and habitual sun exposure on the genetic response of cultured human keratinocytes to solar-simulated irradiation.J Invest Dermatol. 1992; 99: 743-748Abstract Full Text PDF PubMed Google Scholar). Medium was collected 24 h and 48 h after irradiation and assayed for TNF-α by enzyme linked immunosorbent assay. Consistent with the mRNA data, TNF-α level in medium was increased in a dose dependent manner (Figure 2). Maximal 100-fold increase above sham irradiated levels was observed with 30 mJ per cm2. A dose of 5 mJ per cm2 did not significantly induce TNF-α secretion above baseline level (Figure 2), whereas 15 mJ per cm2 and 30 mJ per cm2 strongly induced TNF-α secretion within 24 and 48 h. Substantial induction persisted at least through 48 h after UV irradiation (Figure 2). As compared with sham irradiated control, the increased TNF-α protein level in medium conditioned by UV irradiated cells was highly statistically significant (p < 0.003, ANOVA). To determine if TNF-α mRNA induction by UV irradiation is due to increased transcription of the TNF-α gene, nuclear run-on assay was performed. Nuclei from sham or UV irradiated cells were isolated 4 h after irradiation and assayed for nascent mRNA synthesis at the time of earliest maximal induction in the steady state level of TNF-α mRNA (Figure 1a). Equal counts of 32P-UTP labeled nuclear RNA were hybridized to slot blots containing TNF-α and β-actin cDNA (Figure 3). Total cellular RNA from duplicate cultures was isolated as well to examine steady state mRNA induction by northern blotting. In a total of three independent experiments, TNF-α gene transcription was induced less than 2-fold (1.1–1.7-fold, Figure 3a). In the same experiments, TNF-α steady state mRNA level showed a > 20-fold induction of TNF-α (Figure 3b), whereas β-Actin mRNA level was essentially unchanged between sham and UV irradiated cultures (Figure 3c). To evaluate if UV irradiation affects TNF-α mRNA stability, we determined the TNF-α mRNA half-life (t1/2). Cells were UV or sham irradiated with 30 mJ per cm2 and transcription was inhibited by addition of actinomycin D. Sham irradiated cultures showed a rapid decay of TNF-α mRNA that was undetectable within 6 h after actinomycin D addition (Figure 4a). In contrast, UV irradiated cultures showed hardly any decay of TNF-α mRNA up to 8 h after addition of actinomycin D (Figure 3a). In a total of three independent experiments, the calculated t1/2 for TNF-α mRNA of sham irradiated cultures was ≈35 min (Figure 4b), whereas the t1/2 of UV irradiated cultures was induced to ≈10.5 h assuming an exponential rate of decay after the last experimental determination, representing a nearly 20-fold induction of TNF-α mRNA t1/2 (Figure 4a–c). Our experiments show that TNF-α mRNA level and secretion is strongly induced in SCC12F cells by physiologic UV doses. In sham irradiated cells TNF-α mRNA t1/2 is ≈35 min, consistent with reports in other cell types (Leopardi et al., 1992Leopardi R. Vainionpaa R. Hurme M. Siljander P. Salmi A.A. Measles virus infection enhances IL-1 beta but reduces tumor necrosis factor-alpha expression in human monocytes.J Immunol. 1992; 149: 2397-2401PubMed Google Scholar; Hayes et al., 1995Hayes M.P. Freeman S.L. Donnelly R.P. IFN-gamma priming of monocytes enhances LPS-induced TNF production by augmenting both transcription and MRNA stability.Cytokine. 1995; 7: 427-435Crossref PubMed Scopus (83) Google Scholar; Lisby et al., 1995Lisby S. Muller K.M. Jongeneel C.V. Saurat J.H. Hauser C. Nickel and skin irritants up-regulate tumor necrosis factor-alpha mRNA in keratinocytes by different but potentially synergistic mechanisms.Int Immunol. 1995; 7: 343-352Crossref PubMed Scopus (72) Google Scholar); however, TNF-α mRNA level is rapidly upregulated after UV irradiation with maximal induction within 4 h that is sustained for ≈12 h after UV irradiation. Our results confirm and expand previous reports showing that UV irradiation induces TNF-α mRNA and protein expression and secretion in newborn keratinocytes and in cell lines of keratinocytic origin (Kock et al., 1990Kock A. Schwarz T. Kirnbauer R. Urbanski A. Perry P. Ansel J.C. Luger T.A. Human keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light.J Exp Med. 1990; 172: 1609-1614Crossref PubMed Scopus (611) Google Scholar). The time course of TNF-α mRNA induction in our experiments is very similar to the reported time course in normal human keratinocytes examined for TNF-α mRNA expression after UV irradiation (Kock et al., 1990Kock A. Schwarz T. Kirnbauer R. Urbanski A. Perry P. Ansel J.C. Luger T.A. Human keratinocytes are a source for tumor necrosis factor alpha: evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light.J Exp Med. 1990; 172: 1609-1614Crossref PubMed Scopus (611) Google Scholar). We therefore believe that SCC12F cells represent a useful model to study TNF-α gene regulation after UV irradiation, although further experiments are required to determine the similarity between this model system and normal keratinocytes. Our experiments showed that TNF-α secretion is strongly induced, with similar doses of UV irradiation used to induce TNF-α mRNA. Whereas control cultures or cultures irradiated with a low dose of UV irradiation (5 mJ per cm2) secreted only minimal amounts of TNF-α, higher doses of UV irradiation (15–30 mJ per cm2) that correspond to a moderate to severe sunburn (Johnson, 1984Johnson B. Reactions of normal skin to solar irradiation.in: Jarrett A. Physiology and Pathophysiology of the Skin. Academic Press, London1984: 2414-2492Google Scholar; Garmyn et al., 1992Garmyn M. Yaar M. Boileau N. Backendorf C. Gilchrest B.A. Effect of aging and habitual sun exposure on the genetic response of cultured human keratinocytes to solar-simulated irradiation.J Invest Dermatol. 1992; 99: 743-748Abstract Full Text PDF PubMed Google Scholar) increased TNF-α secretion in a dose-dependent manner up to 100-fold above baseline level. Recently, a metalloproteinase that participates in TNF-α release from the cell membrane was identified (Black et al., 1997Black R.A. Rauch C.T. Kozlosky C.J. et al.A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells.Nature. 1997; 385: 729-733Crossref PubMed Scopus (2550) Google Scholar; Moss et al., 1997Moss M.L. Jin S.L. Milla M.E. et al.Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha.Nature. 1997; 385: 733-736Crossref PubMed Scopus (1406) Google Scholar). In addition, some metalloproteinases are known to be activated in epidermal cells after UV irradiation (Fisher et al., 1996Fisher G.J. Datta S.C. Talwar H.S. Wang Z.Q. Varani J. Kang S. Voorhees J.J. Molecular basis of sun-induced premature skin ageing and retinoid antagonism.Nature. 1996; 379: 335-339Crossref PubMed Scopus (1119) Google Scholar). Therefore, it seems likely that the large increase in TNF-α secretion after UV irradiation results from changes at various levels, including mRNA transcript stabilization and enhanced release of mature protein from the cell surface. Because UV irradiation is also known to induce keratinocyte apoptosis, perhaps through autocrine TNF-α stimulation (Schwarz et al., 1995Schwarz A. Bhardwaj R. Aragane Y. et al.Ultraviolet-B-induced apoptosis of keratinocytes: evidence for partial involvement of tumor necrosis factor-alpha in the formation of sunburn cells.J Invest Dermatol. 1995; 104: 922-927Abstract Full Text PDF PubMed Scopus (245) Google Scholar), it would be interesting to determine if TNF-α mRNA is preferentially upregulated in cells that are destined for apoptosis. UV irradiation has been reported to induce and activate the transcription factors AP-1 and NF-κB (Devary et al., 1993Devary Y. Rosette C. DiDonato J.A. Karin M. NF-kappa B activation by ultraviolet light not dependent on a nuclear signal.Science. 1993; 261: 1442-1445Crossref PubMed Scopus (566) Google Scholar; Simon et al., 1994Simon M.M. Aragane Y. Schwarz A. Luger T.A. Schwarz T. UVB light induces nuclear factor kappa B (NF kappa B) activity independently from chromosomal DNA damage in cell-free cytosolic extracts.J Invest Dermatol. 1994; 102: 422-427Abstract Full Text PDF PubMed Google Scholar), and the promoter of the TNF-α gene contains consensus binding sites for AP-1 and NF-κB (Spriggs et al., 1992Spriggs D.R. Deutsch S. Kufe D.W. Genomic structure, induction, and production of TNF-alpha.Immunol Series. 1992; 56: 3-34PubMed Google Scholar). These facts and previous studies (Bazzoni et al., 1994Bazzoni F. Kruys V. Shakhov A. Jongeneel C.V. Beutler B. Analysis of tumor necrosis factor promoter responses to ultraviolet light.J Clin Invest. 1994; 93: 56-62Crossref PubMed Scopus (40) Google Scholar) suggest that after UV irradiation TNF-α gene is transcriptionally activated; however, our nuclear run-on analysis shows that at least at the time of maximal mRNA, steady state level TNF-α gene transcription is not a major contributing factor in the UV mediated induction of TNF-α mRNA in human epidermal cells. Nuclear run-on analysis has been reported to yield false negative results if the probes used contain repetitive sequences that may hybridize nonspecifically with other transcripts (Brorson et al., 1991Brorson K.A. Beverly B. Kang S.M. Lenardo M. Schwartz R.H. Transcriptional regulation of cytokine genes in nontransformed T cells. Apparent constitutive signals in run-on assays can be caused by repeat sequences.J Immunol. 1991; 147: 3601-3609PubMed Google Scholar). We do not think that our nuclear run-on represents a false negative result, because the cDNA fragment that was used in the northern blot analysis hybridized to a single band of the appropriate size; however, because in our study transcription rate was determined at the time of maximal mRNA steady state levels, it is possible that TNF-α transcription was higher at earlier times after UV irradiation. Still, the modest UV mediated increased rate for TNF-α gene transcription in our system is consistent with the recent report of UV induced chloramphenicol acetyl transferase activity in the skin of mice transgenic for this read-out gene under the control of the TNF-α promoter (Bazzoni et al., 1994Bazzoni F. Kruys V. Shakhov A. Jongeneel C.V. Beutler B. Analysis of tumor necrosis factor promoter responses to ultraviolet light.J Clin Invest. 1994; 93: 56-62Crossref PubMed Scopus (40) Google Scholar). In a follow-up study, promoter activity in nonirradiated mice was minimal to undetectable in the epidermis and was only barely induced 1 and 2 d after a large UVB exposure (de Kossodo et al., 1995de Kossodo S. Cruz Jr, P.D. Dougherty I. Thompson P. Silva-valdez M. Beutler B. Expression of the tumor necrosis factor gene by dermal fibroblasts in response to ultraviolet irradiation or lipopolysaccharide.J Invest Dermatol. 1995; 104: 318-322Crossref PubMed Scopus (37) Google Scholar). Also, it has been shown previously that in keratinocytes UV irradiation can activate both transcriptional and post-transcriptional pathways to regulate gene expression (Rosen et al., 1995Rosen C.F. Poon R. Drucker D.J. UVB radiation-activated genes induced by transcriptional and posttranscriptional mechanisms in rat keratinocytes.Am J Physiol. 1995; 268: 846-855PubMed Google Scholar), and the regulation of IL-6, for example, is controlled post-transcriptionally through increased mRNA stability (de Vos et al., 1994de Vos S. Brach M. Budnik A. Grewe M. Herrmann F. Krutmann J. Post- transcriptional regulation of Interleukin-6 gene expression in human keratinocytes by ultraviolet B radiation.J Invest Dermatol. 1994; 103: 92-96Crossref PubMed Scopus (51) Google Scholar). Furthermore, the 3′-untranslated regions of TNF-α, IL-6, and several other interleukins and cytokines contain multiple repeats of the motif AUUUA that renders the mRNA unstable (Caput et al., 1986Caput D. Beutler B. Hartog K. Thayer R. Brown-shimer S. Cerami A. Identification of a common nucleotide sequence in the 3′-untranslated region of mRNA molecules specifying inflammatory mediators.Proc Natl Acad Sci USA. 1986; 83: 1670-1674Crossref PubMed Scopus (1189) Google Scholar; Malter, 1989Malter J.S. Identification of an AUUUA-specific messenger RNA binding protein.Science. 1989; 246: 664-666Crossref PubMed Scopus (364) Google Scholar; Spriggs et al., 1992Spriggs D.R. Deutsch S. Kufe D.W. Genomic structure, induction, and production of TNF-alpha.Immunol Series. 1992; 56: 3-34PubMed Google Scholar; Beelman and Parker, 1995Beelman C.A. Parker R. Degradation of mRNA in eukaryotes.Cell. 1995; 81: 179-183Abstract Full Text PDF PubMed Scopus (558) Google Scholar); however, during inflammation these mRNA become stable through binding of cytosolic proteins that specifically recognize the AUUUA rich structural elements and prevent the degradation of the message (Malter, 1989Malter J.S. Identification of an AUUUA-specific messenger RNA binding protein.Science. 1989; 246: 664-666Crossref PubMed Scopus (364) Google Scholar). Moreover, it was reported that UV irradiation enhances the cross-linking between the AU rich sequence elements and their protective binding proteins (Henics et al., 1995Henics T. Nagy E. Rigby W.F. Combined application of in vivo UV-crosslinking and in vitro label transfer in the examination of AU-rich sequence binding protein–RNA interactions.Cell Biol Intl. 1995; 19: 791-801Crossref PubMed Scopus (5) Google Scholar), strongly suggesting that our observed increase in TNF-α mRNA is mediated through such a mechanism. In contrast, an across the board UV induced inhibition of protein synthesis is highly unlikely in the face of the 100-fold increase in TNF-α secretion observed after UV irradiation, almost certainly due, at least in part, to increased TNF-α protein synthesis. Moreover, we and others have observed post-irradiation downregulation of many mRNA transcript levels (Garmyn et al., 1991Garmyn M. Yaar M. Holbrook N. Gilchrest B.A. Immediate and delayed molecular response of human keratinocytes to solar-simulated irradiation.Lab Invest. 1991; 65: 471-478PubMed Google Scholar; Gillardon et al., 1991Gillardon F. Morano I. Zimmermann M. Ultraviolet irradiation of the skin attentuates calcitonin gene-related peptide mRNA expression in rat dorsal root ganglion cells.Neurosci Ltrs. 1991; 124: 144-147Crossref PubMed Scopus (23) Google Scholar; De Luca et al., 1997De Luca D.J. Trefzer U. Tubesing K.A. Elmets C.A. ICAM-1 mRNA levels and relative transcription rates are decreased by UV irradiation of monocytes.Photochem Photobiol. 1997; 65: 609-615Crossref PubMed Scopus (4) Google Scholar), suggesting that the increased t1/2 of TNF-α mRNA is not due to across the board decreased translation associated degradation. Only UVC, not present in the solar simulated irradiation used in our experiments, induced substantial promoter activity in the skin of mice transgenic for the TNF-α promoter (de Kossodo et al., 1995de Kossodo S. Cruz Jr, P.D. Dougherty I. Thompson P. Silva-valdez M. Beutler B. Expression of the tumor necrosis factor gene by dermal fibroblasts in response to ultraviolet irradiation or lipopolysaccharide.J Invest Dermatol. 1995; 104: 318-322Crossref PubMed Scopus (37) Google Scholar). In the context of these previous reports, our findings suggest that TNF-α gene transcription may not be a major contributor in the induction of TNF-α mRNA after physiologically relevant UV exposures. It has been shown previously in murine and human macrophages that the TNF-α gene is regulated by transcriptional activation (Beutler et al., 1985Beutler B. Greenwald D. Hulmes J.D. et al.Identity of tumour necrosis factor and the macrophage- secreted factor cachectin.Nature. 1985; 316: 552-554Crossref PubMed Scopus (866) Google Scholar) as well as by post-transcriptional meachanisms (Hayes et al., 1995Hayes M.P. Freeman S.L. Donnelly R.P. IFN-gamma priming of monocytes enhances LPS-induced TNF production by augmenting both transcription and MRNA stability.Cytokine. 1995; 7: 427-435Crossref PubMed Scopus (83) Google Scholar). Also, at least in murine keratinocytes, different stimuli induce TNF-α mRNA by different mechanisms. Whereas phorbol myristate induces transcriptional activity of the TNF promoter in murine keratinocytes, nickel sulfate (NiSO4) increased mRNA stability without inducing promoter activity, and these stimuli act synergistically on TNF-α mRNA levels (Lisby et al., 1995Lisby S. Muller K.M. Jongeneel C.V. Saurat J.H. Hauser C. Nickel and skin irritants up-regulate tumor necrosis factor-alpha mRNA in keratinocytes by different but potentially synergistic mechanisms.Int Immunol. 1995; 7: 343-352Crossref PubMed Scopus (72) Google Scholar). These findings suggest that the regulatory events involved in the modulation of the TNF-α gene expression depend on cell type, species, and stimulus. Our experiments show for the first time that UV irradiation predominantly enhances TNF-α mRNA stability, suggesting that primarily post-transcriptional mechanisms contribute to TNF-α gene induction after this stimulus in keratinocytes. This report contributes to the growing body of evidence that increased mRNA stability may be an important determinant in cellular responses to UV irradiation, in addition to UV mediated transcriptional activation of genes. The authors thank H.Y. Park and T. Maeda for helpful discussions and Professor E.B. Broecker for continuing support. M. Leverkus is a postdoctoral fellow of the German Research Foundation.