Portal de Periódicos da CAPES

Evidence for the Head Domain Movement of the Rieske Iron-Sulfur Protein in Electron Transfer Reaction of the Cytochromebc1 Complex

1999; Elsevier BV; Volume: 274; Issue: 11 Linguagem: Inglês

10.1074/jbc.274.11.7146

1083-351X

Hua Tian, Steve White, Linda Yu, Chang‐An Yu,

Metal-Catalyzed Oxygenation Mechanisms

The three-dimensional structure of the mitochondrial cytochrome bc1 complex suggests that movement of the extramembrane domain (head) of the Rieske iron-sulfur protein (ISP) may play an important role in electron transfer. Such movement requires flexibility in the neck region of ISP, since the head and transmembrane domains of the protein are rather rigid. To test this hypothesis, Rhodobacter sphaeroidesmutants expressing His-tagged cytochrome bc1complexes with cysteine substitution at various positions in the ISP neck (residues 39–48) were generated and characterized. The mutants with a single cysteine substitution at Ala42 or Val44 and a double cysteine substitution at Val44 and Ala46 (VQA-CQC) or at Ala42 and Ala46 (ADVQA-CDVQC) have photosynthetic growth rates comparable with that of complement cells. Chromatophore membrane and intracytoplasmic membrane (ICM) prepared from these mutants have cytochrome bc1complex activity similar to that in the complement membranes, indicating that flexibility of the neck region of ISP was not affected by these cysteine substitutions. Mutants with a double cysteine substitution at Ala42 and Val44 (ADV-CDC) or at Pro40 and Ala42 (PSA-CSC) have a retarded (50%) or no photosynthetic growth rate, respectively. The ADV-CDC or PSA-CSC mutant ICM contains 20 or 0% of the cytochromebc1 complex activity found in the complement ICM. However, activity can be restored by the treatment with β-mercaptoethanol (β-ME). The restored activity is diminished upon removal of β-ME but is retained if the β-ME-treated membrane is treated with the sulfhydryl reagent N-ethylmaleimide orp-chloromercuribenzoic acid. These results indicate that the loss of bc1 complex activity in the ADV-CDC or PSA-CSC mutant membranes is due to disulfide bond formation, which increases the rigidity of ISP neck and, in turn, decreases the mobility of the head domain. Using the conditions developed for the isolation of His-tagged complement cytochrome bc1 complex, a two-subunit complex (cytochromes b and c1) is obtained from all of the double cysteine-substituted mutants. This suggests that introduction of two cysteines in the neck region of ISP weakens the interactions between cytochromes b, ISP, and subunit IV. The three-dimensional structure of the mitochondrial cytochrome bc1 complex suggests that movement of the extramembrane domain (head) of the Rieske iron-sulfur protein (ISP) may play an important role in electron transfer. Such movement requires flexibility in the neck region of ISP, since the head and transmembrane domains of the protein are rather rigid. To test this hypothesis, Rhodobacter sphaeroidesmutants expressing His-tagged cytochrome bc1complexes with cysteine substitution at various positions in the ISP neck (residues 39–48) were generated and characterized. The mutants with a single cysteine substitution at Ala42 or Val44 and a double cysteine substitution at Val44 and Ala46 (VQA-CQC) or at Ala42 and Ala46 (ADVQA-CDVQC) have photosynthetic growth rates comparable with that of complement cells. Chromatophore membrane and intracytoplasmic membrane (ICM) prepared from these mutants have cytochrome bc1complex activity similar to that in the complement membranes, indicating that flexibility of the neck region of ISP was not affected by these cysteine substitutions. Mutants with a double cysteine substitution at Ala42 and Val44 (ADV-CDC) or at Pro40 and Ala42 (PSA-CSC) have a retarded (50%) or no photosynthetic growth rate, respectively. The ADV-CDC or PSA-CSC mutant ICM contains 20 or 0% of the cytochromebc1 complex activity found in the complement ICM. However, activity can be restored by the treatment with β-mercaptoethanol (β-ME). The restored activity is diminished upon removal of β-ME but is retained if the β-ME-treated membrane is treated with the sulfhydryl reagent N-ethylmaleimide orp-chloromercuribenzoic acid. These results indicate that the loss of bc1 complex activity in the ADV-CDC or PSA-CSC mutant membranes is due to disulfide bond formation, which increases the rigidity of ISP neck and, in turn, decreases the mobility of the head domain. Using the conditions developed for the isolation of His-tagged complement cytochrome bc1 complex, a two-subunit complex (cytochromes b and c1) is obtained from all of the double cysteine-substituted mutants. This suggests that introduction of two cysteines in the neck region of ISP weakens the interactions between cytochromes b, ISP, and subunit IV. The cytochrome bc1 complex (ubiquinol-cytochrome c reductase) is an essential segment of the energy-conserving electron transfer chains of mitochondria and many respiratory and photosynthetic bacteria (1Trumpower B.L. Gennis R.B. Annu. Rev. Biochem. 1994; 63: 675-716Crossref PubMed Scopus (468) Google Scholar). This complex catalyzes electron transfer from ubiquinol to cytochrome cand concomitantly translocates protons across the membrane to generate a membrane potential and pH gradient for ATP synthesis. Although the cytochrome bc1 complexes from different sources vary in their polypeptide compositions, they all contain four redox prosthetic groups: two b-type cytochromes (b566 or bL and b562 or bH), onec-type cytochrome (cytochrome c1), and one high potential Rieske iron-sulfur cluster [2Fe-2S]. 1The abbreviations used are: [2Fe-2S] cluster, iron sulfur cluster of Rieske iron-sulfur protein; bL, low potential heme b; bH, high potential heme b; DM, dodecylmaltoside; NTA, nitrilotriacetic acid; ICM, intracytoplasmic membrane(s); PAGE, polyacrylamide gel electrophoresis; ISP, iron-sulfur protein; β-ME, β-mercaptoethanol; NEM, N-ethylmaleimide; PCMB, p-chloromercuribenzoic acid 1The abbreviations used are: [2Fe-2S] cluster, iron sulfur cluster of Rieske iron-sulfur protein; bL, low potential heme b; bH, high potential heme b; DM, dodecylmaltoside; NTA, nitrilotriacetic acid; ICM, intracytoplasmic membrane(s); PAGE, polyacrylamide gel electrophoresis; ISP, iron-sulfur protein; β-ME, β-mercaptoethanol; NEM, N-ethylmaleimide; PCMB, p-chloromercuribenzoic acid The proton-motive Q cycle model (2Mitchell P. J. Theor. Biol. 1976; 62: 327-367Crossref PubMed Scopus (923) Google Scholar) has been favored for electron transfer and proton translocation in the complex. The key feature of this model is the presence of two separate ubiquinone- or ubiquinol-binding sites: a ubiquinol oxidation site near the P side of the inner mitochondrial membrane and a ubiquinone reduction site near the N side of the membrane. Recently, the cytochrome bc1 complex from beef heart mitochondria was crystallized and its three-dimensional structure solved at 2.9-Å resolution (3Yu C.-A. Kachurin A.M. Yu L. Xia D. Kim H. Deisenhofer J. Biochim. Biophys. Acta. 1996; 1275: 47-53Crossref PubMed Scopus (86) Google Scholar, 4Xia D. Yu C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L. Yu L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (867) Google Scholar). The structural information obtained not only answered a number of questions concerning the arrangement of the redox centers, transmembrane helices, and inhibitor binding sites but also suggested movement of an extramembrane domain within the iron-sulfur protein (ISP) during electron transfer (4Xia D. Yu C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L. Yu L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (867) Google Scholar). This suggestion arose from observation of an uneven electron density in the I4122 crystal data of native bovine cytochromebc1 complex. A particularly low electron density area is observed in the intermembrane space portion of the complex, where the extramembrane domains of ISP and cytochromec1 reside (4Xia D. Yu C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L. Yu L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (867) Google Scholar). This movement hypothesis was further supported by the finding that the position of the iron-sulfur cluster in the complex is affected by ubiquinol oxidation site inhibitor binding (5Kim H. Xia D. Deisenhofer J. Yu C.A. Kachurin A. Zhang L. Yu L. FASEB J. 1997; 11: 1084Google Scholar, 6Kim H. Xia D. Yu C.A. Kachurin A. Zhang L. Yu L. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8026-8033Crossref PubMed Scopus (256) Google Scholar, 8Yu C.A. Xia D. Kim H. Deisenhofer J. Zhang L. Kachurin A.M. Yu L. Biochim. Biochem. Acta. 1998; 1365: 151-158Crossref PubMed Scopus (50) Google Scholar) and by the crystal form (7Zhang Z.L. Huang L.-S. Shulmeister V.M. Chi Y.-I. Kim K.K. Huang L.-W. Crofts A.R. Berry E.A. Kim S.-H. Nature. 1998; 392: 677-684Crossref PubMed Scopus (929) Google Scholar, 9Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1057) Google Scholar, 10Crofts A.R. Meinhardt S.W. Biochem. Soc. Trans. 1982; 10: 201-203Crossref PubMed Scopus (39) Google Scholar, 11Tsai A.L. Olson J.S. Palmer G. J. Biol. Chem. 1987; 262: 8677-8684Abstract Full Text PDF PubMed Google Scholar). The anomalous light scattering signal of the [2Fe-2S] cluster is enhanced in co-crystals with stigmatellin or UHDBT but is diminished in the co-crystal with (E)-methyl-3-methoxy-2-(4′-trans-stilbenyl) acrylate (5Kim H. Xia D. Deisenhofer J. Yu C.A. Kachurin A. Zhang L. Yu L. FASEB J. 1997; 11: 1084Google Scholar). Thus, binding of stigmatellin or UHDBT arrests the movement of the extramembrane domain of ISP, fixing the iron-sulfur cluster 27 Å from heme bL and 31 Å from heme c1 (referred to as the "fixed state" of ISP), the same position it occupies in the I4122 crystal of native bovine cytochrome bc1 complex. The position of the iron-sulfur cluster changes from the fixed state to somewhere closer to heme c1 (referred to as the "released state" of ISP) upon (E)-methyl-3-methoxy-2-(4′-trans-stilbenyl) acrylate binding. The recent report of Iwata et al. (9Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1057) Google Scholar), showing the iron-sulfur cluster at two different positions in two crystal forms, further supports the presence of a variable position of in the "released state" of the iron-sulfur cluster. Movement of the head domain of ISP during electron transfer in cytochrome bc1 complex can be explained as follows. The [2Fe-2S] cluster is reduced by the first electron of ubiquinol at a position 27 Å from heme bL and 31 Å from heme c1 (ISP in "fixed state"). Since a reduced [2Fe-2S] cluster cannot donate an electron to cytochromec1 before the second electron of ubiquinol is transferred to heme bL, it was postulated that either the change of the ubiquinone binding position during reduction ofbL or the electron transfer frombL to bH causes a conformational change in cytochrome b, which forces or allows reduced [2Fe-2S] to move close enough to heme c1(ISP in "released state") for electron transfer (5Kim H. Xia D. Deisenhofer J. Yu C.A. Kachurin A. Zhang L. Yu L. FASEB J. 1997; 11: 1084Google Scholar, 7Zhang Z.L. Huang L.-S. Shulmeister V.M. Chi Y.-I. Kim K.K. Huang L.-W. Crofts A.R. Berry E.A. Kim S.-H. Nature. 1998; 392: 677-684Crossref PubMed Scopus (929) Google Scholar). This model would also explain why ubisemiquinone, a more powerful reductant than ubiquinol, reduces bL, but not the [2Fe-2S] cluster, during ubiquinol oxidation. ISP has three domains: the membrane-spanning N-terminal domain consisting of residues 1–62 (tail), the soluble C-terminal extramembrane domain consisting of residues 73–196 (head), and the flexible linking domain comprising residues 63–72 (neck). ISP is associated with the complex primarily via the membrane-spanning N-terminal domain (4Xia D. Yu C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L. Yu L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (867) Google Scholar, 7Zhang Z.L. Huang L.-S. Shulmeister V.M. Chi Y.-I. Kim K.K. Huang L.-W. Crofts A.R. Berry E.A. Kim S.-H. Nature. 1998; 392: 677-684Crossref PubMed Scopus (929) Google Scholar, 9Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1057) Google Scholar). The [2Fe-2S] cluster is located at the tip of the head domain (12Iwata S. Saynovits M. Link T.A. Michel H. Structure. 1996; 4: 567-579Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 13Link T.A. Saynovits M. Assmann C. Iwata S. Ohnishi T. Von Jagow G. Eur. J. Biochem. 1996; 237: 71-75Crossref PubMed Scopus (49) Google Scholar). Since the three-dimensional structures of the head and tail domains are the same in the fixed and released states, movement of the head domain of ISP in the bc1 complex requires flexibility in the neck region. If movement of the head domain of ISP is required forbc1 catalysis and the neck region of ISP confers the required mobility, decreasing the flexibility of the neck region of ISP should affect bc1 complex activity. This hypothesis can be tested by site-directed mutagenesis followed by biochemical and biophysical characterization of mutant expressing cytochrome bc1 complexes with altered ISP necks. However, site-directed mutagenesis in bovine heart mitochondria is not practical. R. sphaeroides is an ideal system to study the neck region of ISP by molecular genetics approach. The four-subunit complex is functionally analogous to the mitochondrial enzyme; the largest three subunits are homologous to their mitochondrial counterparts; and this system is readily manipulated genetically. In addition, the recent generation of R. sphaeroides expressing His6-tagged cytochrome bc1 complex greatly speeds up the preparation of the bc1complex from wild-type or mutant cells (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). The R. sphaeroides ISP neck is composed of residues 39–48 (corresponding to residues 63–72 of bovine ISP) with a sequence of NPSADVQALA. Ala42, Asp43, Val44, Ala46, and Ala48 are the conserved amino acid residues. We have previously generated mutants with increased ISP neck rigidity by double or triple proline substitution of the conserved residues. The results demonstrated that flexibility in the ISP neck is important in bc1 catalysis (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). The ALA-PLP and ADV-PPP mutant membranes have, respectively, 30 and 0% of the cytochrome bc1 complex activity found in the complement membrane. The ALA-PLP mutant complex has a larger activation energy than the wild-type complex, suggesting that movement of the head domain decreases the activation energy barrier of the bc1 complex. To better define the structure and function relationship of the neck region of ISP in the bc1 complex, we recently generated mutants expressing His6-taggedbc1 complex with single or double cysteine substitution at various positions in the ISP neck. We predict that formation of a disulfide bond between a pair of genetically engineered cysteines in the neck will decrease its flexibility and thus decrease electron transfer activity. Measuring the bc1activity in these cysteine-substituted mutants should give insight into the dynamic state of the ISP neck. Herein we report procedures for generating R. sphaeroides mutants expressing His6-tagged cytochrome bc1 complexes with altered ISP necks by introducing single cysteines or a pair of cysteines at different positions. The photosynthetic growth behavior, the cytochrome bc1 complex activity, and the EPR characteristics of the Rieske [2Fe-2S] cluster in membranes and the purified state from complement and mutant strains are examined and compared. The effect of sulfhydryl reagents on cytochromebc1 complexes from complement and mutant membranes is also examined. 2-Mercaptoethanol (β-ME),N-ethylmaleimide (NEM), and p-chloromercuribenzoic acid (PCMB) are from Sigma. All other chemicals are of the highest purity commercially available. Mutations were constructed by site-directed mutagenesis using the Altered Sites system from Promega. The oligonucleotide primers used for mutagenesis were as follows: ADV(42–44)-CDC, GCTGATCAACCAAATGAATCCGTCGTGCGACTGCCAGGCCCTCGCCTCCATCTTCGTCG; A42C, CAAATGAATCCGTCGTGCGACGTGCAGGCCCTCGCCTCCATCT; V44C, ATGAATCCGTCGGCCTACTGCCAGGCCCTCGCCTCCATCT; VQA(44–46)-CQC, AACCAAATGAATCCGTCGGCCGACTGCCAGTGCCTCGCCTCCATCTTCGTCGATGTGA; PSA(40–42)-CSC, TGGCCGCTGATCAACCAAATGAATTGCTCGTGCGACGTGCAGGCCCTCGCCTCCATCTT; ADVQA(42–46)-CDVQC, TCGTGCGACGTCCAGTGCCTCGCCTCCATCTT. The method for construction of ISP mutants is essentially the same as previously reported by Tian et al. (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). The ADVQA(42–46)-CDVQC mutant was constructed by annealing the oligonucleotide primer with single-stranded pSELNB3503 carrying a A42C mutation in ISP. The presence of engineered mutations were confirmed by DNA sequencing before and after photosynthetic or semiaerobic growth of the cells. Expression plasmid pRKDfbcFmBCHQ was purified from an aliquot of a photosynthetic or semiaerobic culture using the Qiagen plasmid Mini Prep kit. Since R. sphaeroides cells contain four types of endogenous plasmids, the isolated plasmids are not pure and concentrated enough for direct sequencing. Thus, a 1.2-kilobase pair DNA segment containing the mutation sequence was amplified from the isolated plasmids by polymerase chain reaction and purified by 1% agarose gel electrophoresis. The 1.2-kilobase pair polymerase chain reaction product was recovered from the gel by a gel extraction kit from Qiagen. Escherichia coli was grown at 37 °C in an enriched medium (TYP) in order to shorten growth time and increase plasmid yield (15Khosravi M. Ryan W. Websger D.A. Stark B.C. Plasmid. 1990; 23: 138-143Crossref PubMed Scopus (36) Google Scholar). For photosynthetic growth of the plasmid-bearing R. sphaeroides BC17 cells, an enriched Sistrom's medium containing 5 mm glutamate and 0.2% casamino acids was used. The pH of the medium was adjusted to 7.1 with a mixture of 6 n NaOH and 2 n KOH to increase the sodium and potassium ion content of the medium to a more optimal level (16Sistrom W.R. J. Gen. Microbiol. 1960; 22: 778-785Crossref PubMed Scopus (335) Google Scholar). Photosynthetic growth condition of R. sphaeroides was essentially as described previously (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar); cells harboring mutated fbc genes on the pRKDfbcFBCQ plasmid were grown photosynthetically for one or two serial passages to minimize any pressure for reversion. For semiaerobic growth of R. sphaeroides, an enriched Sistrom's medium supplemented with 20 amino acids and extra rich vitamins was used. These semiaerobic cultures were grown in 0.5 liters of enriched medium in 2-liter Bellco flasks with vigorous shaking (220 rpm) for 26 h. The inoculation volumes used for both photosynthetic and semiaerobic cultures were always at least 5% of the total volume. Antibiotics were added to the following concentrations: ampicillin (125 mg/liter), tetracycline (10 mg/liter for E. coli and 1 mg/liter for R. sphaeroides), kanamycin sulfate (30 mg/liter for E. coli and 20 mg/liter for R. sphaeroides), trimethoprim (87.5 mg/liter for E. coli). Cells were harvested, washed, and passed twice through a French pressure cell at 846 p.s.i. as described previously (17Yu L. Yu C.A. Biochemistry. 1990; 30: 4934-4939Crossref Scopus (27) Google Scholar). The chromatophore fraction was pelleted by ultracentrifugation of broken cells in a Beckman Ti 50.2 rotor at 48,000 rpm for 2 h at 4 °C. Membrane was washed with 50 mm Tris-Cl, pH 8.0, containing 1 mm MgSO4 and stored at −80 °C in the presence of 20% glycerol. The His6-tagged cytochromebc1 complexes were purified from chromatophores by the method of Tian et al. (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). His6 tag is located at the C terminus of the cytochromec1 subunit. Ubiquinol-cytochrome c reductase activity was measured at 23 °C in a 1-ml assay mixture containing 100 mmsodium/potassium phosphate buffer, pH 7.4, 0.3 mm EDTA, 100 μm cytochrome c, 25 μm2,3-dimethoxy-5-methyl-6(10-bromodecyl)-1,4-benzoquinol, and an appropriate amount of membrane or purified cytochromebc1 complex. Chromatophores or ICM were diluted with 50 mm Tris-Cl, pH 8.0, containing 20% glycerol and 1 mm MgSO4 to a final concentration of cytochromeb of 5 μm. No detergent was added to the diluted mixture in order to preserve the bc1activity. 5 μl of diluted membrane was added to the assay mixture. Activity was determined by measuring the reduction of cytochromec (the absorbance increase at 550 nm), using a millimolar extinction coefficient of 18.5 cm−1mm−1. Nonenzymatic oxidation of 2,3-dimethoxy-5-methyl-6(10-bromodecyl)-1,4-benzoquinol, determined under the same conditions in the absence of enzyme, was subtracted. The purified bc1 complex activity assay is essentially as described previously (14Tian H. Yu L. Mather M. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). β-ME was added to membrane preparations (40 μm cytochrome b) to a final concentration of 100 μm. After incubation on ice for 10 min, aliquots were removed from the mixture for assay. β-ME was removed from the treated membrane by washing with 50 mmTris-Cl, pH 8.0, and 1 mm MgSO4 and centrifuging at 80,000 rpm for 30 min with a Beckman TL ultracentrifuge. This process was repeated three times. Freshly prepared NEM (100 mm in H2O) was added to the β-ME-pretreated chromatophore or ICM (concentration is at 40 μm cytochrome b) to a final concentration of 500 μm. The mixture was flushed briefly with nitrogen, sealed, and incubated at room temperature for 15 min before measuring cytochromebc1 complex activity. The stock solution of PCMB was prepared by first dissolving PCMB powder in 0.5 n NaOH followed by neutralization. Modification of cysteine with PCMB was carried out as described for NEM. Excess NEM and PCMB was removed by repeated washing and centrifuging, and enzymatic activity was redetermined. Molecular modeling was carried out in a Indigo II Silicon Graphics Station. A peptide with NCSCQVQALA sequence, corresponding to the ISP neck sequence of the R. sphaeroidesPSA-CSC mutant, was built using the Builder Module from Insight II software from Molecular Simulation, Inc. Whether this peptide has acceptable geometry for disulfide bond formation was examined by minimizing the structure as follows: (a) continued iterations using steepest descents minimization until the maximum derivation was less than 10 kcal/Å; (b) continued iterations using conjugate minimization until the maximum derivation was less than 1.0 kcal/Å; (c) continued iterations using va09a minimization until the maximum derivation was less than 0.01 kcal/Å; (d) creation of a disulfide bond; (e) minimization of the peptide using the Optimize command in Builder; and (f) visual examination of geometry and comparison with a control (no disulfide bond) using the print energy per residue command. Protein concentration was determined by the method of Lowry et al. (18Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Cytochrome b (19Berden J.A. Slater E.C. Biochim. Biophys. Acta. 1970; 216: 237-249Crossref PubMed Scopus (151) Google Scholar) and cytochromec1 (20Yu L. Dong J.H. Yu C.A. Biochim. Biophys. Acta. 1986; 852: 203-211Crossref PubMed Scopus (36) Google Scholar) were determined according to published methods. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed according to Laemmli (21Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (206620) Google Scholar) using a Bio-Rad Mini-protean dual slab vertical cell. Western blotting was performed using rabbit polyclonal antibodies against cytochrome b, cytochromec1, ISP, and subunit IV of the R. sphaeroides bc1 complex. The polypeptides separated in the SDS-PAGE gel were transferred to polyvinylidene difluoride membrane for immunoblotting. Goat anti-rabbit IgG conjugated to alkaline phosphatase or protein A conjugated to horseradish peroxidase was used as the second antibody. EPR spectra were recorded with a Bruker ER 200D apparatus equipped with a liquid N2 Dewar at 77 K. Instrument settings are detailed in the figure legends. Six R. sphaeroides mutants expressing His6-tagged cytochromebc1 complexes with single or double cysteine substitutions at various positions in the ISP neck region were generated to test the hypothesis that neck flexibility allows ISP head domain movement required for bc1 catalysis. The flexibility of the neck should decrease when a disulfide bond is formed between a pair of substituted cysteines. Of the six mutants, two, A42C and V44C, are single substitutions, in which Ala-42 or Val-44 is replaced with cysteine. The other four are double cysteine substitutions, PSA-CSC, ADV-CDC, VQA-CQC, and ADVQA-CDVQC, in which Pro40 and Ala42, Ala42 and Val44, Val44 and Ala46, or Ala42 and Ala46 are replaced with cysteines. A plate mating technique was used (22Pemberton J.M. Bowen A.R.S.G. J. Bacteriol. 1981; 147: 110-117Crossref PubMed Google Scholar) to transfer the pRKDfbcFmBC6HQ plasmid from E. coli S17 to R. sphaeroides BC17. The mating took place in less than 16 h on the LB/SIS plates. R. sphaeroides BC17 cells harboring pRKDfbcFmBC6HQ plasmid were selected by spreading the conjugated cell mixture on enriched Sistrom's plate containing tetracycline and kanamycin sulfate. It took 4 days for the A42C, V44C, ADVQA-CDVQC, and VQA-CQC mutant colonies to show up on the plate, the same time period as that required for complement colonies. However, it took about 7 days for the ADV-CDC and PSA-CSC mutant colonies to appear. This slower growth rate on the plates is an indication of zero or reduced bc1 activity in the virtual absence of environmental selection pressure. A similar phenomenon was observed with several cytochrome b mutants that had no bc1activity. 2H. Tian, S. White, L. Yu, and C-A. Yu, unpublished data. When mid-log phase, aerobically grown complement and mutant cells were inoculated into enriched Sistrom medium and subjected to anaerobic photosynthetic growth conditions, the A42C, V44C, VQA-CQC, and ADVQA-CDVQC mutants grow at a rate comparable with that of complement cells, the ADV-CDC mutant has a retarded (50%) growth rate, and PSA-CSC does not grow photosynthetically (TableI). Chromatophores from the A42C, V44C, and ADVQA-CDVQC mutant cells have cytochrome bc1complex activity comparable with that of the complement chromatophores. The VQA-CQC and ADV-CDC mutant chromatophores have, respectively, 77 and 68% of the bc1 complex activity found in complement chromatophores. ICM from the PSA-CSC mutant have no ubiquinol-cytochrome c reductase activity. This was expected, since bc1 complex is required for photosynthetic growth and this mutant does not grow photosynthetically.Table ICharacterization of ISP neck cysteine mutantsStrainsPosition of cysteine substitution(s)Photosynthetic growthEnzymatic activityaThe enzymatic activity is expressed as μmol of cytochrome c reduced/min/nmol of cytochrome b.Subunit compositionChromatophoreICMPurified complexChromatophore or ICMPurified complexComplementNone++b++, the growth rate is essentially the same as that of the complement cells.2.22.12.5FBCQcFBCQ indicates gene products of the fbcF (ISP) (F), fbcB (cytochrome b) (B), fbcC(cytochrome c1) (C), and fbcQ (subunit IV) (Q), respectively.FBCQA42CAla42++1.8—d—, sample is not available.2.8FBCQFBCQV44CVal44++1.9—2.6FBCQFBCQADVQA-CDVQCAla42, Ala46++1.92.00FBCQBCVQA-CQCVal44, Ala46++1.71.80FBCQBCPSA-CSCPro40, Ala42−e−, no photosynthetic growth within 4 days.000FBCQBCADV-CDCAla42, Ala44+1.50.30FBCQBCa The enzymatic activity is expressed as μmol of cytochrome c reduced/min/nmol of cytochrome b.b ++, the growth rate is essentially the same as that of the complement cells.c FBCQ indicates gene products of the fbcF (ISP) (F), fbcB (cytochrome b) (B), fbcC(cytochrome c1) (C), and fbcQ (subunit IV) (Q), respectively.d —, sample is not available.e −, no photosynthetic growth within 4 days. Open table in a new tab To determine whether the loss (or decrease) of the cytochromebc1 complex activity in the mutant membranes results from a lack of or improper assembly of ISP protein in the membrane, the amount of ISP and its EPR characteristics in mutant and complement membranes were compared. Western blot analysis with antibodies against R. sphaeroides cytochrome b, cytochrome c1, ISP, and subunit IV revealed that the amount of these four subunits in the six mutant membranes is the same as that in the complement membrane (Fig. 1, lanes 2–8). Absorption spectral analysis shows that the content of cytochrome b and c1/c2 in all of these mutant membranes is the same as that in complement membrane. These results indicate that the mutations did not affect the assembly of ISP protein into the membrane. The [2Fe-2S] cluster in all of these mutant membranes has an EPR spectrum identical to that observed in complement chromatophores, with resonance at gx = 1.80 and gy = 1.9 (Fig. 2). Thus the mutations did not change the microenvironment of the iron-sulfur cluster.Figure 2EPR spectra of the [2Fe-2S] cluster of the Rieske iron sulfur protein in mutant and complement membranes.Chromatophore membranes from the A42C, V44C, VQA-CQC, ADV-CDC, and ADVQA-CDVQC mutants and complement cells and ICM from the PSA-CSC mutant were incubated wit