Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Lens Epithelium-derived Growth Factor/p75 Interacts with the Transposase-derived DDE Domain of PogZ

2009; Elsevier BV; Volume: 284; Issue: 17 Linguagem: Inglês

10.1074/jbc.m807781200

ISSN

1083-351X

Autores

Koen Bartholomeeusen, Frauke Christ, Jelle Hendrix, Jean‐Christophe Rain, Stéphane Emiliani, Richard Bénarous, Zeger Debyser, Rik Gijsbers, Jan De Rijck,

Tópico(s)

Cytomegalovirus and herpesvirus research

Resumo

Lens epithelium-derived growth factor/p75 (LEDGF/p75) is a prominent cellular interaction partner of human immunodeficiency virus-1 (HIV-1) integrase, tethering the preintegration complex to the host chromosome. In light of the development of LEDGF/p75-integrase interaction inhibitors, it is essential to understand the cell biology of LEDGF/p75. We identified pogZ as new cellular interaction partner of LEDGF/p75. Analogous to lentiviral integrase, pogZ, a domesticated transposase, carries a DDE domain, the major determinant for LEDGF/p75 interaction. Using different in vitro and in vivo approaches, we corroborated the interaction between the C terminus of LEDGF/p75 and the DDE domain of pogZ, revealing an overlap in the binding of pogZ and HIV-1 integrase. Competition experiments showed that integrase is efficient in displacing pogZ from LEDGF/p75. Moreover, pogZ does not seem to play a role as a restriction factor of HIV. The finding that LEDGF/p75 is capable of interacting with a DDE domain protein that is not a lentiviral integrase points to a profound role of LEDGF/p75 in DDE domain protein function. Lens epithelium-derived growth factor/p75 (LEDGF/p75) is a prominent cellular interaction partner of human immunodeficiency virus-1 (HIV-1) integrase, tethering the preintegration complex to the host chromosome. In light of the development of LEDGF/p75-integrase interaction inhibitors, it is essential to understand the cell biology of LEDGF/p75. We identified pogZ as new cellular interaction partner of LEDGF/p75. Analogous to lentiviral integrase, pogZ, a domesticated transposase, carries a DDE domain, the major determinant for LEDGF/p75 interaction. Using different in vitro and in vivo approaches, we corroborated the interaction between the C terminus of LEDGF/p75 and the DDE domain of pogZ, revealing an overlap in the binding of pogZ and HIV-1 integrase. Competition experiments showed that integrase is efficient in displacing pogZ from LEDGF/p75. Moreover, pogZ does not seem to play a role as a restriction factor of HIV. The finding that LEDGF/p75 is capable of interacting with a DDE domain protein that is not a lentiviral integrase points to a profound role of LEDGF/p75 in DDE domain protein function. In 2003 we identified LEDGF/p75 5The abbreviations used are: LEDGF/p75, lens epithelium-derived growth factor/p75; IN, integrase; HIV-1, human immunodeficiency virus-1; IBD, IN binding domain; CCD, catalytic core domains; MLL, mixed-lineage leukemia; TIGD, Tigger-derived; IRES, internal ribosome entry site; Y2Hs, yeast two-hybrid; SID, specific interaction domain; HTH, helix-turn-helix; JRK, Jerky homologue; JRKL, JRK-like; NLS, nuclear localization signal; aa, amino acids; MBP, maltose-binding protein; eGFP, enhanced green fluorescent protein; mRFP, monomeric red fluorescent protein; PBS, phosphate-buffered saline; Pipes, 1,4-piperazinediethanesulfonic acid; DAPI, 4′,6-diamidino-2-phenylindole; siRNA, small interfering RNA. as the major cellular interaction partner of HIV-1 integrase (IN) (1.Cherepanov P. Maertens G. Proost P. Devreese B. Van Beeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar). In vitro studies demonstrated that the interaction of LEDGF/p75 is restricted to lentiviral integrases (2.Busschots K. Vercammen J. Emiliani S. Benarous R. Engelborghs Y. Christ F. Debyser Z. J. Biol. Chem. 2005; 280: 17841-17847Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 3.Llano M. Vanegas M. Fregoso O. Saenz D. Chung S. Peretz M. Poeschla E.M. J. Virol. 2004; 78: 9524-9537Crossref PubMed Scopus (260) Google Scholar, 4.Cherepanov P. Nucleic Acids Res. 2007; 35: 113-124Crossref PubMed Scopus (146) Google Scholar). In recent years the important role of LEDGF/p75 in HIV replication has been demonstrated. Knock-down (5.Llano M. Vanegas M. Hutchins N. Thompson D. Delgado S. Poeschla E.M. J. Mol. Biol. 2006; 360: 760-773Crossref PubMed Scopus (160) Google Scholar, 6.De Rijck J. Vandekerckhove L. Gijsbers R. Hombrouck A. Hendrix J. Vercammen J. Engelborghs Y. Christ F. Debyser Z. J. Virol. 2006; 80: 11498-11509Crossref PubMed Scopus (151) Google Scholar), knock-out (7.Shun M.C. Raghavendra N.K. Vandegraaff N. Daigle J.E. Hughes S. Kellam P. Cherepanov P. Engelman A. Genes Dev. 2007; 21: 1767-1778Crossref PubMed Scopus (384) Google Scholar), and transdominant inhibition studies (6.De Rijck J. Vandekerckhove L. Gijsbers R. Hombrouck A. Hendrix J. Vercammen J. Engelborghs Y. Christ F. Debyser Z. J. Virol. 2006; 80: 11498-11509Crossref PubMed Scopus (151) Google Scholar, 8.Llano M. Saenz D.T. Meehan A. Wongthida P. Peretz M. Walker W.H. Teo W. Poeschla E.M. Science. 2006; 314: 461-464Crossref PubMed Scopus (431) Google Scholar, 9.Hombrouck A. De Rijck J. Hendrix J. Vandekerckhove L. Voet A. De Maeyer M. Witvrouw M. Engelborghs Y. Christ F. Gijsbers R. Debyser Z. PLoS Pathog. 2007; 3: 418-430Crossref Scopus (105) Google Scholar) all revealed a pivotal role of LEDGF/p75 in HIV-1 integration and replication. These studies also provided a proof-of-principle to block the interaction between LEDGF/p75 and HIV-1 IN as a potential antiviral strategy. By sequencing lentiviral vector integration sites in mouse LEDGF/p75 knock-out cell lines (7.Shun M.C. Raghavendra N.K. Vandegraaff N. Daigle J.E. Hughes S. Kellam P. Cherepanov P. Engelman A. Genes Dev. 2007; 21: 1767-1778Crossref PubMed Scopus (384) Google Scholar) and human LEDGF/p75 knock-down cell lines (10.Ciuffi A. Llano M. Poeschla E. Hoffmann C. Leipzig J. Shinn P. Ecker J.R. Bushman F. Nat. Med. 2005; 11: 1287-1289Crossref PubMed Scopus (507) Google Scholar, 11.Marshall H.M. Ronen K. Berry C. Llano M. Sutherland H. Saenz D. Bickmore W. Poeschla E. Bushman F.D. PLoS ONE. 2007; 2: e1340Crossref PubMed Scopus (199) Google Scholar), the co-factor was shown to play a role in integration site selection. Indeed, depletion of LEDGF/p75 induced a shift in lentiviral integration sites from the characteristic distribution in transcription units outside the promoter regions to a more random distribution. The interaction between LEDGF/p75 and HIV-1 IN is mediated by the IN binding domain (IBD) in the C terminus of LEDGF/p75 (12.Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem. 2004; 279: 33421-33429Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). A crystal structure of a complex between two IBDs and a dimer of HIV-1 IN catalytic core domains (CCDs) identified amino acid residues in LEDGF/p75 that are essential for the interaction with IN (13.Cherepanov P. Ambrosio A.L. Rahman S. Ellenberger T. Engelman A. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 17308-17313Crossref PubMed Scopus (356) Google Scholar). The hydrophobic amino acids Ile-365, Phe-406, and Val-408 and the charged Asp-366 residue all reside in the interhelical loops of the IBD. As a ubiquitously expressed protein, LEDGF/p75 functions as a transcriptional co-activator, protecting cells from extracellular stress by regulating transcription of stress-related genes (for review, see Ref. 14.Ganapathy V. Daniels T. Casiano C.A. Autoimmun. Rev. 2003; 2: 290-297Crossref PubMed Scopus (67) Google Scholar). By preventing cells from undergoing apoptotic cell death, the protein is also involved in oncogenesis (15.Daniels T. Zhang J. Gutierrez I. Elliot M.L. Yamada B. Heeb M.J. Sheets S.M. Wu X. Casiano C.A. Prostate. 2005; 62: 14-26Crossref PubMed Scopus (110) Google Scholar, 16.Daugaard M. Kirkegaard-Sorensen T. Ostenfeld M.S. Aaboe M. Hoyer-Hansen M. Orntoft T.F. Rohde M. Jaattela M. Cancer Res. 2007; 67: 2559-2567Crossref PubMed Scopus (107) Google Scholar, 17.Grand F.H. Koduru P. Cross N.C. Allen S.L. Leuk. Res. 2005; 29: 1469-1472Crossref PubMed Scopus (26) Google Scholar, 18.Hussey D.J. Moore S. Nicola M. Dobrovic A. BMC Genet. 2001; 2: 20Crossref PubMed Scopus (36) Google Scholar, 19.Morerio C. Acquila M. Rosanda C. Rapella A. Tassano E. Micalizzi C. Panarello C. Leuk. Res. 2005; 29: 467-470Crossref PubMed Scopus (24) Google Scholar). Through a link with the mixed-lineage leukemia (MLL) histone methyltransferase, LEDGF/p75 was recently shown to be essential for MLL-dependent transcription and leukemic transformation (20.Yokoyama A. Cleary M.L. Cancer Cell. 2008; 14: 36-46Abstract Full Text Full Text PDF PubMed Scopus (391) Google Scholar). To gain more insight into the cellular and virological role of LEDGF/p75, we attempt to identify and validate the cellular interaction partners of LEDGF/p75. Previously, we and others identified JPO2 as a first cellular interaction partner of the C-terminal end of LEDGF/p75 (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar, 22.Maertens G.N. Cherepanov P. Engelman A. J. Cell Sci. 2006; 119: 2563-2571Crossref PubMed Scopus (104) Google Scholar). Like HIV-1 IN, JPO2 also interacts with the IBD of LEDGF/p75. Amino acid residues in the IBD that are critical for IN interaction were not crucial for the interaction with JPO2 (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar), pointing to differential structural constraints for both interactions. Here we describe the identification of the interaction between the cellular protein pogZ (pogo transposable element-derived protein with zinc finger) and the C terminus of LEDGF/p75 using yeast two-hybrid screening. Our in silico analysis of the protein sequence indicates that pogZ represents a domesticated transposase related to the Tigger-derived (TIGD) DNA transposases with a DDE domain (23.Namgoong S.Y. Harshey R.M. EMBO J. 1998; 17: 3775-3785Crossref PubMed Scopus (61) Google Scholar). A DDE domain, also present in lentiviral integrases (24.Dyda F. Hickman A.B. Jenkins T.M. Engelman A. Craigie R. Davies D.R. Science. 1994; 266: 1981-1986Crossref PubMed Scopus (730) Google Scholar), is characterized by a catalytic site composed of two or three aspartic acid and/or glutamic acid residues with a specific spatial arrangement to allow coordination of Mg2+ cations (25.Allingham J.S. Pribil P.A. Haniford D.B. J. Mol. Biol. 1999; 289: 1195-1206Crossref PubMed Scopus (47) Google Scholar). It allows DNA-modifying reactions such as strand cleaving, nicking, and ligation. Our characterization of the interaction between pogZ and LEDGF/p75 gives new insight in the role of LEDGF/p75 and suggests a more profound role for LEDGF/p75 in DDE domain protein function. They support speculation on a possible evolutionary relationship between DNA transposons and lentiviral integrases. Yeast Two-hybrid Screen—A yeast two-hybrid screen was performed using a cell-to-cell mating protocol (26.Fromont-Racine M. Rain J.C. Legrain P. Methods Enzymol. 2002; 350: 513-524Crossref PubMed Scopus (46) Google Scholar). The experimental setup was designed as described previously (27.Emiliani S. Mousnier A. Busschots K. Maroun M. Van Maele B. Tempe D. Vandekerckhove L. Moisant F. Ben-Slama L. Witvrouw M. Christ F. Rain J.C. Dargemont C. Debyser Z. Benarous R. J. Biol. Chem. 2005; 280: 25517-25523Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). The prey consisted of a random-primed cDNA library prepared from CEMC7 cells (human T-cell line). The bait construct comprised the C-terminal domain (aa 341–507) of LEDGF/p75. Cell Culture—HeLaP4 CCR5 cells, a kind gift from Pierre Charneau, Institut Pasteur, Paris, France, were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum (International Medical), 20 μg/ml gentamicin (Invitrogen) (further referred to as Dulbecco's modified Eagle's medium-complete), and 0.5 mg/ml Geneticin at 37 °C and 5% CO2 in a humidified atmosphere. HeLaP4 CCR5 FLAG-LEDGF/p75 cells were treated the same with the addition of 2 μg/ml hygromycin B (Invitrogen) to the growth medium. Expression Plasmids and Lentiviral Vector Cloning—pEGFP-pogZ was a kind gift from M. Lechner, Drexel University, Philadelphia, PA. A lentiviral vector construct for the expression of mRFP-ΔNpogZ was produced by PCR amplification of the C-terminal coding region of pogZ from pEGFP-pogZ with the primers BamHI 5′-aatggatccatgttacccttgtctatgattgt and SalI 5′-aatgtcgactcaaatctccatcagatc. The PCR product was digested and used to replace JPO2 in the pCHMWS-mRFP-JPO2-IRES-hygro transfer plasmid (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar), 3′ to the mRFP-coding region. A bacterial expression plasmid encoding MBP-tagged C-terminal pogK, pK-ΔN, was produced by PCR amplification of the pogK coding sequence from HeLaP4 genomic DNA and insertion into pMalc2e (New England Biolabs) 3′ to the MBP coding sequence. PCR primers used were forward EcoRI, 5′-aatgaattctatgaggtagctcagatgg, and reverse BamHI, 5′-taaggatcctcagttgctctcagccatgc. The bacterial expression plasmid pZ-ΔN was produced by PCR amplification of the C-terminal coding region of pogZ from pEGFP-pogZ and cloning into pMalc2e 3′ to the MBP-coding sequence. PCR primers used were forward EcoRI, 5′-aatgaattcatgttacccttgtctatgattgt, and reverse BamHI, 5′-taaggatcctcaaatctccatcagatc. Bacterial expression plasmids encoding FLAG-tagged LEDGF/p75 and its IBD mutants as well as bacterial expression plasmids encoding p52, LEDGF/p75, HIV-1 IN-His, and MBP-JPO2 were described previously (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar). Eukaryotic expression plasmids and lentiviral vector constructs for the expression of mRFP-tagged LEDGF/p75, eGFP-tagged LEDGF/p75, and the nuclear localization signal (NLS)-deficient mutant (K150A) as well as eGFP-tagged Δ325 and the D366A mutant were described previously (6.De Rijck J. Vandekerckhove L. Gijsbers R. Hombrouck A. Hendrix J. Vercammen J. Engelborghs Y. Christ F. Debyser Z. J. Virol. 2006; 80: 11498-11509Crossref PubMed Scopus (151) Google Scholar, 9.Hombrouck A. De Rijck J. Hendrix J. Vandekerckhove L. Voet A. De Maeyer M. Witvrouw M. Engelborghs Y. Christ F. Gijsbers R. Debyser Z. PLoS Pathog. 2007; 3: 418-430Crossref Scopus (105) Google Scholar). A lentiviral vector construct co-expressing FLAG-tagged LEDGF/p75 and a hygromycin resistance gene was produced by PCR amplification of FLAG-LEDGF/p75 from the FLAG-LEDGF/p75 bacterial expression plasmid pCP-Nat-FLAG (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar) and cloning into pCHMWS-IRES-hygro transfer plasmid 5′ to the IRES, yielding pCHMWS-FLAG-LEDGF/p75 IRES-Hygro. Primers used were BglII forward, gcgagatctatggactacaaagaccatgacg, and SalI reverse, gaattcgtcgacctagttatctagtgtagaatcc. Purification of Recombinant ΔNpogZ, LEDGF/p75, p52, HIV-1 Integrase, CCD, and ΔNpogK—pZΔN and pKΔN were used to transform Rosetta2 Escherichia coli cells (Novagen, Germany). The transformants were grown at 37 °C to an A600 of 0.6, and protein production was induced by the addition of 0.5 mm isopropyl-β-d-thiogalactopyranoside. After induction, the culture was allowed to grow for 4 h before cells were collected by centrifugation (15 min, 4 °C, 6000 × g). The bacterial pellet was resuspended in lysis buffer (20 mm Tris/HCl, pH 7.4, 200 mm NaCl) and lysed by sonication (MSE 150-watt Ultrasonic Desintegrator). The MBP-ΔNpogZ and MBP-ΔNpogK fusion proteins were purified based on their affinity to amylose resin according to the manufacturer's protocol (New England Biolabs). The protein concentration of the collected fractions was determined with a BCA test (Pierce), and purity was determined by SDS-PAGE followed by Coomassie Brilliant Blue staining (Sigma-Aldrich). 20% glycerol was added to the fractions with the highest concentration and purity. The respective protein samples were stored at -20 °C. His-tagged HIV-1 IN was expressed from pRP1012 and purified as described previously (2.Busschots K. Vercammen J. Emiliani S. Benarous R. Engelborghs Y. Christ F. Debyser Z. J. Biol. Chem. 2005; 280: 17841-17847Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). Non-tagged LEDGF/p75 and p52 were expressed and purified as described previously (29.Maertens G. Cherepanov P. Pluymers W. Busschots K. De Clercq E. Debyser Z. Engelborghs Y. J. Biol. Chem. 2003; 278: 33528-33539Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar). The FLAG-tagged LEDGF/p75 expression and purification was essentially the same as for the non-tagged LEDGF/p75. HIV-1 IN CCD was purified as described previously (30.Goldgur Y. Dyda F. Hickman A.B. Jenkins T.M. Craigie R. Davies D.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9150-9154Crossref PubMed Scopus (371) Google Scholar). Vector Production—Lentiviral vectors were prepared as described previously (31.Geraerts M. Michiels M. Baekelandt V. Debyser Z. Gijsbers R. J. Gene Med. 2005; 7: 1299-1310Crossref PubMed Scopus (135) Google Scholar). Stable Cell Lines—To make the HeLaP4 CCR5 FLAG-LEDGF/p75 stable cell line, HeLaP4 CCR5 cells were seeded in a 24-well plate and transduced with 104 RNA equivalents of CHMWS-FLAG-LEDGF/p75 IRES-Hygro lentiviral vector the following day. After 4 h of incubation, the supernatant was removed, cells were washed with PBS, and 1 ml of Dulbecco's modified Eagle's medium complete medium was added. After 48 h, selection was initiated by adding 2 μg/ml hygromycin B (Invitrogen). Analysis of Direct Protein-Protein Interaction by AlphaScreen—The AlphaScreen assay was performed according to the manufacturer's protocol (PerkinElmer Life Sciences) and as described before (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar). Cross-titration experiments were performed by titrating increasing amounts of one protein interaction partner against different concentrations of a second protein interaction partner. Co-immunoprecipitation—Nuclear extracts were prepared as described previously (1.Cherepanov P. Maertens G. Proost P. Devreese B. Van Beeumen J. Engelborghs Y. De Clercq E. Debyser Z. J. Biol. Chem. 2003; 278: 372-381Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar), and all further manipulations were performed at 4 °C. ANTI-FLAG® M2-agarose affinity beads (Sigma-Aldrich) were washed with PBS and incubated with the lysate for 1 h. The beads were collected by centrifugation (30 s, 1800 × g, 4 °C) and washed 3 times with 400 μl of 400CSK buffer (10 mm Pipes, pH 6.8, 10% (w/v) sucrose, 1 mm dithiothreitol, 1 mm MgCl2, 400 mm NaCl, complete protease inhibitor w/o EDTA (Roche Applied Science). Immunoprecipitated protein was eluted with 40 μl of SDS-PAGE loading buffer. Samples were analyzed by 10% SDS-PAGE and Western blotting using appropriate antibodies. Western Blotting—Protein samples were separated on 10% SDS-PAGE and electroblotted onto polyvinylidene difluoride membranes (Bio-Rad). Membranes were blocked with milk powder in PBS, 0.1% Tween 20, and detection was carried out using mouse anti-LEDGF/p75 antibody (Bethyl, Montgomery, TX), rabbit anti-pogZ antibody (Aviva Systems Biology, San Diego, CA), or rabbit anti-mRFP antibody (Chemicon). Visualization was performed using chemiluminescence (ECL+, Amersham Biosciences) using anti-mouse (α-FLAG) or anti-rabbit (α-pogZ, α-mRFP) antibodies coupled to horseradish peroxidase (Dako). Fluorescence and Laser Scanning Microscopy—Cells grown in LabTek II glass chamber slides (VWR International) were fixed by incubation with 4% formaldehyde in PBS for 10 min and washed with PBS. The nuclear DNA was stained with 0.5 μg/ml DAPI (Molecular Probes). Immunohistochemistry staining of pogZ was performed using anti-pogZ antibody (Aviva Systems Biology, San Diego, CA). Confocal microscopy was performed using an LSM 510 meta unit (Zeiss, Zaventem, Belgium). All images were acquired in the multi-track mode. eGFP was excited at 488 nm (AI laser), mRFP at 543 nm (HeNe laser), and DAPI at 790 nm (MAI TAI two photon laser). After the main dichroic beam splitter (HFT UV/488/543/633 for eGFP, HFT 700/543 for mRFP, and HFT KP 650 for DAPI), the fluorescence signal was divided by a secondary dichroic beam splitter (NFT 490 for eGFP or NFT 545 for mRFP) and detected in the separate channels using the appropriate filters (BP 500-550 for eGFP, BP 561–615 for mRFP, and BP 435–485 for DAPI). HIV Infection and Analysis of Transfected HeLaP4 Cells—The day before transient transfection, 200,000 cells were seeded per well in a 6-well plate, and attachment to the plate was allowed overnight. Cells were transfected with 20 nm siRNA following the guidelines of the siFECTamine™ protocol. Synthetic siRNAs were designed as follows and provided by Qiagen (Belgium); sipZ1, (aagaagagagctgttaggaaa), sipZ2 (aaagaacagcgacagtacaaa), siCD-4 targeting the CD4 receptor was described previously (33.Novina C.D. Murray M.F. Dykxhoorn D.M. Beresford P.J. Riess J. Lee S.K. Collman R.G. Lieberman J. Shankar P. Sharp P.A. Nat. Med. 2002; 8: 681-686Crossref PubMed Scopus (743) Google Scholar). Three days after transfection 1.5 × 104 cells were re-seeded in a 24-well plate for 4 h at 37 °C. After attachment, cells were infected with 8.5 × 105 pg p24/ml of HIV-1 in a total volume of 250 μl. At 24 h after infection, a single well was analyzed for β-galactosidase activity (chemiluminescent β-galactosidase reporter gene assay; Roche Applied Science). The β-galactosidase activity was measured according to the manufacturer's protocol. Chemiluminescence was measured with a LumiCount instrument (Packard Instrument Co.). The protein concentration of each sample was determined (BCA protein assay kit; Perbio), and read-outs were normalized for protein content. Identification of pogZ as a Novel Interaction Partner of LEDGF/p75—To identify novel cellular interaction partners of LEDGF/p75, we performed a Y2H screen. In light of our ongoing drug discovery program, we were primarily interested in the identification of cellular binding partners of LEDGF/p75 that interact with the IBD. Therefore, we used the C-terminal region (aa 341–507) as bait (Fig. 1A). The prey consisted of a CEM-C7 T-cell line cDNA library. Next to the earlier-described LEDGF/p75 binding partner JPO2 (21.Bartholomeeusen K. De Rijck J. Busschots K. Desender L. Gijsbers R. Emiliani S. Benarous R. Debyser Z. Christ F. J. Mol. Biol. 2007; 372: 407-421Crossref PubMed Scopus (73) Google Scholar, 22.Maertens G.N. Cherepanov P. Engelman A. J. Cell Sci. 2006; 119: 2563-2571Crossref PubMed Scopus (104) Google Scholar), the transposase-like protein, pogZ, was identified as putative interaction partner of LEDGF/p75. Ten clones of different length were identified, and alignment of the sequences pinpointed to the C-terminal region of pogZ as the specific interaction domain (SID) for LEDGF/p75 (Fig. 1B). In Silico Analysis Reveals pogZ to Contain a DDE Domain, a Helix-turn-helix Domain, and a Six-zinc-finger Array Representing a Domesticated DNA Transposase—PogZ (Uniprot entry Q7Z3K3) was previously identified as a potential interaction partner of the transcription factor sp1 in a Y2H screen (34.Gunther M. Laithier M. Brison O. Mol. Cell. Biochem. 2000; 210: 131-142Crossref PubMed Google Scholar). However, nothing was known about the cellular function of the protein. PogZ (1410 aa) has a calculated molecular mass of 155 kDa. A sequence homology search using the NCBI-BLAST algorithm for the N-terminal region of pogZ showed 57% homology with the human protein ZNF280D overlapping the zinc finger region (Fig. 1A). A conserved domain scan using the NCBI BLAST algorithm (35.Marchler-Bauer A. Panchenko A.R. Shoemaker B.A. Thiessen P.A. Geer L.Y. Bryant S.H. Nucleic Acids Res. 2002; 30: 281-283Crossref PubMed Scopus (540) Google Scholar) revealed the presence of a DDE domain and a DNA binding helix-turn-helix (HTH) domain in the C-terminal end of pogZ (Fig. 1B). The SID of pogZ with LEDGF/p75 overlapped with the predicted DDE domain (Fig. 1, A and B). This finding is of particular interest as the interaction of HIV-1 IN with LEDGF/p75 is mediated by the IN CCD, essentially a DDE domain (24.Dyda F. Hickman A.B. Jenkins T.M. Engelman A. Craigie R. Davies D.R. Science. 1994; 266: 1981-1986Crossref PubMed Scopus (730) Google Scholar, 36.Plasterk R.H. Nat. Struct. Biol. 1995; 2: 87-90Crossref PubMed Scopus (11) Google Scholar). Next, the PSI-BLAST algorithm (37.Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (61086) Google Scholar) was used to reveal functionally and evolutionarily important protein similarities for the DDE domain of pogZ (aa 1117–1323). When convergence was reached, PSI-BLAST uncovered sequence homology with TIGD transposases, such as TIGD1, human Jerky homologue (JRK), and human Jerky homologue like (JRKL) (Fig. 1C). Both Jerky and TIGD transposases are remnants of DNA-transposons related to the Tc1/mariner transposons that were active in the primate genome 60–80 million years ago (38.Pace Jr., J.K. Feschotte C. Genome Res. 2007; 17: 422-432Crossref PubMed Scopus (212) Google Scholar, 39.Smit A.F. Riggs A.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1443-1448Crossref PubMed Scopus (364) Google Scholar). An earlier report points to the conservation of the catalytic Asp, Asp, and Asp/Glu residues in the DDE domain of TIGD1 by sequence homology with Tc/mariner transposases (39.Smit A.F. Riggs A.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1443-1448Crossref PubMed Scopus (364) Google Scholar). Alignment of the human JRK, JRKL, and TIGD1 with the DDE domain of pogZ demonstrates the conservation of the catalytic Asp, Asp, and Asp/Glu residues in pogZ and both JRKL and JRK (Fig. 1C). The positioning of the catalytic residues in pogZ follows the DD35(D/E) consensus. In addition, a search of the PDB repository for the closest enzymatically active, structural homologue of the pogZ DDE domain using the PHYRE search engine (40.Bennett-Lovsey R.M. Herbert A.D. Sternberg M.J. Kelley L.A. Proteins. 2008; 70: 611-625Crossref PubMed Scopus (362) Google Scholar) yielded the DDE domain of mos-1 DNA transposase (PDB entry 2f7t), which has a consensus DDE domain fold. Alignment of the predicted secondary structure of the DDE domains of pogZ and mos-1 revealed a significant conservation in length and position of secondary structure elements (Fig. 1D). Although there is limited sequence homology at the primary structure, the catalytic important DD(E/D) triad of pogZ could be aligned with that of mos-1. Altogether, these data suggest that the pogZ protein represents a domesticated DNA transposase that was C-terminal-fused to a zinc finger-rich domain. This hypothesis is further supported by the fact that the C terminus of pogZ, including the transposase homology domain and the HTH (Fig. 1A) is encoded by a single exon (exon 19). A similar evolutionary path seems to be taken by a human paralogue of pogZ, pogK. Like pogZ and TIGDs, the C-terminal end of pogK also contains a predicted HTH and a DDE domain (Fig. 1A). Similar to pogZ, this region is also encoded by a single exon for the pogK protein. In pogK, however, this transposase-derived sequence is N-terminal-fused to a predicted KRAB domain (Fig. 1A). Sequence alignment of the DDE domain of pogK points to a loss of the DxD35(E/D) catalytic triad (Fig. 1C). Confirmation of the Cellular Interaction between LEDGF/p75 and pogZ—Confocal fluorescence microscopy analysis of cells transiently transfected with a plasmid encoding eGFP-tagged pogZ demonstrated its specific nuclear localization. Whereas expression of the pogZ fusion was rather low (data not shown), co-expression of mRFP-tagged LEDGF/p75 resulted in increased eGFP-pogZ expression levels (Fig. 2A). The fluorescent signals for eGFP-pogZ and mRFP-LEDGF/p75 displayed a similar intranuclear localization (Fig. 2A, overlay). To confirm that LEDGF/p75 and pogZ are in the same complex, HeLaP4 CCR5 cells stably overexpressing N-terminal FLAG-tagged LEDGF/p75 (HeLaP4-CCR5 FLAG-LEDGF/p75) were fractionated into a cytoplasmic, a soluble nuclear, and an insoluble high salt-resistant chromatin fraction. Both pogZ and LEDGF/p75 were present in the nuclear fraction. Whereas LEDGF/p75 completely dissociated from the chromatin by applying 400 mm NaCl (Fig. 2B, compare lanes 2 and 3, lower panel), a significant amount of pogZ remained associated with the chromatin (Fig. 2B, lanes 2 and 3, upper panel) possibly because of a strong interaction of the six-zinc-finger array and the HTH domain with the chromatin. The soluble nuclear fraction was used for immunoprecipitation of FLAG-tagged LEDGF/p75. Parental HeLaP4-CCR5 cells were used as control (Fig. 2B, lanes 6 and 7). Endogenous pogZ was efficiently co-immunoprecipitated with FLAG-tagged LEDGF/p75 (Fig. 2B). Dilution of the 400 mm NaCl nuclear fraction to 250 mm NaCl improved pogZ co-immunoprecipitation (Fig. 2B, compare lanes 4 and 5, upper panel). These data indicate the presence of a salt-sensitive nuclear complex containing LEDGF/p75 and pogZ. In a separate set of co-immunoprecipitation experiments we could show that both pogZ and JPO2, like HIV IN, interact with Hrp2, next to LEDGF/p75, the only known human IBD-containing protein (12.Maertens G. Cherepanov P. Debyser Z. Engelborghs Y. Engelman A. J. Biol. Chem.

Referência(s)