Internalization and Sequestration of the Human Prostacyclin Receptor
2000; Elsevier BV; Volume: 275; Issue: 41 Linguagem: Inglês
10.1074/jbc.m003873200
ISSN1083-351X
AutoresEmer M. Smyth, Sandra Austin, Muredach P. Reilly, Garret A. FitzGerald,
Tópico(s)Neuropeptides and Animal Physiology
ResumoProstacyclin (PGI2), the major product of cyclooxygenase in macrovascular endothelium, mediates its biological effects through its cell surface G protein-coupled receptor, the IP. PKC-mediated phosphorylation of human (h) IP is a critical determinant of agonist-induced desensitization (Smyth, E. M., Hong Li, W., and FitzGerald, G. A. (1998) J. Biol. Chem. 273, 23258–23266). The regulatory events that follow desensitization are unclear. We have examined agonist-induced sequestration of hIP. Human IP, tagged at the N terminus with hemagglutinin (HA) and fused at the C terminus to the green fluorescent protein (GFP), was coupled to increased cAMP (EC50 = 0.39 ± 0.09 nm) and inositol phosphate (EC50 = 86.6 ± 18.3 nm) generation when overexpressed in HEK 293 cells. Iloprost-induced sequestration of HAhIP-GFP, followed in real time by confocal microscopy, was partially colocalized to clathrin-coated vesicles. Iloprost induced a time- and concentration-dependent loss of cell surface HA, indicating receptor internalization, which was prevented by inhibitors of clathrin-mediated trafficking and partially reduced by cotransfection of cells with a dynamin dominant negative mutant. Sequestration (EC50 = 27.6 ± 5.7 nm) was evident at those concentrations of iloprost that induce PKC-dependent desensitization. Neither the PKC inhibitor GF109203X nor mutation of Ser-328, the site for PKC phosphorylation, altered receptor sequestration indicating that, unlike desensitization, internalization is PKC-independent. Deletion of the C terminus prevented iloprost-induced internalization, demonstrating the critical nature of this region for sequestration. Internalization was unaltered by cotransfection of cells with G protein-coupled receptor kinases (GRK)-2, -3, -5, -6, arrestin-2, or an arrestin-2 dominant negative mutant, indicating that GRKs and arrestins do not play a role in hIP trafficking. The hIP is sequestered in response to agonist activation via a PKC-independent pathway that is distinct from desensitization. Trafficking is dependent on determinants located in the C terminus, is GRK/arrestin-independent, and proceeds in part via a dynamin-dependent clathrin-coated vesicular endocytotic pathway although other dynamin-independent pathways may also be involved. Prostacyclin (PGI2), the major product of cyclooxygenase in macrovascular endothelium, mediates its biological effects through its cell surface G protein-coupled receptor, the IP. PKC-mediated phosphorylation of human (h) IP is a critical determinant of agonist-induced desensitization (Smyth, E. M., Hong Li, W., and FitzGerald, G. A. (1998) J. Biol. Chem. 273, 23258–23266). The regulatory events that follow desensitization are unclear. We have examined agonist-induced sequestration of hIP. Human IP, tagged at the N terminus with hemagglutinin (HA) and fused at the C terminus to the green fluorescent protein (GFP), was coupled to increased cAMP (EC50 = 0.39 ± 0.09 nm) and inositol phosphate (EC50 = 86.6 ± 18.3 nm) generation when overexpressed in HEK 293 cells. Iloprost-induced sequestration of HAhIP-GFP, followed in real time by confocal microscopy, was partially colocalized to clathrin-coated vesicles. Iloprost induced a time- and concentration-dependent loss of cell surface HA, indicating receptor internalization, which was prevented by inhibitors of clathrin-mediated trafficking and partially reduced by cotransfection of cells with a dynamin dominant negative mutant. Sequestration (EC50 = 27.6 ± 5.7 nm) was evident at those concentrations of iloprost that induce PKC-dependent desensitization. Neither the PKC inhibitor GF109203X nor mutation of Ser-328, the site for PKC phosphorylation, altered receptor sequestration indicating that, unlike desensitization, internalization is PKC-independent. Deletion of the C terminus prevented iloprost-induced internalization, demonstrating the critical nature of this region for sequestration. Internalization was unaltered by cotransfection of cells with G protein-coupled receptor kinases (GRK)-2, -3, -5, -6, arrestin-2, or an arrestin-2 dominant negative mutant, indicating that GRKs and arrestins do not play a role in hIP trafficking. The hIP is sequestered in response to agonist activation via a PKC-independent pathway that is distinct from desensitization. Trafficking is dependent on determinants located in the C terminus, is GRK/arrestin-independent, and proceeds in part via a dynamin-dependent clathrin-coated vesicular endocytotic pathway although other dynamin-independent pathways may also be involved. prostacyclin cyclooxygenase G protein-coupled receptor prostacyclin receptor, PGI2 receptor PGI2 synthase GPCR kinase clathrin-coated vesicle adrenoreceptor human IP hemagglutinin green fluorescent protein Dulbecco's modified Eagle's medium enzyme-linked immunosorbent assay polyacrylamide gel electrophoresis protein kinase C HAhIPSer-328 → Ala HAhIP Ser-328 → Ala/Ser-374 → Ala HAhIP374Ala HAhIPC-DEL thromboxane receptor Prostacyclin (PGI2)1 is the major product of cyclooxygenase (COX) in macrovascular endothelium (1Vane J.R. Botting R.M. Am. J. Cardiol. 1995; 75: 3-10Abstract Full Text PDF PubMed Scopus (271) Google Scholar). In humans, the predominant source of prostacyclin biosynthesis is COX-2 (2McAdam B.F. Catella-Lawson F. Mardini I.A. Kapoor S. Lawson J.A. FitzGerald G.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 272-277Crossref PubMed Scopus (1189) Google Scholar, 3Catella-Lawson F. McAdam B. Morrison B.W. Kapoor S. Kujubu D. Antes L. Lasseter K.C. Quan H. Gertz B.J. FitzGerald G.A. J. Pharmacol. Exp. Ther. 1999; 289: 735-741PubMed Google Scholar), probably reflecting induction of its expression in endothelium by physiological rates of shear (4Topper J.N. Cai J. Falb D. Gimbrone Jr., M.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10417-10422Crossref PubMed Scopus (722) Google Scholar). COX-2 is also up-regulated in vascular cells by cytokines and growth factors (5Herschman H.R. Trends Cardiovasc. Med. 1998; 8: 145-150Crossref PubMed Scopus (21) Google Scholar), and both COX isoforms are coexpressed in monocyte/macrophages infiltrating human atherosclerotic plaque (6Schonbeck U. Sukhova G.K. Graber P. Coulter S. Libby P. Am. J. Pathol. 1999; 155: 1281-1291Abstract Full Text Full Text PDF PubMed Scopus (383) Google Scholar). PGI2 inhibits platelet activation, is a vasodilator, and possesses proinflammatory and antiproliferative properties in vitro (7Vane J.R. Br. J. Pharmacol. 1969; 35: 209-242Crossref PubMed Scopus (445) Google Scholar, 8Moncada, S., and Vane, J. R. (1981) 61, 369–372.Google Scholar, 9Zucker T.-P. Bonisch D. Hasse A. Grosser T. Weber A.-A. Schror K. Eur. J. Pharmacol. 1998; 245: 213-220Crossref Scopus (50) Google Scholar). It is thought to function as a homeostatic regulator of platelet-vascular interactions in settings of plaque rupture, such as unstable angina, where biosynthesis of PGI2 is increased during ischemic episodes (8Moncada, S., and Vane, J. R. (1981) 61, 369–372.Google Scholar, 10Oates J.A. FitzGerald G.A. Branch R.A. Jackson E.K. Knapp H. Roberts L.J. N. Engl. J. Med. 1988; 319: 689-698Crossref PubMed Scopus (321) Google Scholar, 11Fitzgerald D.J. Catella F. FitzGerald G.A. N. Engl. J. Med. 1986; 315: 983-989Crossref PubMed Scopus (1009) Google Scholar, 12Fitzgerald D.J. Doran J. Jackson E.K. FitzGerald G.A. J. Clin. Invest. 1986; 77: 496-502Crossref PubMed Scopus (68) Google Scholar). Sustained overproduction of PGI2 is evident physiologically in pregnancy (13Goodman R.P. Killam A.P. Brash A.R. Branch R.A. Am. J. Obstet. Gynecol. 1982; 142: 817-822Abstract Full Text PDF PubMed Scopus (188) Google Scholar) and in severe atherosclerosis (14FitzGerald G.A. Smith B. Pedersen A.K. Brash A.R. N. Engl. J. Med. 1984; 310: 1065-1068Crossref PubMed Scopus (398) Google Scholar). Interest in the importance of PGI2 in vivohas increased recently with the observation that COX-2 inhibitors suppress PGI2, without concomitant inhibition of COX-1-derived thromboxane formation by platelets (2McAdam B.F. Catella-Lawson F. Mardini I.A. Kapoor S. Lawson J.A. FitzGerald G.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 272-277Crossref PubMed Scopus (1189) Google Scholar, 3Catella-Lawson F. McAdam B. Morrison B.W. Kapoor S. Kujubu D. Antes L. Lasseter K.C. Quan H. Gertz B.J. FitzGerald G.A. J. Pharmacol. Exp. Ther. 1999; 289: 735-741PubMed Google Scholar). PGI2 activates a G protein-coupled membrane receptor (GPCR), the IP (15Boie Y. Rushmore T.H. Darmon-Goodwin A. Grygorczyk R. Slipetz D.M. Metters K.M. Abramovitz M. J. Biol. Chem. 1994; 269: 12173-12178Abstract Full Text PDF PubMed Google Scholar, 16Namba T. Oida H. Sugimoto Y. Kakizuka A. Negishi M. Ichikawa A. Narumiya S. J. Biol. Chem. 1994; 269: 9986-9992Abstract Full Text PDF PubMed Google Scholar). However, no antagonist of the IP exists, limiting our ability to probe the role of this eicosanoid in vivo. Nevertheless, directed overexpression of PGI2synthase (PGIS) reduces elevated pulmonary blood pressure (17Geraci M.W. Gao B. Shepherd D.C. Moore M.D. Westcott J.Y. Fagan K.A. Alger L.A. Tuder R.M. Voelkel N.F. J. Clin. Invest. 1999; 103: 1509-1515Crossref PubMed Scopus (190) Google Scholar), and the proliferative response to vascular injury (18Todaka T. Yokoama C. Yanamoto N. Hagata I. Tsukahara T. Hara S. Hatae T. Morishita R. Aoki M. Ogihara T. Kanedam Y. Tanabe T. Stroke. 1999; 30: 419-426Crossref PubMed Scopus (66) Google Scholar) and polymorphism in the PGIS promoter has been related to the severity of hypertension (19Iwai N. Katsuya T. Ishikawa K. Mannami T. Ogata J. Higaki J. Ogihara T. Tanabe T. Baba S. Circulation. 1999; 100: 2231-2236Crossref PubMed Scopus (74) Google Scholar). Deletion of the IP increases the response to thrombotic stimuli and both pain and inflammation in the periphery (20Murata T. Ushikubi F. Matsuoka T. Hirata M. Yamasaki A. Sugimoto Y. Ichikawa A. Azem Y. Tanaka T. Yoshida N. Uano A. Oh-Ishi S. Narumiya S. Nature. 1997; 388: 678-682Crossref PubMed Scopus (680) Google Scholar). On the other hand, PGIS and the IP are expressed widely in the central nervous system (21Siegle I. Klein T. Zou M.H. Fritz P. Komhoff M. J. Histochem. Cytochem. 2000; 48: 631-642Crossref PubMed Scopus (29) Google Scholar,22Matsumura K. Watanabe Y. Onoe H. Watanabe Y. Neuroscience. 1995; 65: 493-503Crossref PubMed Scopus (85) Google Scholar), where the function of this eicosanoid is unknown. Given the acute and chronic alterations in PGI2biosynthesis in disease (1Vane J.R. Botting R.M. Am. J. Cardiol. 1995; 75: 3-10Abstract Full Text PDF PubMed Scopus (271) Google Scholar), the tachyphylaxis that complicates administration of PGI2 and its analogs (23Archer S.L. Mike D. Crow J. Long W. Weir E.K. Chest. 1996; 109: 750-755Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 24McLaughlin V.V. Genthner D.E. Panella M.M. Rich S. N. Engl. J. Med. 1998; 338: 273-277Crossref PubMed Scopus (614) Google Scholar), and the interest in overexpression of its biosynthetic enzymes or receptor as a therapeutic strategy (18Todaka T. Yokoama C. Yanamoto N. Hagata I. Tsukahara T. Hara S. Hatae T. Morishita R. Aoki M. Ogihara T. Kanedam Y. Tanabe T. Stroke. 1999; 30: 419-426Crossref PubMed Scopus (66) Google Scholar), a detailed understanding of the molecular mechanisms that regulate the response of the IP to ligation by agonist would seem desirable. We and others (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) have previously provided evidence implicating both serine-threonine kinases, such as protein kinases A and C, and GPCR kinases (GRKs) in agonist-induced receptor phosphorylation and desensitization, consequent to the IP, and other eicosanoid receptors, being uncoupled from G proteins. However, the fate of the IP after those events is unclear. One possibility is that GRK-mediated phosphorylation would target the IP for binding by arrestin-like adapter proteins, which in turn might direct it toward sequestration in clathrin-coated vesicles (CCVs), where dephosphorylation would prepare the IP for recycling to the plasma membrane (32Ferguson S.S.G. Caron M.G. Semin. Cell Dev. Biol. 1998; 9: 119-127Crossref PubMed Scopus (160) Google Scholar, 33Bunemann M. Lee K.B. Pals-Rylaarsdam R. Roseberry A.G. Hosey M.M. Annu. Rev. Physiol. 1999; 61: 169-192Crossref PubMed Scopus (133) Google Scholar). Alternatively, it might be targeted for lysosomal degradation (32Ferguson S.S.G. Caron M.G. Semin. Cell Dev. Biol. 1998; 9: 119-127Crossref PubMed Scopus (160) Google Scholar, 33Bunemann M. Lee K.B. Pals-Rylaarsdam R. Roseberry A.G. Hosey M.M. Annu. Rev. Physiol. 1999; 61: 169-192Crossref PubMed Scopus (133) Google Scholar). Arrestin/clathrin-dependent pathways of sequestration are followed by several GPCRs including the β2-adrenoreceptor (AR; 34) and m1, -3, and -4 muscarinic acetylcholine (35Vogler O. Nolte B. Voss M. Schmidt M. Jakobs K.H. van Koppen C.J. J. Biol. Chem. 1999; 274: 12333-12338Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) receptors, although several GPCRs diverge from this paradigm. The preferred pathway for agonist-induced internalization of the m2 muscarinic receptor (36Pals-Rylaarsdam R. Gurevich V.V. Lee K.B. Ptasienski J.A. Benovic J.L. Hosey M.M. J. Biol. Chem. 1997; 272: 23682-23689Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar) and angiotensin II type 1A receptor (37Zhang J. Ferguson S.S.G. Barak L.S. Menard L. Caron M.G. J. Biol. Chem. 1996; 271: 18302-18305Abstract Full Text Full Text PDF PubMed Scopus (398) Google Scholar) is arrestin- and clathrin-independent. Similarly, internalization of the cholecystokinin receptor can occur via clathrin-dependent and -independent pathways (38Roettger B.F. Rentsch R.U. Pinon D. Holicky E. Hadac E. Larkin J.M. Miller L.J. Cell Biol. 1995; 128: 1029-1041Crossref PubMed Scopus (204) Google Scholar). Furthermore, both GRK-dependent and -independent mechanisms may regulate the same receptor. The β1-AR (39Freedman N.J. Liggett S.B. Drachman D.E. Pei G. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1995; 270: 17953-17961Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar), thrombin (40Ishii K. Chen J. Ishii M. Koch W.J. Freedman N.J. Lefkowitz R.J. Coughlin S.R. J. Biol. Chem. 1994; 269: 1125-1130Abstract Full Text PDF PubMed Google Scholar), angiotensin II-1A (41Opperman M. Freedman N.J. Alexander R.W. Lefkowitz R.J. J. Biol. Chem. 1996; 271: 13266-13272Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar), and m1 muscarinic acetylcholine (42Haga K. Kameyama K. Haga T. Kikkawa U. Shiozaki K. Uchiyama H. J. Biol. Chem. 1996; 271: 2776-2782Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar) receptors are regulated by the action of both second messenger kinases and GRKs. In addition, a β2-AR Y326A mutant, which does not internalize, is unresponsive to phosphorylation by GRKs but is phosphorylated and desensitized in a PKA-dependent manner (43Ferguson S.S.G. Menard L. Barak L.S. Koch W.J. Colapietro A.-M. Caron M.G. J. Biol. Chem. 1995; 270: 24782-24789Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). Whereas agonist-dependent phosphorylation of the human (h) IP primarily involves PKC in the desensitization process (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar), the events that may direct internalization and sequestration are unknown. We provide evidence that the IP is indeed sequestered following desensitization but that this process occurs independent of both PKC and GRKs. Iloprost, the cAMP radioimmunoassay, and enhanced chemiluminescence (ECL) kits, as well as all radiochemicals, were purchased from Amersham Pharmacia Biotech. Monoclonal anti-HA and anti-GFP antibodies were obtained from Convance (Princeton, NJ). Anti-clathrin and anti-caveolin-1 were from Transduction Laboratories (Lexington, KY). pcDNA III was obtained from Invitrogen (San Diego). Isobutylmethylxanthine, ATP, cAMP, GTP, alumina, and lysine were all purchased from Sigma. All cell culture reagents, G418, Albumax, and the PKC α-pseudosubstrate peptide were obtained from Life Technologies, Inc. DOTAP, Fugene-6, Complete Protease Inhibitor tablets, and 4-nitrophenyl phosphate were obtained from Roche Molecular Biochemicals. AG 1-X8 resin (formate form) and AG W-X4 resin (hydrogen form) were purchased from Bio-Rad. The hIP cDNA was generously donated by Dr. Kathleen Metters (Merck Sharp and Dohme). GRK2 (bovine), GRK3 (bovine), GRK5 (human), GRK6 (human), arrestin-2 (human), arrestin-2-(319–418) (human), and dynamin (human) cDNAs and antibodies to GRK2 and arrestin-2 were generous gifts from Dr. Jeffery Benovic (Jefferson University, Philadelphia). Oligonucleotides were from Genosys (The Woodlands, TX). The green fluorescent protein (GFP) was fused to the C-terminal end of the hemagglutinin (HA)-tagged hIP (HAhIP, see Ref. 25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) to generate the construct HAhIP-GFP. The 3′-oligonucleotide (TTTGGATCCGCAGAGGGAGCAGGCGACGCT) contained a BamHI site and the coding sequence for the last seven amino acids of the hIP without the TGA stop codon. The 5′-oligonucleotide containing an internal hIP sequence included a unique EcoNI restriction site. These primers were used in a polymerase chain reaction using the hIP cDNA as a template (15Boie Y. Rushmore T.H. Darmon-Goodwin A. Grygorczyk R. Slipetz D.M. Metters K.M. Abramovitz M. J. Biol. Chem. 1994; 269: 12173-12178Abstract Full Text PDF PubMed Google Scholar). The product was digested withBamHI and EcoNI and ligated to theHindIII-EcoNI fragment from HAhIP to yield the full HAhIP coding sequence without a stop codon. This was ligated into the GFP-N3 mammalian expression vector (CLONTECH, Palo Alto, CA) to generate a plasmid that contained the HAhIP sequence upstream of, and in-frame with, the GFP coding sequence for expression of HAhIP-GFP. HEK 293 cells (American Type Tissue Culture Collection; Manassas, VA) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum, 50 units/ml penicillin, 50 μg/ml streptomycin, 25 mm HEPES, and 2 mm glutamine. All cDNAs were cloned into the mammalian expression vector pCDNA III for transfection, unless otherwise indicated. For stable transfections cells were seeded at 1.5 × 106 cells/100-mm dish and, the next day, transfected with 10 μg/dish DNA by liposome-mediated transfer (DOTAP) as described previously (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Stable transfectants were selected in the presence of G418 (1 mg/ml). For transient transfections, cells were grown to 60–80% confluence overnight and transfected with 10 μg/100-mm dish DNA by non-liposome-mediated transfer using Fugene6 at a ratio of 1:3 (μg DNA:μl Fugene6). Cells were plated at the time of transfection to multiwell or 60-mm dishes, as required, and assayed 48 h later. HEK transfected with HAhIP-GFP were observed by phase contrast microscopy under a green fluorescent lamp, under normal growth conditions. For confocal microscopy, cells were grown to ∼50% confluence in lysine-coated microwell dishes. Medium was replaced with serum-free DMEM, and GFP fluorescence was examined in real time by confocal microscopy. For colocalization experiments cells were preloaded with rhodamine-conjugated transferrin (Molecular Probes, Eugene, OR; 250 μg/ml, 60 min) and examined by confocal microscopy. Cells, grown to confluence in 24-well plates coated with lysine (0.1 mg/ml), were treated with iloprost (10 min at 37 °C). Reactions were terminated by aspiration, and cAMP was extracted with ice-cold 65% ethanol for 30 min. Samples were dried under vacuum and reconstituted in assay buffer, and cAMP was quantified by radioimmunoassay as described previously (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Cells, grown to 70–80% confluence in 12-well plates coated with 0.1 mg/ml lysine, were labeled overnight with 2 μCi/ml [3H]myoinositol in DMEM (without inositol) containing 0.5% albumax, 50 units/ml penicillin, and 50 μg/ml streptomycin. Thirty minutes prior to stimulation cells were treated with 20 mm LiCl at 37 °C. After stimulation for 10 min at 37 °C, the reactions were terminated by aspiration. Total inositol phosphates were extracted with 750 μl of 10 mm formic acid and recovered by anion exchange as described previously (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Adenylyl cyclase activity was assayed in cell membranes, as described previously (26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Briefly, assays were carried out in 50 mm Tris containing 3 mm MgCl2, 1.5 mm EDTA, 0.15 mm ATP, 0.05 mm GTP, 0.1 mm cAMP, 2.8 mm phosphoenolpyruvate, and 0.1 mmisobutylmethylxanthine. Each reaction contained 1 unit of myokinase, 1 unit of pyruvate kinase, and 2 μCi of [α-32P]ATP (30 Ci/mmol). Reactions were started by the addition of membranes (5 μg per assay tube) and, after 30 min at 30 °C, were quenched by the addition of 1 ml of 5% trichloroacetic acid containing 30,000 cpm of [3H]cAMP (41 Ci/mmol). Samples were subjected to sequential chromatography through Dowex (AG W-X4, hydrogen form) and alumina (WN-6, neutral).32P and 3H in the eluates were estimated by scintillation counting. PKC activity in total cellular lysates was determined by phosphorylation of the α-pseudosubstrate peptide. Cells in 6-well plates were lysed (50 mm Tris-HCl, pH 7.4, and Complete Protease Inhibitor mixture) by sonication. The reaction was carried out in a total volume of 50 μl containing 50 mm Tris-HCl, pH 7.4, 250 μg/ml bovine serum albumin, 1 mm EGTA, 100 μg/ml phosphatidylserine, 100 nm phorbol 12-myristate 13-acetate, 10 mmα-pseudosubstrate peptide, 25 mm ATP, and 7.5 mm magnesium acetate. After incubation at 30 °C for 5 min, 25 μl of each reaction was spotted onto Whatman PE-81 paper. The paper was washed three times with 0.1 m phosphoric acid and once with acetone and air-dried, and the radioactivity was counted in a scintillation counter. Cells were lysed (RIPA, 50 mmTris, 5 mm EDTA, pH 8.0, containing 150 mmNaCl, 1% Nonidet P-40, 0.1% SDS, 0.5% deoxycholic acid, 1 tablet/50 ml of Complete Protease Inhibitor mixture), drawn though a 23-gauge needle 6 times, and centrifuged at 14,000 rpm. Proteins were resolved on 10% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) and transferred to nitrocellulose. Receptors were visualized by treating immunoblots, first blocked with 5% non-fat milk in TBS-T (50 mm Tris, 250 mm NaCl, pH 7.6, containing 1% Tween 20) for 2 h at room temperature, with anti-HA (1:1500 dilution) or anti-GFP (1:1000 dilution), as appropriate. This was followed by incubation with horseradish peroxidase-conjugated anti-mouse IgG (1:5000 dilution). Antigen-antibody complexes were visualized by ECL. Surface HAhIP expression was measured by ELISA. Cells were seeded on 24-well dishes coated with lysine (0.1 mg/ml) and, 48 h later, treated with the agent of interest at 37 °C. Reactions were stopped by aspiration and fixation (0.4% paraformaldehyde in PBS, 4 °C, 10–15 min). Following 3 washes with PBS, cell monolayers were blocked (2% BSA in PBS, room temperature, 30 min) and HA expression quantified by incubation with monoclonal anti-HA antibody (1:1500 dilution in PBS) for 90 min at room temperature. Antigen-antibody complexes were revealed, following three washes with PBS, by incubation with alkaline peroxidase-conjugated anti-mouse IgG (1:10,000 dilution in PBS) for 30 min. Cell surface alkaline phosphatase was detected, after four washes with PBS, by following the conversion of 4-nitrophenyl phosphate by measurement of absorbance at 405 nm. A background control in which anti-HA was not added was included in each plate and subtracted from the final absorbance measurements. Absorbance readings above background were negligible in vector control cells (data not shown) indicating that binding of the anti-HA antibody was specific for HAhIP. Data were compared by Student'st test or analysis of variance, followed by Dunnet's test, for multiple comparisons. A p value of <0.05 was considered significant. We have described previously the generation of HEK cells lines that express a HA-tagged hIP (HAhIP-HEK, see Ref. 25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). We generated a second HEK cell line expressing HAhIP to which GFP was fused at the C-terminal end (HAhIP-GFP-HEK) to follow the sequestration of hIP without the need for fixation of cells and treatment with antibodies. Lysates from transfected cells were resolved by SDS-PAGE and immunoblotted with an anti-GFP antibody. The HAhIP-GFP appeared as a broad complex with a molecular mass of 70–95 kDa (Fig.1 A), representing glycosylated HAhIP (44–60 kDa, see Ref. 25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) plus the 27-kDa green fluorescent protein fused to the C-terminal end. The identity of this species as HAhIP-GFP was confirmed in parallel immunoblots with anti-HA (Fig.1 A). When living cells were observed in culture under a green fluorescent protein lamp, HAhIP-GFP was localized to the plasma membranes (Fig. 1 B). GFP-vector control cells, in contrast, demonstrated the presence of a 27-kDa GFP band, by SDS-PAGE, and a diffuse cellular pattern of GFP expression in phase contrast micrographs. Treatment of HAhIP-GFP-HEK with the prostacyclin analog iloprost, for 10 min, induced a concentration-dependent increase in intracellular cAMP (EC50 = 0.39 ± 0.09 nm, n = 3; Fig. 1 C) and inositol phosphate production (EC50 = 86.6 ± 18.3 nm, n = 4; Fig. 1 C) indicating coupling to the two signaling systems similar to that seen for HAhIP and the non-tagged receptor (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Thus, similar to other studies (27Kallal J. Benovic J.L. Trends Pharmacol. Sci. 2000; 21: 175-180Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar), addition of the GFP at the C-terminal end of HAhIP did not significantly alter the expression or signal transduction properties of the receptor. Treatment with iloprost induced a rapid sequestration of HAhIP-GFP from the cell membrane into the intracellular space. Internalization was evident after 5 min of agonist treatment and continued over a 45-min time course (Fig. 2 A), as observed by confocal microscopy. Sequestered HAhIP-GFP was partially localized to early endosomes, preloaded with rhodamine-conjugated transferrin (Fig. 2 B). These data indicate that early HAhIP sequestration events may occur, at least in part, via a clathrin-coated vesicular endocytotic pathway. Iloprost-induced sequestration of HAhIP was quantified by ELISA. Treatment of HAhIP-HEK with iloprost induced a time- and dose-dependent loss of HA expression at the cell surface indicating internalization of the receptor. The time course for iloprost-induced HAhIP sequestration was similar to that seen in the confocal experiments; HAhIP sequestration was evident within the first 5–10 min of agonist (1 μm) treatment and reached a plateau within 30 min (Fig.3 A). Minimal sequestration was evident following treatment for 60 min with low (<10 nm) concentrations of iloprost (Fig. 3 B). In contrast, substantial (up to 50%) sequestration of HAhIP was evident at higher agonist concentrations (EC50 = 27.6 ± 5.7 nm, n = 7). These concentrations increase inositol phosphate generation and induce PKC-dependent phosphorylation and desensitization of the HAhIP (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 26Smyth E.M. Li W.H. FitzGerald G.A. J. Biol. Chem. 1998; 273: 23258-23266Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Pretreatment of cells for 30 min with GF109203X inhibited iloprost-stimulated total PKC activity by approximately 60% (Fig. 4 A, inset). The residual kinase activity may be due to GF109203X-insensitive PKC isoforms or non-PKC-mediated phosphorylation of the α-pseudosubstrate peptide. We have demonstrated previously that the majority of rapid, iloprost-induced phosphorylation of HAhIP is inhibited by pretreatment of cells with GF109203X but not the PKA inhibitor H89 (25Smyth E.M. Nestor P.V. FitzGerald G.A. J. Biol. Chem. 1996; 271: 33698-33704Abstract Full Text Full Text
Referência(s)