Portal de Periódicos da CAPES

Stable Interaction between β-Arrestin 2 and Angiotensin Type 1A Receptor Is Required for β-Arrestin 2-mediated Activation of Extracellular Signal-regulated Kinases 1 and 2

2004; Elsevier BV; Volume: 279; Issue: 46 Linguagem: Inglês

10.1074/jbc.m406205200

1083-351X

Huijun Wei, Seungkirl Ahn, William G. Barnes, Robert J. Lefkowitz,

Protein Degradation and Inhibitors

Binding of β-arrestins to seven-membrane-spanning receptors (7MSRs) not only leads to receptor desensitization and endocytosis but also elicits additional signaling processes. We recently proposed that stimulation of the angiotensin type 1A (AT1A) receptor results in independent β-arrestin 2- and G protein-mediated extracellular signal-regulated kinases 1 and 2 (ERK1/2) activation. Here we utilize two AT1A mutant receptors to study these independent pathways, one truncated at residue 324, thus removing all potential carboxyl-terminal phosphorylation sites, and the other bearing four mutations in the serine/threonine-rich clusters in the carboxyl terminus. As assessed by confocal microscopy, the two mutant receptors interacted with β-arrestin 2-green fluorescent protein with much lower affinity than did the wild-type receptor. In addition, the mutant receptors more robustly stimulated G protein-mediated inositol phosphate production. Approximately one-half of the wild-type AT1A receptor-stimulated ERK1/2 activation was via a β-arrestin 2-dependent pathway (suppressed by β-arrestin 2 small interfering RNA), whereas the rest was mediated by a G protein-dependent pathway (suppressed by protein kinase C inhibitor). ERK1/2 activation by the mutant receptors was insensitive to β-arrestin 2 small interfering RNA but was reduced more than 80% by a protein kinase C inhibitor. The biochemical consequences of ERK activation by the G protein and β-arrestin 2-dependent pathways were also distinct. G-protein-mediated ERK activation enhanced the transcription of early growth response 1, whereas β-arrestin 2-dependent ERK activation did not. In addition, stimulation of the truncated AT1A mutant receptor caused significantly greater early growth response 1 transcription than did the wild-type receptor. These findings demonstrate how the ability of receptors to interact with β-arrestins determines both the mechanism of ERK activation as well as the physiological consequences of this activation. Binding of β-arrestins to seven-membrane-spanning receptors (7MSRs) not only leads to receptor desensitization and endocytosis but also elicits additional signaling processes. We recently proposed that stimulation of the angiotensin type 1A (AT1A) receptor results in independent β-arrestin 2- and G protein-mediated extracellular signal-regulated kinases 1 and 2 (ERK1/2) activation. Here we utilize two AT1A mutant receptors to study these independent pathways, one truncated at residue 324, thus removing all potential carboxyl-terminal phosphorylation sites, and the other bearing four mutations in the serine/threonine-rich clusters in the carboxyl terminus. As assessed by confocal microscopy, the two mutant receptors interacted with β-arrestin 2-green fluorescent protein with much lower affinity than did the wild-type receptor. In addition, the mutant receptors more robustly stimulated G protein-mediated inositol phosphate production. Approximately one-half of the wild-type AT1A receptor-stimulated ERK1/2 activation was via a β-arrestin 2-dependent pathway (suppressed by β-arrestin 2 small interfering RNA), whereas the rest was mediated by a G protein-dependent pathway (suppressed by protein kinase C inhibitor). ERK1/2 activation by the mutant receptors was insensitive to β-arrestin 2 small interfering RNA but was reduced more than 80% by a protein kinase C inhibitor. The biochemical consequences of ERK activation by the G protein and β-arrestin 2-dependent pathways were also distinct. G-protein-mediated ERK activation enhanced the transcription of early growth response 1, whereas β-arrestin 2-dependent ERK activation did not. In addition, stimulation of the truncated AT1A mutant receptor caused significantly greater early growth response 1 transcription than did the wild-type receptor. These findings demonstrate how the ability of receptors to interact with β-arrestins determines both the mechanism of ERK activation as well as the physiological consequences of this activation. Stimulation of seven-membrane-spanning receptors (7MSRs) 1The abbreviations used are: 7MSR, seven-membrane-spanning receptor; siRNA, small interfering RNA; Ang II, angiotensin II; AT1A, angiotensin type 1A; ERK, extracellular signal-regulated kinase; HA, hemagglutinin; GRK, G protein-coupled receptor kinase; PKC, protein kinase C; EGR-1, early growth response 1; C-tail, carboxyl-terminal; GFP, green fluorescent protein; HEK, human embryonic kidney; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, inositol phosphate; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; MAPK, mitogen-activated protein kinase.1The abbreviations used are: 7MSR, seven-membrane-spanning receptor; siRNA, small interfering RNA; Ang II, angiotensin II; AT1A, angiotensin type 1A; ERK, extracellular signal-regulated kinase; HA, hemagglutinin; GRK, G protein-coupled receptor kinase; PKC, protein kinase C; EGR-1, early growth response 1; C-tail, carboxyl-terminal; GFP, green fluorescent protein; HEK, human embryonic kidney; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IP, inositol phosphate; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; MAPK, mitogen-activated protein kinase. leads to G protein coupling as well as receptor phosphorylation by G protein-coupled receptor kinases (GRKs) and the recruitment of arrestins. Phosphorylation of 7MSRs has been shown to occur primarily in the carboxyl-terminal tail (C-tail) and to be critical for stable and high affinity arrestin binding (1Krupnick J.G. Gurevich V.V. Benovic J.L. J. Biol. Chem. 1997; 272: 18125-18131Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). Binding of arrestins not only mediates 7MSR desensitization by physically preventing the interaction between G protein and receptor but also initiates receptor internalization. Some receptors, such as the AT1A receptor and V2 vasopressin receptor, bind β-arrestins tightly and internalize with them into endosomal vesicles ("class B") (4Oakley R.H. Laporte S.A. Holt J.A. Caron M.G. Barak L.S. J. Biol. Chem. 2000; 275: 17201-17210Abstract Full Text Full Text PDF PubMed Scopus (679) Google Scholar). Others, such as the β2-adrenergic receptor, bind β-arrestins with relatively low affinity, dissociate from them in coated pits, and internalize without β-arrestins ("class A") (4Oakley R.H. Laporte S.A. Holt J.A. Caron M.G. Barak L.S. J. Biol. Chem. 2000; 275: 17201-17210Abstract Full Text Full Text PDF PubMed Scopus (679) Google Scholar). These patterns are easily distinguishable by confocal microscopy. Upon agonist stimulation, the AT1A receptor is phosphorylated on its carboxyl terminus by GRKs and protein kinase C (PKC) (5Qian H. Pipolo L. Thomas W.G. Biochem. J. 1999; 343: 637-644Crossref PubMed Scopus (31) Google Scholar, 6Oppermann M. Freedman N.J. Alexander R.W. Lefkowitz R.J. J. Biol. Chem. 1996; 271: 13266-13272Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar). The primary PKC phosphorylation sites have been mapped to Ser331, Ser338, and Ser348 (5Qian H. Pipolo L. Thomas W.G. Biochem. J. 1999; 343: 637-644Crossref PubMed Scopus (31) Google Scholar), which do not appear to be involved in β-arrestin binding (3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). In addition, there are also three distinct serine/threonine-rich regions in the COOH terminus. The most carboxyl-terminal of these regions (Ser346, Ser347, Ser348) appears to play a minimal role in β-arrestin binding (2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar), whereas mutations in either the most amino-terminal region (Ser328, Ser329, Ser331, Thr332) or the middle region (Ser335, Thr336, Ser338) change the pattern of β-arrestin 2-GFP recruitment from class B to class A, suggesting that these two regions are important for β-arrestin 2 binding (2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar). Consistent with this, alanine substitutions for Thr332, Ser335, Thr336, and Ser338 of the AT1A receptor result in a marked decrease in agonist-induced β-arrestin 1 association (3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). Furthermore, an AT1A mutant receptor truncated at residue 325, which lacks all of the serine and threonine residues of the carboxyl terminus and shows no agonist-dependent phosphorylation (5Qian H. Pipolo L. Thomas W.G. Biochem. J. 1999; 343: 637-644Crossref PubMed Scopus (31) Google Scholar), lacks the ability to interact with β-arrestin 1 in an agonist dependent manner as assessed by co-immunoprecipitation (3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). Accumulating evidence strongly suggests that β-arrestins also scaffold signaling pathways such as those leading to mitogen-activated protein kinase activation. In particular, β-arrestins have been shown to form complexes with the AT1A, neurokinin receptor 1, and V2 vasopressin receptors, which scaffold and facilitate the activation of the ERK kinase cascade (RAF, MEK, ERK) while targeting the activated ERK to endocytic vesicles in the cytoplasm (7Tohgo A. Pierce K.L. Choy E.W. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2002; 277: 9429-9436Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar, 8Tohgo A. Choy E.W. Gesty-Palmer D. Pierce K.L. Laporte S. Oakley R.H. Caron M.G. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2003; 278: 6258-6267Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 9DeFea K.A. Vaughn Z.D. O'Bryan E.M. Nishijima D. Dery O. Bunnett N.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11086-11091Crossref PubMed Scopus (351) Google Scholar). We recently showed that stimulation of a mutant AT1A receptor (DRY/AAY) with angiotensin II (Ang II) or a wild-type receptor with an Ang II analog ([Sar1,Ile4,Ile8]Ang II) fails to activate classical heterotrimeric G protein signaling but does lead to β-arrestin 2 recruitment and ERK1/2 activation (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar). In addition, depletion of cellular β-arrestin 2 via siRNA completely abolishes such G protein-independent activation of ERK1/2. Thus the DRY/AAY mutant AT1A receptor and [Sar1,Ile4,Ile8]Ang II mutant ligand appear to be selective for the β-arrestin 2-dependent G protein-independent pathway leading to ERK1/2 activation. Here we set out to develop corresponding AT1A receptor mutants capable of activating only G protein and independent of β-arrestin 2-mediated signaling; this was accomplished by mutating the carboxyl-terminal GRK phosphorylation sites in the receptor that are thought to be necessary for high affinity β-arrestin binding. This approach also permitted us to explore the correlation between β-arrestin/receptor interactions and β-arrestin-mediated ERK1/2 signaling. Materials—The radiolabeled compounds, 125I-Tyr-4-Ang II and myo-[3H]inositol, were obtained from PerkinElmer Life Sciences. Human Ang II was purchased from Peninsula Laboratories, Inc. [Sar1,Ile4,Ile8]Ang II was synthesized in the Cleveland Clinic core synthesis facility (Cleveland, OH). Ro-31-8425 was purchased from Calbiochem. Chemically synthesized double-stranded siRNAs corresponding to human β-arrestin 2 and a non-silencing control were described previously (11Ahn S. Wei H. Garrison T.R. Lefkowitz R.J. J. Biol. Chem. 2004; 279: 7807-7811Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). GeneSilencer transfection reagents were from Gene Therapy Systems (San Diego, CA). All other reagents were purchased from Sigma. The pcDNA3.1 expression plasmid encoding hemagglutinin (HA) epitope-tagged AT1A receptors was provided by M. G. Caron (Duke University). β-Arrestin 2-GFP was provided by Sudha Shenoy. Construction of AT1A Receptor Mutants—Mutant AT1A receptors were generated by mutagenesis PCR using pcDNA3.1-HA-AT1A receptor as a template and a QuikChange multisite-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. The primers for TSTS/A and 324Δ mutant receptors were 5′ p-CTCAAGCCTGTCTGCGAAAATGGCCGCTTGCTTACCGGCCTTC 3′ and 5′ p-CCCCCAAAGGCCTAGTCCCACTCAAGCC 3′, respectively. Mutations were confirmed by DNA sequencing. Cell Culture and DNA Transfection—HEK-293 cells were grown in Eagle's minimal essential medium with Earle's salts supplemented with 10% (v/v) fetal bovine serum and a 1% penicillin/streptomycin mixture (Sigma). Cells were transiently transfected using FuGENE 6 reagent (Roche Applied Science) according to the manufacturer's instructions. Inositol Phosphate Determination—Transiently transfected HEK-293 cells in 10-cm dishes were plated onto poly-d-lysine-coated 12-well plates (BD Biosciences). To assay for inositol phosphate (IP) production, cells were incubated overnight at 37 °C in labeling medium (1 μCi of myo-[3H]inositol in 0.5 ml of Eagle's minimal essential medium with 10% fetal bovine serum/well). Cells were washed with 20 mm HEPES containing 20 mm LiCl for 20 min at 37 °C and then treated with different concentrations of Ang II for 20 min. Total inositol phosphates were extracted and separated as described previously (12Cotecchia S. Ostrowski J. Kjelsberg M.A. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1992; 267: 1633-1639Abstract Full Text PDF PubMed Google Scholar). siRNA Transfection—HEK-293 cells were simultaneously transfected in 10-cm dishes with 1 μg of pcDNA3.1-HA-AT1A receptor or 3 μg of TSTS/A or 324Δ mutant AT1A receptor plasmids and 20 μg of β-arrestin 2 siRNA or control siRNA as described previously (13Ahn S. Nelson C.D. Garrison T.R. Miller W.E. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 1740-1744Crossref PubMed Scopus (188) Google Scholar). Similar receptor expression levels (150–200 fmol of receptors/mg of protein) were obtained under these experimental conditions as measured by radioligand binding. Forty-eight hours after transfection, cells were divided into 6-well plates, and cellular extracts were prepared three days after transfection. Confocal Microscopy—HEK-293 cells were transiently transfected in 10-cm dishes with 1 μg of pcDNA3.1-HA-AT1A receptor or 3 μg of TSTS/A or 324Δ mutant AT1A receptor plasmids and 0.3 μg of the β-arrestin 2-GFP plasmid. One day after transfection, cells were split onto collagen-coated 35-mm plastic dishes with glass bottoms (MatTek, Ashland, MA) and cultured overnight at 37 °C. Confocal microscopy was performed at ×100 magnification with a Zeiss laser-scanning microscope (LSM-510). Images were collected using a 488-nm excitation and 515–540-nm emission filter. Preparation of Cellular Extracts and Immunoblotting—Cells in 6-well plates were solubilized in a lysis buffer containing 50 mm HEPES (pH 7.5), 0.5% Nonidet P-40, 250 mm NaCl, 2 mm EDTA, 10% (v/v) glycerol, 1 mm sodium orthovanadate, 1 mm sodium fluoride, 1 mm phenylmethylsulfonyl fluoride, 5 μg/ml leupeptin, 5 μg/ml aprotinin, 1 μg/ml pepstatin A, and 100 μm benzaminidine. Proteins were separated on 10% Tris/glycine polyacrylamide gels (Invitrogen) and transferred to nitrocellulose membranes for immunoblotting. Phosphorylated ERK1/2, total ERK1/2, and β-arrestin 2 were detected by immunoblotting with a phospho-p44/42 MAPK antibody (Cell Signaling Technology, Inc., 1:3000), an anti-MAPK1/2 (Upstate Biotechnology, Inc., 1:10,000), and a rabbit polyclonal anti-β-arrestin 2 antibody, A2CT (1:5000), respectively. Chemiluminescent detection was performed using SuperSignal West Pico reagent (Pierce), and phosphorylated ERK1/2 immunoblots were quantified by densitometry with a Fluor-S MultiImager (Bio-Rad). Quantitative Real Time Reverse Transcription-PCR—Total RNA was purified from cells using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Two micrograms of total RNA was then used to generate cDNA using an Omniscript RT kit (Qiagen). For each PCR reaction, cDNAs corresponding to 300 ng of total RNA were used. Real time PCR was performed using a SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer's instructions on a Mx3000P™ real time PCR system (Stratagene). PCR reactions were carried out by incubating reactions at 95 °C for 10 min to inactive the reverse transcriptases and activate the DNA polymerase. Forty-five standard PCR cycles were carried out at 95 °C for 30 s for denaturing, 58 °C for 30 s for annealing, and 72 °C for 20 s for extension. Primers for human EGR-1 were CAGCACCTTCAACCCTCAG (sense) and CACAAGGTGTTGCCACTGTT (antisense). Additionally, real time reverse transcription-PCR for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was conducted as a reference for normalization. Primers for GAPDH were ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTGTA (antisense) In each experiment, reverse transcription-PCR reactions for both EGR-1 and GAPDH were performed in triplicate for each RNA sample. The average threshold cycle values for EGR-1 were normalized to the threshold cycle value of GAPDH and converted to a linear scale. To generate mutant AT1A receptors that are defective in their ability to associate with β-arrestin 2, we mutated the carboxyl-terminal sites in the receptor thought to be necessary for high affinity β-arrestin binding. The two mutant AT1A receptors created were TSTS/A, which has alanine substitutions for Thr332, Ser335, Thr336, and Ser338, and 324Δ, which truncates the AT1A receptor from residue 325 and lacks all of the serine and threonine residues at the carboxyl terminus (Fig. 1A). To test whether TSTS/A and 324Δ mutant receptors were defective in their ability to associate with β-arrestin 2, we examined the ability of wild-type, TSTS/A, and 324Δ mutant AT1A receptors to interact with β-arrestin 2-GFP upon agonist stimulation using confocal microscopy. Ang II induced translocation of β-arrestin 2-GFP to endocytic vesicles (class B pattern) in cells expressing wild-type AT1A receptors (Fig. 1B), demonstrating a stable interaction between β-arrestin 2-GFP and internalized AT1A receptors (2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar). Conversely, in cells expressing TSTS/A mutant receptor, Ang II induced translocation of β-arrestin 2-GFP only to the plasma membrane (class A pattern) (Fig. 1B). This is consistent with the previous report that the mutated serine/threonine sites are important for the high affinity binding of β-arrestin (2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). Ang II also induced translocation of β-arrestin 2-GFP to the plasma membrane in cells expressing the 324Δ mutant receptor but in a pattern that seemed weaker than the classic class A pattern of β-arrestin 2 recruitment (Fig. 1B) (4Oakley R.H. Laporte S.A. Holt J.A. Caron M.G. Barak L.S. J. Biol. Chem. 2000; 275: 17201-17210Abstract Full Text Full Text PDF PubMed Scopus (679) Google Scholar). The carboxyl terminus of AT1A receptors is not thought to be critical for G protein coupling (14Thomas W.G. Regul. Pept. 1999; 79: 9-23Crossref PubMed Scopus (91) Google Scholar). Consistent with this, both TSTS/A and 324Δ mutant receptors still coupled efficiently to G proteins as indicated by inositol phosphate production turnover assay (Fig. 2). In fact, both mutant receptors mediated somewhat greater constitutive and agonist-stimulated IP production than the wild-type receptor. Both the affinity and maximum activity of the mutant receptors were also increased (Fig. 2). This presumably reflects impaired β-arrestin-mediated desensitization. Thus, both the TSTS/A and 324Δ receptors are defective in their ability to associate with β-arrestin 2 while retaining the ability to interact with G protein. We have previously proposed that the AT1A receptor can stimulate ERK1/2 activation by two pathways mediated, respectively, by G protein and β-arrestin 2 (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar). Because both TSTS/A and 324Δ can still couple to G protein, activation of G protein-mediated ERK1/2 should not be compromised for either of these two mutant receptors. Consistent with this idea, stimulation of wild-type AT1A receptor, TSTS/A, and 324Δ mutant receptors with Ang II all led to robust ERK1/2 activation (Fig. 3, A and B), which, if anything, was increased with the mutant receptors. To determine the role of β-arrestin 2 in the activation of ERK1/2 by these mutant receptors, we compared the effect of β-arrestin 2 siRNA on the ERK1/2 activation induced by the wild-type AT1A receptor, TSTS/A, or 324Δ mutant receptors. Down-regulation of β-arrestin 2 significantly decreased the ERK1/2 activation induced by wild-type AT1A receptor by ∼50–60% (Fig. 3, A and C) as reported previously (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar). This suggests that about one-half of the ERK1/2 activation by the wild-type AT1A receptor is mediated by β-arrestin 2. In contrast, no significant inhibition in the ERK1/2 activation was observed when either of the mutant receptors was stimulated with Ang II in β-arrestin 2 siRNA-transfected cells (Fig. 3, A and C). These results indicate that ERK1/2 activated by TSTS/A or 324Δ mutant receptors is largely independent of β-arrestin 2 and mediated primarily by G proteins. In addition, these results demonstrate a good correlation between the ability of β-arrestin 2 to interact with the receptors (as observed by confocal microscopy) and the ability of the receptors to mediate β-arrestin 2-dependent ERK1/2 activation. We have shown previously that the G protein-mediated ERK1/2 activation by the wild-type AT1A receptor in HEK-293 cells requires activation of PKC, whereas the β-arrestin 2-dependent ERK1/2 activation does not (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar). If the ERK1/2 activation induced by TSTS/A or 324Δ mutant receptor is mostly dependent on the G protein-mediated pathway, then ERK1/2 activation induced by these mutant receptors should be more sensitive to PKC inhibition than activation induced by the wild-type AT1A receptor. As predicted, pretreatment with the PKC inhibitor Ro-31-8425 inhibited the wild-type AT1A receptor-stimulated ERK1/2 activation by ∼55%, whereas it inhibited TSTS/A or 324Δ mutant receptor-stimulated ERK1/2 activation by >80% (Fig. 4, A and B). A combination of β-arrestin 2 siRNA and Ro-31-8425 almost completely abolished the activation of ERK1/2 induced by the wild-type AT1A receptor as well as TSTS/A and 324Δ mutant receptors (Fig. 4, C and D). Ang II-induced EGR-1 transcription is mediated by ERK1/2 in vascular smooth muscle cells and Chinese hamster ovary cells (15Guillemot L. Levy A. Raymondjean M. Rothhut B. J. Biol. Chem. 2001; 276: 39394-39403Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 16Day F.L. Rafty L.A. Chesterman C.N. Khachigian L.M. J. Biol. Chem. 1999; 274: 23726-23733Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). To determine whether Ang II-induced transcription of EGR-1 is ERK1/2-dependent in HEK-293 cells, we tested the effect of U0126, a specific inhibitor of MEK, just upstream of ERK1/2, on Ang II-induced EGR-1 transcription. Pretreatment with U0126 completely abolished Ang II-induced ERK1/2 activation by the wild-type AT1A receptor (data not shown) and inhibited >97.3 ± 12.3% (n = 3) of Ang II-induced EGR-1 transcription, indicating that Ang II-induced transcription of EGR-1 is dependent on ERK1/2 activation in HEK-293 cells. Because mitogen-induced gene expression requires nuclear translocation of ERK1/2 (17Brunet A. Roux D. Lenormand P. Dowd S. Keyse S. Pouyssegur J. EMBO J. 1999; 18: 664-674Crossref PubMed Scopus (516) Google Scholar), Ang II-induced transcription of EGR-1 is a valid indication of nuclear ERK1/2 activation in HEK-293 cells. It has been demonstrated previously that β-arrestins facilitate 7MSR-mediated ERK activation but retain activated phospho-ERK1/2 in the cytosol, which is incapable of inducing ERK-dependent transcription (7Tohgo A. Pierce K.L. Choy E.W. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2002; 277: 9429-9436Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar, 8Tohgo A. Choy E.W. Gesty-Palmer D. Pierce K.L. Laporte S. Oakley R.H. Caron M.G. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2003; 278: 6258-6267Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 18DeFea K.A. Zalevsky J. Thoma M.S. Dery O. Mullins R.D. Bunnett N.W. J. Cell Biol. 2000; 148: 1267-1281Crossref PubMed Scopus (683) Google Scholar, 19Ahn S. Shenoy S.K. Wei H. Lefkowitz R.J. J. Biol. Chem. 2004; 279: 35518-35525Abstract Full Text Full Text PDF PubMed Scopus (408) Google Scholar). Thus, we would expect that G protein-dependent phospho-ERK1/2 translocates to the nucleus, leading to ERK-dependent transcription, whereas the β-arrestin 2-dependent phospho-ERK1/2 remains in the cytosol and cannot activate ERK-dependent transcription. To determine whether the induction of EGR-1 transcription by Ang II is mediated by the G protein-dependent but not by β-arrestin 2-dependent phospho-ERK1/2, we tested the effect of the PKC inhibitor Ro-31-8425 on the induction of EGR-1 transcription by Ang II. Stimulation of wild-type AT1A receptors with Ang II for 1 h led to an almost 22-fold increase in EGR-1 transcripts (Fig. 5). Pretreatment with the PKC inhibitor all but abolished this induction, suggesting that stimulation of EGR-1 transcription by Ang II is mediated by the G protein-dependent phospho-ERK. To further confirm that the β-arrestin 2-dependent phospho-ERK1/2 is unable to enhance transcription of EGR-1, we tested the ability of [Sar1,Ile4,Ile8]Ang II, which we have previously shown to activate ERK1/2 only via the β-arrestin 2-dependent pathway and not by the G protein-dependent pathway (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar), to induce EGR-1 transcription. Stimulation of wild-type AT1A receptors with [Sar1,Ile4,Ile8]Ang II did not lead to a significant increase in EGR-1 mRNA levels (Fig. 5A). The β-arrestin 2-activated phospho-ERK1/2 pool is confined to the cytoplasm (7Tohgo A. Pierce K.L. Choy E.W. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2002; 277: 9429-9436Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar, 8Tohgo A. Choy E.W. Gesty-Palmer D. Pierce K.L. Laporte S. Oakley R.H. Caron M.G. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2003; 278: 6258-6267Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 18DeFea K.A. Zalevsky J. Thoma M.S. Dery O. Mullins R.D. Bunnett N.W. J. Cell Biol. 2000; 148: 1267-1281Crossref PubMed Scopus (683) Google Scholar, 19Ahn S. Shenoy S.K. Wei H. Lefkowitz R.J. J. Biol. Chem. 2004; 279: 35518-35525Abstract Full Text Full Text PDF PubMed Scopus (408) Google Scholar). Therefore, we expect that β-arrestin 2 siRNA would not decrease the Ang II-induced EGR-1 transcription even though it leads to a significant decline in cellular phospho-ERK1/2 (Figs. 3 and 4). Consistent with this expectation, β-arrestin 2 siRNA did not significantly change the Ang II-induced EGR-1 transcription (Fig. 5B). The 324Δ and TSTS/A mutant AT1A receptors are defective in their ability to tightly bind β-arrestins (Fig. 1B) and are more capable of stimulating G protein signaling than the wildtype receptor (Fig. 2). Thus, they might be expected to induce EGR-1 transcription even more strongly than the wild-type AT1A receptor. Consistent with our IP production data, a significant increase in the basal EGR-1 transcripts was observed in cells expressing TSTS/A or 324Δ mutant AT1A receptor (Fig. 5C). In addition, stimulation of the 324Δ mutant AT1A receptor with Ang II for 1 h led to a significant increase in the amount of EGR-1 transcripts as compared with the amount of EGR-1 transcripts induced by stimulation of the wild-type AT1A receptor (Fig. 5C), whereas TSTS/A induced an intermediate level of EGR-1 transcripts. We have previously proposed that the AT1A receptor can induce ERK1/2 activation through two independent pathways mediated by G protein and β-arrestin 2, respectively (10Wei H. Ahn S. Shenoy S.K. Karnik S.S. Hunyady L. Luttrell L.M. Lefkowitz R.J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10782-10787Crossref PubMed Scopus (546) Google Scholar). Here we provide support for this idea by showing that the nature of the interaction between β-arrestin 2 and the AT1A receptor is determinative for β-arrestin 2-mediated ERK1/2 activation. Using EGR-1 mRNA as an indicator for nuclear ERK1/2 activation, we further show that G protein-mediated ERK1/2 activation induces EGR-1 transcription, whereas β-arrestin 2-mediated ERK1/2 activation does not. Not only is this consistent with previous reports that β-arrestins sequester phospho-ERK1/2 in the cytosol (7Tohgo A. Pierce K.L. Choy E.W. Lefkowitz R.J. Luttrell L.M. J. Biol. Chem. 2002; 277: 9429-9436Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar, 18DeFea K.A. Zalevsky J. Thoma M.S. Dery O. Mullins R.D. Bunnett N.W. J. Cell Biol. 2000; 148: 1267-1281Crossref PubMed Scopus (683) Google Scholar, 19Ahn S. Shenoy S.K. Wei H. Lefkowitz R.J. J. Biol. Chem. 2004; 279: 35518-35525Abstract Full Text Full Text PDF PubMed Scopus (408) Google Scholar), but it is also indicative of a clear functional divergence in the consequence of ERK1/2 activation by the two pathways. Although several cytosolic proteins such as GRK2, Bcl2, and tau are regulated by ERK1/2 phosphorylation (20Elorza A. Penela P. Sarnago S. Mayor Jr., F. J. Biol. Chem. 2003; 278: 29164-29173Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 21Breitschopf K. Haendeler J. Malchow P. Zeiher A.M. Dimmeler S. Mol. Cell. Biol. 2000; 20: 1886-1896Crossref PubMed Scopus (290) Google Scholar, 22Angulo E. Casado V. Mallol J. Canela E.I. Vinals F. Ferrer I. Lluis C. Franco R. Brain Pathol. 2003; 13: 440-451Crossref PubMed Scopus (136) Google Scholar), the physiological substrates of the cytosolic phospho-ERK1/2 activated by β-arrestin 2 remain unknown. Nevertheless, it is clear that the β-arrestin 2- and G protein-mediated signaling pathways have different physiological consequences. The 324Δ mutant receptor lacks all the phosphorylation sites in its C-tail and cannot be phosphorylated in response to Ang II stimulation (5Qian H. Pipolo L. Thomas W.G. Biochem. J. 1999; 343: 637-644Crossref PubMed Scopus (31) Google Scholar). However, our confocal data clearly indicate that this mutant receptor can recruit β-arrestin 2 to the plasma membrane in an agonist-dependent manner. These results show that β-arrestin 2 can bind to AT1A receptors in a phosphorylation-independent manner, albeit with lower affinity. However, in the case of AT1A receptors, this phosphorylation-independent binding of β-arrestin 2 does not apparently trigger ERK1/2 activation. Although phosphorylation of the C-tail appears to be required for high affinity binding of β-arrestins (2Oakley R.H. Laporte S.A. Holt J.A. Barak L.S. Caron M.G. J. Biol. Chem. 2001; 276: 19452-19460Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar), several receptors have been reported to interact with β-arrestins through the third intracellular loop. For example, both the third intracellular loop and the C-tail are important for β-arrestin binding to the neurokinin receptor 1 (23Schmidlin F. Roosterman D. Bunnett N.W. Am. J. Physiol. 2003; 285: C945-C958Crossref PubMed Scopus (36) Google Scholar), delta opioid receptor (24Cen B. Yu Q. Guo J. Wu Y. Ling K. Cheng Z. Ma L. Pei G. J. Neurochem. 2001; 76: 1887-1894Crossref PubMed Scopus (41) Google Scholar, 25Cen B. Xiong Y. Ma L. Pei G. Mol. Pharmacol. 2001; 59: 758-764Crossref PubMed Scopus (65) Google Scholar), and lutropin/choriogonadotropin receptor (26Bhaskaran R.S. Min L. Krishnamurthy H. Ascoli M. Biochemistry. 2003; 42: 13950-13959Crossref PubMed Scopus (23) Google Scholar). In each case, Ser/Thr residues in the third intracellular loop also appear to be critical for β-arrestin binding. However, we found that an AT1A mutant receptor with alanine substitutions for all three Ser/Thr residues in the third intracellular loop showed no difference in recruiting β-arrestin 2-GFP compared with the wild-type AT1A receptor (data not shown). In addition, an AT1A mutant receptor-combining truncation of the C-tail and alanine substitutions for all three Ser/Thr residues in the third intracellular loop can still recruit β-arrestin 2-GFP to the plasma membrane in an agonist-dependent manner (data not shown). Together with previous reports that a C-tail truncation mutant of AT1A receptor at residue 325 cannot be phosphorylated upon Ang II stimulation (3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar), these results suggest that the phosphorylation-independent association of β-arrestin 2 with the AT1A receptor is driven by conformational changes in the receptor, which occur upon agonist binding. Such a conformational change-dependent recruitment of β-arrestins is not unique. For example, the interaction between β-arrestin 2 and the lutropin/choriogonadotropin receptor depends mostly on receptor activation rather than on receptor phosphorylation (27Min L. Galet C. Ascoli M. J. Biol. Chem. 2002; 277: 702-710Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar), and an Asp residue in the third intracellular loop is important for β-arrestin 2 binding to this receptor (28Mukherjee S. Gurevich V.V. Preninger A. Hamm H.E. Bader M.F. Fazleabas A.T. Birnbaumer L. Hunzicker-Dunn M. J. Biol. Chem. 2002; 277: 17916-17927Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). At first glance, the pattern of agonist-dependent recruitment of β-arrestin 2-GFP to the plasma membrane by the 324Δ mutant receptor is similar to the pattern of β-arrestin 2-GFP recruitment by class A receptors (4Oakley R.H. Laporte S.A. Holt J.A. Caron M.G. Barak L.S. J. Biol. Chem. 2000; 275: 17201-17210Abstract Full Text Full Text PDF PubMed Scopus (679) Google Scholar). However, the binding of β-arrestin 2 to 324Δ mutant receptors and the binding of β-arrestin 2 to a class A receptor might be fundamentally different because β-arrestin 2 recruitment by a class A receptor, such as the β2-adrenergic receptor, is primarily dependent on receptor phosphorylation (29Lohse M.J. Andexinger S. Pitcher J. Trukawinski S. Codina J. Faure J.P. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1992; 267: 8558-8564Abstract Full Text PDF PubMed Google Scholar). The inability of TSTS/A and 324Δ mutant receptors to stably interact with β-arrestins resulted in dramatic inhibition of receptor internalization and increased IP production (3Qian H. Pipolo L. Thomas W.G. Mol. Endocrinol. 2001; 15: 1706-1719PubMed Google Scholar). As a consequence, G protein-mediated ERK1/2 activation was augmented, further reducing the role of the β-arrestin 2-dependent pathway. This may explain why the proportion of β-arrestin 2-dependent ERK1/2 activation induced by stimulation of the TSTS/A or 324Δ mutant receptors is so low, making it hard to detect by the β-arrestin 2 siRNA method. Our data further suggest that the low affinity association of β-arrestin 2 with the AT1A receptor, which is not dependent on receptor phosphorylation, is less able to initiate β-arrestin 2-dependent signaling and that a high affinity state of β-arrestin 2 binding, which requires receptor phosphorylation, is necessary for β-arrestin 2-dependent signaling. We thank Donna Addison and Elizabeth Hall for excellent secretarial assistance. We also thank Dr. Erin J. Whalen for critical reading and comments.