Identification of YHR068w in Saccharomyces cerevisiae Chromosome VIII as a Gene for Deoxyhypusine Synthase
1995; Elsevier BV; Volume: 270; Issue: 31 Linguagem: Inglês
10.1074/jbc.270.31.18408
ISSN1083-351X
AutoresKee Ryeon Kang, Edith C. Wolff, Myung Hee Park, J.E. Folk, Soo Il Chung,
Tópico(s)Epigenetics and DNA Methylation
ResumoDeoxyhypusine synthase catalyzes the formation of deoxyhypusine, the first step in hypusine biosynthesis. Amino acid sequences of five tryptic peptides from rat deoxyhypusine synthase were found to match partially the deduced amino acid sequence of the open reading frame of gene YHR068w of Saccharomyces cerevisiae chromosome VIII (AC:U00061). In order to determine whether the product of this gene corresponds to yeast deoxyhypusine synthase, a 1.17-kilobase pair cDNA with an identical nucleotide sequence to that of the YHR068w coding region was obtained from S. cerevisiae cDNA by polymerase chain reaction and was expressed in Escherichia coli B strain BL21(DE3). The recombinant protein was found mostly in the E. coli cytosol fraction and comprised ~20% of the total soluble protein. The purified form of the expressed protein effectively catalyzed the formation of deoxyhypusine in yeast eIF-5A precursors as well as in human precursor and in those from Chinese hamster ovary cells. The molecular mass of the enzyme was estimated to be 172,000 ± 4,300 Da by equilibrium centrifugation. The mass of its polypeptide subunit was determined to be ~43,000 Da, in close agreement with that calculated for the coding region of the YHRO68w gene. These findings show that this gene is a coding sequence for yeast deoxyhypusine synthase and that the product of this gene exists in a tetrameric form. Deoxyhypusine synthase catalyzes the formation of deoxyhypusine, the first step in hypusine biosynthesis. Amino acid sequences of five tryptic peptides from rat deoxyhypusine synthase were found to match partially the deduced amino acid sequence of the open reading frame of gene YHR068w of Saccharomyces cerevisiae chromosome VIII (AC:U00061). In order to determine whether the product of this gene corresponds to yeast deoxyhypusine synthase, a 1.17-kilobase pair cDNA with an identical nucleotide sequence to that of the YHR068w coding region was obtained from S. cerevisiae cDNA by polymerase chain reaction and was expressed in Escherichia coli B strain BL21(DE3). The recombinant protein was found mostly in the E. coli cytosol fraction and comprised ~20% of the total soluble protein. The purified form of the expressed protein effectively catalyzed the formation of deoxyhypusine in yeast eIF-5A precursors as well as in human precursor and in those from Chinese hamster ovary cells. The molecular mass of the enzyme was estimated to be 172,000 ± 4,300 Da by equilibrium centrifugation. The mass of its polypeptide subunit was determined to be ~43,000 Da, in close agreement with that calculated for the coding region of the YHRO68w gene. These findings show that this gene is a coding sequence for yeast deoxyhypusine synthase and that the product of this gene exists in a tetrameric form. INTRODUCTIONThe biosynthesis of hypusine (Nϵ-(4-amino-2-hydroxybutyl)lysine) occurs in the eIF-5A ( 1The abbreviations used are: eIF-5Aeukaryotic translation initiation factor 5Aec-eIF-5Athe recombinant precursor(s) of eIF-5A, containing lysine in place of hypusine, expressed in E. coli from a cDNA of human eIF-5A gene (ec-eIF-5A) or of the two yeast eIF-5A genes, TIF51A and TIF51B, respectively (yeast ec-eIF-5Aa and yeast ec-eIF-5Ab)PAGEpolyacrylamide gel electrophoresisPCRpolymerase chain reactionIPTGisopropyl-1-thio-β-D-galactopyranosideCHOChinese hamster ovary. )precursor protein through a unique posttranslational modification (reviewed in (1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar)). In the first step, the enzyme deoxyhypusine synthase catalyzes conversion of a single lysine (Lys50 in the human precursor) to deoxyhypusine (Nϵ-(4-aminobutyl)lysine) by transfer of the butylamine moiety of the polyamine spermidine to the ϵ-amino group of this lysine (2Park M.H. Cooper H.L. Folk J.E. J. Biol. Chem. 1982; 257: 7217-7222Abstract Full Text PDF PubMed Google Scholar, 3Murphey R.J. Gerner E.W. J. Biol. Chem. 1987; 262: 15033-15036Abstract Full Text PDF PubMed Google Scholar, 4Park M.H. Wolff E.C. J. Biol. Chem. 1988; 263: 15264-15269Abstract Full Text PDF PubMed Google Scholar, 5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar) by an NAD-dependent reaction (Fig. S1)(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar, 6Chen K.Y. Dou Q.P. FEBS Lett. 1988; 229: 325-328Crossref PubMed Scopus (25) Google Scholar). The second step completes hypusine formation through catalytic hydroxylation of the deoxyhypusine residue(2Park M.H. Cooper H.L. Folk J.E. J. Biol. Chem. 1982; 257: 7217-7222Abstract Full Text PDF PubMed Google Scholar, 7Abbruzzese A. Park M.H. Folk J.E. J. Biol. Chem. 1986; 261: 3085-3089Abstract Full Text PDF PubMed Google Scholar).Hypusine is ubiquitous in eukaryotes and is found in some archaebacteria(1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar, 8Schmann H. Klink F. Syst. Appl. Microbiol. 1989; 11: 103-107Crossref Scopus (18) Google Scholar). It does not occur in eubacteria(8Schmann H. Klink F. Syst. Appl. Microbiol. 1989; 11: 103-107Crossref Scopus (18) Google Scholar). Several lines of evidence support the essential role of hypusine in eIF-5A for eukaryotic cell proliferation(9Park M.H. Wolff E.C. Folk J.E. Trends Biochem. Sci. 1993; 18: 475-479Abstract Full Text PDF PubMed Scopus (145) Google Scholar). These include: (i) the lack of growth of yeast in the absence of expression of the two eIF-5A genes (10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar, 11Magdolen V. Klier H. Whl T. Klink F. Hirt H. Hauber J. Lottspeich F. Mol. & Gen. Genet. 1994; 224: 646-652Crossref Scopus (38) Google Scholar); (ii) the inability of the mutated eIF-5A gene (Lys50→ Arg50) to substitute for the wild type gene in supporting growth of yeast(10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar); and (iii) the arrest of proliferation of mammalian cells by inhibitors of deoxyhypusine synthase(12Park M.H. Wolff E.C. Lee Y.B. Folk J.E. J. Biol. Chem. 1994; 269: 27827-27832Abstract Full Text PDF PubMed Google Scholar). In view of the importance of hypusine in cell proliferation and the very narrow substrate specificity of deoxyhypusine synthesis(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar, 13Joe Y.A. Park M.H. J. Biol. Chem. 1994; 269: 25916-25921Abstract Full Text PDF PubMed Google Scholar, 14Jakus J. Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1993; 268: 13151-13159Abstract Full Text PDF PubMed Google Scholar), this enzyme presents a promising target for anti-proliferative therapy.We have recently purified deoxyhypusine synthase from rat testis(15Wolff E.C. Lee Y.B. Chung S.I. Folk J.E. Park M.H. J. Biol. Chem. 1995; 270: 8660-8666Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). The partial amino acid sequences determined for five tryptic peptides from the rat testis enzyme prompted us to search for similar sequences in the molecular biology data banks. Although we found no protein with similar sequences, the deduced amino acid sequence of one open reading frame (387 amino acids) of the gene YHR068w in Saccharomyces cerevisiae chromosome VIII (AC:U00061) (16Johnston M. Andrews S. Brinkman R. Cooper J. Ding H. Dover J. Du Z. Favello A. Fulton L. Gattung S. Geisel C. Kirsten J. Kucaba T. Hillier L. Jier M. Johnston L. Langston Y. Latreille P. Louis E.J. Macri C. St. Peter H. Trevaskis E. Vaughan K. Vignati D. Wilcox L. Wohidman P. Waterston R. Wilson R. Vaudin M. Science. 1995; 265: 2077-2079Crossref Scopus (253) Google Scholar) yielded partial matches with the rat enzyme sequences. In an effort to determine if the product of this gene corresponds to a yeast deoxyhypusine synthase, we obtained from S. cerevisiae cDNA by PCR a 1.17-kilobase pair cDNA with the identical nucleotide sequences as that of the entire YHR068w coding region. The expression, purification, and characterization of the yeast recombinant enzyme are the subject of this paper.EXPERIMENTAL PROCEDURESMaterials[1,8-3H]Spermidine • HCl (15 Ci/mmol) was purchased from DuPont NEN. Oligonucleotide primers were synthesized by the Midland Certified Reagent Company. pET-11a expression vector and the host Escherichia coli B strain BL21(DE3) were from Novagen; Vent polymerase and T4 DNA ligase from New England Biolabs; restriction enzymes from Life Technologies, Inc.; precast polyacrylamide gels and wide range protein standards (Mark 12) from Novex; ec-eIF-5A, purified from E. coli lysates after overexpression of the human eIF-5A cDNA as described(13Joe Y.A. Park M.H. J. Biol. Chem. 1994; 269: 25916-25921Abstract Full Text PDF PubMed Google Scholar), was kindly provided by Y. A. Joe of our laboratory.MethodsAssay of Deoxyhypusine SynthaseThe enzyme activity was measured as described previously(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar, 14Jakus J. Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1993; 268: 13151-13159Abstract Full Text PDF PubMed Google Scholar). A typical reaction mixture contained, in total volumes of 20 μl, 0.2 M glycine NaOH buffer, pH 9.5, containing 1 mM dithiothreitol, 25 mg of bovine serum albumin, 0.5 mM NAD, 7 μM [1,8-3H]spermidine, 10 μM ec-eIF-5A, and enzyme. Incubations were at 37°C for 60 min. The radioactivity of [3H]deoxyhypusine was measured after its ion exchange chromatographic separation from the hydrolyzed protein fraction essentially as described earlier(17Park M.H. Cooper H.L. Folk J.E. Methods Enzymol. 1983; 94: 458-462Crossref Scopus (3) Google Scholar). One unit of activity is defined as the amount of enzyme catalyzing the formation of 1 pmol of deoxyhypusine h-1.Construction of a Plasmid Encoding Full-length Yeast Deoxyhypusine Synthase and Expression in E. coliOn the basis of the nucleotide sequence in the open reading frame of the gene YHR068w in S. cerevisiae chromosome VIII, primers for PCR representing the 5'-end (43-mer, CTTCCAGTATGCTCATATGTCCGATATCAACGAAAAACTCCCA) and the 3'-end region (45-mer, CTTCCAGTATGGATCCTCAATTCTTAACTTTTTTGATTGGTTTAC) were synthesized with a built-in NdeI site (5'-end primer) and a BamHI site (3'-end primer) (underlined) to facilitate cloning into the expression vector pET-11a. PCR was performed in a thermal cycler (Perkin-Elmer) using yeast Quick Clone cDNA (Clontech) as a template. Conditions for PCR were: denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension reaction at 72°C for 1.5 min for 35 cycles, and a final extension reaction at 72°C for 10 min. Agarose gel electrophoretic analysis of the PCR product showed only one band of ~1.2 kilobase pair. The PCR product was cleaved with NdeI and BamHI, ligated to the insertion site of the vector pET-11a, and introduced into the BL21(DE3) strain of E. coli. The cDNA clones containing an insert of the correct size were sequenced by the dideoxy-mediated chain termination procedure with Sequenase (version 2.0, U. S. Biochemical Corp.) using double-stranded DNA as a template. The recombinant strains obtained by transformation were grown in Luria-Bertani medium, supplemented with 50 μg/ml ampicillin. When the cell density in the culture reached an OD of 0.6 at 600 nm, IPTG was added to a final concentration of 1 mM. The cells were harvested by centrifugation (5,000 × g for 5 min) after 4 h of induction.Purification of S. cerevisiae Deoxyhypusine Synthase Expressed in BL21(DE3) StrainThe induced E. coli cells (14 g) were suspended in 150 ml of Buffer A (20 mM Tris acetate, pH 8.0, 1 mM EDTA, and 1 mM phenylmethylsulfonyl fluoride) and thrice sonicated for a 1-min interval at a 70-watts setting, and the supernatant was collected after centrifugation for 30 min at 15,000 × g. The supernatant was applied to a fast flow Q-Sepharose (Pharmacia Biotech Inc.) column (5 × 6 cm) previously equilibrated with Buffer A, the column was washed with Buffer A until the effluent showed A280 < 0.1, and a 1-liter linear gradient of 0-0.5 M NaCl in Buffer A was applied. The fractions containing enzyme activity, eluting between 0.23 and 0.27 M NaCl, were pooled, concentrated to ~4.0 ml by ultrafiltration (Amicon), applied to a Bio-Gel A 0.5-m (200-400 mesh, Bio-Rad) column (2.5 × 96 cm) previously equilibrated with Buffer B (0.05 M citrate buffer, pH 6.0, 0.07 M NaCl), and eluted with Buffer B. The fractions containing enzyme activity were pooled, concentrated by ultrafiltration, dialyzed against Buffer A for 1 h, and applied to a Mono Q (5/5) column. The adsorbed enzyme was eluted with a 90-ml linear gradient of 0.1-0.5 M NaCl in Buffer A. PAGE analysis of the purified recombinant enzyme showed a single band in the presence or absence of SDS.Preparation of the Yeast Recombinant eIF-5A Precursors, ec-eIF-5Aa and ec-eIF-5AbS. cerevisiae contains two eIF-5A genes, TIF51A and TIF51B(10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar). The products of these two genes, ec-eIF-5Aa and ec-eIF-5Ab, respectively, were produced by a method similar to that described above for preparation of the recombinant deoxyhypusine synthase. The cDNA for each of the yeast eIF-5A precursors was obtained by PCR amplification of Quick Clone S. cerevisiae cDNA (Clontech) using a set of two primers containing the underlined NdeI site and BamHI site as follows: 5'-end primer (CTTCCAGTATGCTCATATGTCTGACGAAGAACATACCTTTGAAACTG) and 3'-end primer (CTTCCAGTATGGATCCTTAATCGGTTCTAGCAGCTTCCTTGAAG) for the eIF-5Aa cDNA and 5'-end primer (CTTCCAGTATGCTCATATGTCTGACGAAGAACACACCTTTGAAAATG) and the 3'-end primer (CTTCCAGTATGGATCCCTAATCAGATCTTGGAGCTTCCTTGAAG) for the eIF-5Ab cDNA, respectively. The PCR product after cleavage with NdeI and BamHI was inserted into the vector pET-11a and used for transformation of BL21(DE3) cells. Expression of the eIF-5A precursor proteins in the selected transformants was induced with IPTG (1 mM) for 4 h as described above. The lysate supernatant of IPTG-induced cells (~14 g of packed cells from a 10-liter culture) was applied to a fast flow S-Sepharose (Pharmacia) column (5 × 4 cm) equilibrated with Buffer C (50 mM Tris acetate, pH 6.0, 1 mM EDTA, 5 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride). After a wash of the column with 200 ml of Buffer C containing 0.25 M KCl, the eIF-5A precursor proteins were eluted with Buffer C containing 1 M KCl. The fractions containing the eIF-5A precursors were pooled. After ammonium sulfate fractionation (40-75% saturation) of this pool and subsequent dialysis, ~20 mg of each of the eIF-5A precursor proteins was obtained in >90% purity. In the transformant containing yeast eIF-5Aa cDNA, two forms of the eIF-5A precursor protein, exhibiting apparent molecular masses of 21 and 19 kDa, respectively, were detected on SDS-PAGE. The 19-kDa form, presumably generated by proteolytic cleavage of a 10-amino-acid fragment of the intact protein(18Wohl T. Klier H. Ammer H. Lottspeich F. Magdolen V. Mol. & Gen. Genet. 1993; 241: 305-311Crossref PubMed Scopus (61) Google Scholar), copurified with the intact form upon ion exchange chromatography on an S-Sepharose or Mono-Q column (data not shown). From the recombinant strain transformed with yeast eIF-5Ab cDNA, one form of eIF-5A precursor with an apparent molecular mass of ~20 kDa was isolated.Other MethodsMatrix-assisted laser desorption mass spectrometry was carried out using a Kratos Kompact MALDI-3 spectrometer (Kratos, Ltd., Manchester, UK). Sedimentation equilibrium analysis was performed at 20°C with a 5-mm column height of sample (0.34 mg/ml yeast enzyme) using a Beckman XL-A analytical ultracentrifuge.RESULTSThe deduced amino acid sequence of the open reading frame of the yeast YHR068w gene (16Johnston M. Andrews S. Brinkman R. Cooper J. Ding H. Dover J. Du Z. Favello A. Fulton L. Gattung S. Geisel C. Kirsten J. Kucaba T. Hillier L. Jier M. Johnston L. Langston Y. Latreille P. Louis E.J. Macri C. St. Peter H. Trevaskis E. Vaughan K. Vignati D. Wilcox L. Wohidman P. Waterston R. Wilson R. Vaudin M. Science. 1995; 265: 2077-2079Crossref Scopus (253) Google Scholar) along with the fit of the amino acid sequences of five tryptic peptides (P1-P5) from rat deoxyhypusine synthase (15Wolff E.C. Lee Y.B. Chung S.I. Folk J.E. Park M.H. J. Biol. Chem. 1995; 270: 8660-8666Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar) is shown in Fig. 1. There is a remarkable identity between P5 and residues 319-332 of the yeast YHR068w gene product. By making the reasonable assumption that P2 and P3 were originally joined by lysine in the rat enzyme, a good match can be made for this extended peptide. The other two peptides do not show as good a fit. Using primers based on the nucleotide sequence of the yeast gene, PCR product was observed as a single band after amplification of Quick Clone S. cerevisiae cDNA (Clontech). Two independent clones were found to have nucleotide sequences (1,161 bases) identical to that deposited in the GenBank for this gene, suggesting that we had obtained a full-length YHR068w cDNA, encoding a polypeptide of 387 amino acids, with a calculated molecular mass of 42,892 Da. The cDNA clone, tentatively identified as the cDNA for a yeast deoxyhypusine synthase, was expressed in E. coli using pET-11a plasmid. As shown in Fig. 2A, deoxyhypusine synthase activity was detected in the cell lysates and increased in a time-dependent manner up to 4 h after induction by IPTG. SDS-PAGE of the cell lysates showed that a 43-kDa polypeptide was overexpressed (Fig. 2B), in correspondence with the increase in enzyme activity. At 4 h, this polypeptide amounted to ~20% of the total soluble protein of the lysate.Figure 1:Deduced amino acid sequence of the open reading frame of YHR068w (AC:U00061) (top line) and alignment of five tryptic peptides from rat testis deoxyhypusine synthase (second line, underlined). The peptides are labeled P1-P5. The sequence of P1 is fitted with a gap of 10 residues.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 2:Induction of the yeast recombinant deoxyhypusine synthase in E. coli by IPTG. Samples of cells were removed after induction with IPTG for 1, 2, and 4 h. The cells in each sample were lysed, and a portion containing ~0.1 μg of protein was analyzed for deoxyhypusine synthase activity (A); another portion containing ~10 μg of protein was used for SDS-PAGE on 10% gel to follow the expression of recombinant 43-kDa polypeptide (B). Protein bands were visualized by Coomassie Blue R-250 staining. The 43-kDa protein is denoted by the arrowhead on the right. The positions of molecular mass standards are shown on the left.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Purification of Yeast Recombinant Deoxyhypusine SynthaseA four-step purification procedure is summarized in Table 1. A fast flow Q-Sepharose anion exchange chromatographic step of the cell lysate supernatant fraction allowed ~3-fold purification with 90% recovery of total enzyme activity. Upon size exclusion chromatography (Step 3), the enzyme (~90% purity) eluted in a single symmetrical peak (Fig. 3A). Analysis of the peak fractions by PAGE under non-denaturing conditions showed correspondence between the staining intensity of the major band and enzyme activity (Fig. 3B). Upon SDS-PAGE of the same fractions after their treatment with SDS and dithiothreitol, a predominant band at 43 kDa corresponded with the enzyme activity (Fig. 3C). Minor impurities from the gel filtration step were removed in the final step of purification, ion exchange chromatography on a Mono Q (5/5) column (Table 1, Step 4), as evidenced by SDS-PAGE (Fig. 3D). The overall protocol yielded pure yeast recombinant deoxyhypusine synthase with an average recovery of ~50% and a specific activity of 0.7-1.1 × 106 units/mg of protein (Table 1).Tabled 1 Open table in a new tab Figure 3:Size exclusion chromatography and PAGE of the yeast recombinant deoxyhypusine synthase. A, exclusion chromatography on a Bio-Gel A 0.5-m column was carried out as described under "Experimental Procedures." A sample volume of 4.0 ml containing 50 mg of protein from Step 2 was applied to the column. TGase, transglutaminase; Alb, albumin. B, PAGE (non-denaturing) on a 10% precast gel; 4 μl from size exclusion chromatography fractions 53, 55, 57, 59, and 61 (panel A) in lanes 1-5, respectively; C, SDS-PAGE on a 10% precast gel; 4 μl from the same fractions as in B; D, SDS-PAGE on a 10% precast gel of purified deoxyhypusine synthase; 2 μl from peak fractions 70-74 (lanes 1-5, respectively) after Mono Q ion exchange chromatography (Table 1, Step 4). Positions of molecular mass standards are shown by arrows.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Enzymatic PropertiesThe YHR068w gene product expressed in E. coli catalyzes the formation of deoxyhypusine in the human eIF-5A precursor protein in the presence of spermidine and NAD. Its specific enzymatic activity is comparable with that of the deoxyhypusine synthase purified from rat testis (0.8 × 106 units/mg of protein)(15Wolff E.C. Lee Y.B. Chung S.I. Folk J.E. Park M.H. J. Biol. Chem. 1995; 270: 8660-8666Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Thus this gene product is defined as a deoxyhypusine synthase. Like the rat enzyme, the yeast recombinant enzyme displays a strict specificity for NAD. NADP, FAD, and FMN cannot substitute for NAD (data not shown). Its requirement for the precursor protein is also specific. No [3H]deoxyhypusine was formed in any E. coli cytosol protein or in albumin after incubation with enzyme, [3H]spermidine, and NAD in the absence of the eIF-5A precursor protein. However, the yeast enzyme recognized the eIF-5A precursor proteins from yeast and other species (Fig. 4). The human eIF-5A precursor protein and the two eIF-5A precursors from CHO cells, PI and PII(19Park M.H. J. Biol. Chem. 1989; 264: 18531-18535Abstract Full Text PDF PubMed Google Scholar), were modified by the yeast enzyme as were the yeast precursor proteins (Fig. 4A). In the reaction mixture containing [3H]spermidine, no significant difference was observed in the degree of labeling of the two bands of yeast ec-eIF-5Aa proteins and the yeast ec-eIF-5Ab protein (Fig. 4A). Interestingly, when the same panel of protein substrates was tested with the rat testis enzyme (Fig. 4B), labeling also occurred in all cases but was much weaker with the precursor proteins from CHO cells than with the human or the yeast precursors. Table 2 lists the kinetic constants of the yeast enzyme for the three substrates, spermidine, NAD, and eIF-5A precursor, obtained using three different eIF-5A precursors. The kinetic parameters for spermidine and NAD do not appear to vary significantly whether the protein substrate used was human or either of the yeast proteins. When the variable substrate was eIF-5A precursor, the Km and V values for the two yeast proteins were found to be similar, in accordance with the results of Fig. 4A. Upon comparison of these kinetic parameters with those of the rat enzyme(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar), the most striking difference observed is the ~20-fold higher value of Km for NAD with the yeast enzyme. In the absence of the protein substrates, the yeast recombinant enzyme catalyzes the NAD-dependent hydrolysis of spermidine to 1,3-diaminopropane and Δ1-pyrroline, as has been shown to occur with the rat testis enzyme(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar).Figure 4:Modification of eIF-5A precursor proteins from several species by deoxyhypusine synthases from yeast and rat. The deoxyhypusine synthase reaction was carried out as described under "Experimental Procedures" except that either the yeast enzyme (A, ~0.2 μg) or the rat enzyme (B, ~0.2 μg) and the substrate proteins (~2 μg) from three species, yeast, human, and CHO cells, were used in the assay. One portion (15 μl) of the reaction mixture (total of 20 μl) was used for SDS-PAGE, and the other portion (5 μl) was used for determination of [3H]deoxyhypusine formed. The amounts of radioactivity of [3H]deoxyhypusine in the samples were: panel A, lane 2, 44,922 cpm; lane 3, 52,440 cpm; lane 4, 49,248 cpm; lane 5, 22,068 cpm; lane 6, 45,966 cpm; panel B, lane 2, 71,100 cpm; lane 3, 86,745 cpm; lane 4, 92,175 cpm; lane 5, 9,198 cpm; lane 6, 8,718 cpm. Abbreviations used are: STD, standard; h5A, human eIF-5A precursor, ec-eIF-5A; y5Aa, yeast ec-eIF-5Aa; y5Ab, yeast ec-eIF-5Ab; CHOPI and CHOPII, eIF-5A precursors isolated from DL-α-difluoromethylornithine (DFMO)-treated CHO cells (19Park M.H. J. Biol. Chem. 1989; 264: 18531-18535Abstract Full Text PDF PubMed Google Scholar).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Tabled 1 Open table in a new tab Structural PropertiesValues for the molecular mass of the recombinant polypeptide determined by SDS-PAGE (43 kDa) and by matrix-assisted laser-desorption mass spectrometry (42,998 ± 100 Da) are in close agreement with a value of 42,891.2 Da calculated for the coding region of the YHR068w cDNA. The enzyme migrated as a single band upon electrophoresis under non-denaturing conditions (Fig. 3B) and eluted from an exclusion chromatography column as a single symmetrical peak corresponding to a mass size of 165 kDa (Fig. 3A). Analysis of equilibrium sedimentation data, using a calculated partial specific volume of 0.718 cm2/g, gave a weight average molecular mass of 172,000 ± 4,300 Da. A value of 3.3 × 1016M-3 was obtained for Ka for formation of tetramer and a change of standard free energy ΔG0 = −22.2 ± 0.1 kcal mol-1. The association appears to be strongly cooperative, since no molecular species other than monomer and tetramer could be observed. The mean dissociation constant per monomer may be calculated to be 3.12 × 10-6M. These results indicate that the tetrameric form is the dominant species under physiologic conditions.DISCUSSIONThe identification of YHR068w in S. cerevisiae chromosome VIII as the gene for deoxyhypusine synthase provides the first full amino acid sequence of deoxyhypusine synthase from any source. The selection of this open reading frame as a candidate for a yeast deoxyhypusine synthase gene was made on partial matching with the amino acid sequences of five tryptic peptides from the purified rat testis enzyme(15Wolff E.C. Lee Y.B. Chung S.I. Folk J.E. Park M.H. J. Biol. Chem. 1995; 270: 8660-8666Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). While this manuscript was in preparation, the purification of a deoxyhypusine synthase from Neurospora crassa was reported(20Tao Y. Chen K.Y. J. Biol. Chem. 1995; 270: 383-386Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). The amino acid sequences of the four tryptic peptides obtained from the N. crassa enzyme also show a high degree of identity with the yeast enzyme.Deoxyhypusine synthase exhibits a remarkable substrate specificity in its recognition of a single lysine residue of one cellular protein, the eIF-5A precursor. eIF-5A is highly conserved in a wide range of eukaryotic species(1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar), and the amino acid sequence identity is especially high in the region surrounding the lysine residue that undergoes modification to hypusine(1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar). Furthermore, a large portion of the substrate protein is required for recognition and modification by deoxyhypusine synthase(13Joe Y.A. Park M.H. J. Biol. Chem. 1994; 269: 25916-25921Abstract Full Text PDF PubMed Google Scholar). Nevertheless, the enzymes from rat testis or yeast appear to recognize eIF-5A precursor proteins from other species, even distantly related ones. The experiments of Schwelberger et al. (21Schwelberger H.G. Kang H.A. Hershey J.W.B. J. Biol. Chem. 1993; 268: 14018-14025Abstract Full Text PDF PubMed Google Scholar) and of Magdolen et al. (11Magdolen V. Klier H. Whl T. Klink F. Hirt H. Hauber J. Lottspeich F. Mol. & Gen. Genet. 1994; 224: 646-652Crossref Scopus (38) Google Scholar) provide evidence that the eIF-5A precursor proteins from human, slime mold, and alfalfa can be modified in yeast by the endogenous deoxyhypusine synthase and that these heterologous proteins can functionally substitute for the yeast eIF-5A in support of growth of this organism. The present results indeed show effective modification of the yeast substrate proteins, the human eIF-5A precursor, and those from CHO cells in vitro by the yeast enzyme. The high conservation of the amino acid sequence of the eIF-5A precursors from the diverse species may be the basis of the broad species specificity.Yeast contains two forms of eIF-5A, designated eIF-5Aa and eIF-5Ab here, which are derived from two distinct genes TIF51A and TIF51B(10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar). Although the two genes are reciprocally regulated by oxygen(22Lowry C.V. Weiss J.L. Walthall D.A. Zitomer R.S. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 151-155Crossref PubMed Scopus (43) Google Scholar), the two proteins share 90% amino acid sequence identity (10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar) and appear to be functionally indistinguishable in vitro(10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar) and in vivo(11Magdolen V. Klier H. Whl T. Klink F. Hirt H. Hauber J. Lottspeich F. Mol. & Gen. Genet. 1994; 224: 646-652Crossref Scopus (38) Google Scholar, 21Schwelberger H.G. Kang H.A. Hershey J.W.B. J. Biol. Chem. 1993; 268: 14018-14025Abstract Full Text PDF PubMed Google Scholar). It is not known whether yeast contains more than one form of deoxyhypusine synthase. Our results, however, show that the recombinant enzyme can modify both of the precursors with nearly equal efficiency. Recently we cloned a full-length cDNA for human deoxyhypusine synthase. ( 2Y. A. Joe, E. C. Wolff, and M. H. Park, submitted for publication. )The deduced amino acid sequences of the human and the yeast enzymes show 58% identity. Thus, conservation of deoxyhypusine synthase, as well as of its substrate protein, may contribute to the maintenance of the specificity of hypusine synthesis and of the functionality of eIF-5A.Despite obvious differences in primary structure between the yeast recombinant and the rat testis enzymes, as well as the failure of a polyclonal antibody to rat enzyme to recognize the yeast enzyme (data not shown), the two enzymes exhibit certain similarities in physical and enzymatic properties. Each appears to exist as a tetramer (molecular mass, 160-170 kDa) of 43-kDa subunits. The sedimentation equilibrium data obtained for the yeast recombinant enzyme is evidence of the tetrameric structure and is consistent with a high affinity of 43-kDa subunits for one another and with the stability of the tetrameric complex. Each enzyme requires NAD for the catalytic reaction; each displays a strict specificity for this nucleotide. They also catalyze a NAD-dependent cleavage of spermidine in the absence of protein substrate. The availability of the yeast cDNA clone and the yeast recombinant enzyme should permit further studies on the structure of this important en-zyme and on the mechanism of the complex reaction that it catalyzes. INTRODUCTIONThe biosynthesis of hypusine (Nϵ-(4-amino-2-hydroxybutyl)lysine) occurs in the eIF-5A ( 1The abbreviations used are: eIF-5Aeukaryotic translation initiation factor 5Aec-eIF-5Athe recombinant precursor(s) of eIF-5A, containing lysine in place of hypusine, expressed in E. coli from a cDNA of human eIF-5A gene (ec-eIF-5A) or of the two yeast eIF-5A genes, TIF51A and TIF51B, respectively (yeast ec-eIF-5Aa and yeast ec-eIF-5Ab)PAGEpolyacrylamide gel electrophoresisPCRpolymerase chain reactionIPTGisopropyl-1-thio-β-D-galactopyranosideCHOChinese hamster ovary. )precursor protein through a unique posttranslational modification (reviewed in (1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar)). In the first step, the enzyme deoxyhypusine synthase catalyzes conversion of a single lysine (Lys50 in the human precursor) to deoxyhypusine (Nϵ-(4-aminobutyl)lysine) by transfer of the butylamine moiety of the polyamine spermidine to the ϵ-amino group of this lysine (2Park M.H. Cooper H.L. Folk J.E. J. Biol. Chem. 1982; 257: 7217-7222Abstract Full Text PDF PubMed Google Scholar, 3Murphey R.J. Gerner E.W. J. Biol. Chem. 1987; 262: 15033-15036Abstract Full Text PDF PubMed Google Scholar, 4Park M.H. Wolff E.C. J. Biol. Chem. 1988; 263: 15264-15269Abstract Full Text PDF PubMed Google Scholar, 5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar) by an NAD-dependent reaction (Fig. S1)(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar, 6Chen K.Y. Dou Q.P. FEBS Lett. 1988; 229: 325-328Crossref PubMed Scopus (25) Google Scholar). The second step completes hypusine formation through catalytic hydroxylation of the deoxyhypusine residue(2Park M.H. Cooper H.L. Folk J.E. J. Biol. Chem. 1982; 257: 7217-7222Abstract Full Text PDF PubMed Google Scholar, 7Abbruzzese A. Park M.H. Folk J.E. J. Biol. Chem. 1986; 261: 3085-3089Abstract Full Text PDF PubMed Google Scholar).Hypusine is ubiquitous in eukaryotes and is found in some archaebacteria(1Park M.H. Wolff E.C. Folk J.E. BioFactors. 1993; 4: 95-104PubMed Google Scholar, 8Schmann H. Klink F. Syst. Appl. Microbiol. 1989; 11: 103-107Crossref Scopus (18) Google Scholar). It does not occur in eubacteria(8Schmann H. Klink F. Syst. Appl. Microbiol. 1989; 11: 103-107Crossref Scopus (18) Google Scholar). Several lines of evidence support the essential role of hypusine in eIF-5A for eukaryotic cell proliferation(9Park M.H. Wolff E.C. Folk J.E. Trends Biochem. Sci. 1993; 18: 475-479Abstract Full Text PDF PubMed Scopus (145) Google Scholar). These include: (i) the lack of growth of yeast in the absence of expression of the two eIF-5A genes (10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar, 11Magdolen V. Klier H. Whl T. Klink F. Hirt H. Hauber J. Lottspeich F. Mol. & Gen. Genet. 1994; 224: 646-652Crossref Scopus (38) Google Scholar); (ii) the inability of the mutated eIF-5A gene (Lys50→ Arg50) to substitute for the wild type gene in supporting growth of yeast(10Schnier J. Schwelberger H. Smit-McBride Z. Kang H.A. Hershey J.W.B. Mol. Cell. Biol. 1991; 11: 3105-3114Crossref PubMed Scopus (284) Google Scholar); and (iii) the arrest of proliferation of mammalian cells by inhibitors of deoxyhypusine synthase(12Park M.H. Wolff E.C. Lee Y.B. Folk J.E. J. Biol. Chem. 1994; 269: 27827-27832Abstract Full Text PDF PubMed Google Scholar). In view of the importance of hypusine in cell proliferation and the very narrow substrate specificity of deoxyhypusine synthesis(5Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1990; 265: 4793-4799Abstract Full Text PDF PubMed Google Scholar, 13Joe Y.A. Park M.H. J. Biol. Chem. 1994; 269: 25916-25921Abstract Full Text PDF PubMed Google Scholar, 14Jakus J. Wolff E.C. Park M.H. Folk J.E. J. Biol. Chem. 1993; 268: 13151-13159Abstract Full Text PDF PubMed Google Scholar), this enzyme presents a promising target for anti-proliferative therapy.We have recently purified deoxyhypusine synthase from rat testis(15Wolff E.C. Lee Y.B. Chung S.I. Folk J.E. Park M.H. J. Biol. Chem. 1995; 270: 8660-8666Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). The partial amino acid sequences determined for five tryptic peptides from the rat testis enzyme prompted us to search for similar sequences in the molecular biology data banks. Although we found no protein with similar sequences, the deduced amino acid sequence of one open reading frame (387 amino acids) of the gene YHR068w in Saccharomyces cerevisiae chromosome VIII (AC:U00061) (16Johnston M. Andrews S. Brinkman R. Cooper J. Ding H. Dover J. Du Z. Favello A. Fulton L. Gattung S. Geisel C. Kirsten J. Kucaba T. Hillier L. Jier M. Johnston L. Langston Y. Latreille P. Louis E.J. Macri C. St. Peter H. Trevaskis E. Vaughan K. Vignati D. Wilcox L. Wohidman P. Waterston R. Wilson R. Vaudin M. Science. 1995; 265: 2077-2079Crossref Scopus (253) Google Scholar) yielded partial matches with the rat enzyme sequences. In an effort to determine if the product of this gene corresponds to a yeast deoxyhypusine synthase, we obtained from S. cerevisiae cDNA by PCR a 1.17-kilobase pair cDNA with the identical nucleotide sequences as that of the entire YHR068w coding region. The expression, purification, and characterization of the yeast recombinant enzyme are the subject of this paper.
Referência(s)