Portal de Periódicos da CAPES

Constitutive and Interleukin-7- and Interleukin-15-Stimulated DNA Binding of STAT and Novel Factors in Cutaneous T Cell Lymphoma Cells

2001; Elsevier BV; Volume: 117; Issue: 3 Linguagem: Inglês

10.1046/j.0022-202x.2001.01436.x

1523-1747

Jian‐Zhong Qin, Jivko Kamarashev, Chun-Lei Zhang, R. Dummer, Günter Burg, Udo Döbbeling,

Cytokine Signaling Pathways and Interactions

On testing cutaneous T cell lymphoma cell lines and skin lesions, we found that the transcription factors STAT2, STAT3, STAT5, and STAT6 (STAT, signal transducer and activator of transcription) were present in the nuclei of these cells and that the binding to their specific DNA binding sites was stimulated by interleukin-7 and interleukin-15. DNA binding studies also revealed the presence of three additional DNA factors in cutaneous T cell lymphoma cells that bound to the same sequences and could also be stimulated by interleukin-7 and interleukin-15. One of these novel factors was also present in the adult T cell leukemia cell line Jurkat and malignant T cells from the blood of Sézary syndrome patients, but not in normal peripheral blood lymphocytes. It may therefore be a marker of T cell leukemia. It seems to interfere with the binding of STAT1 to the sis inducible element, suggesting that the DNA binding activity of STAT1 in cutaneous T cell lymphoma cells is disturbed. On testing cutaneous T cell lymphoma cell lines and skin lesions, we found that the transcription factors STAT2, STAT3, STAT5, and STAT6 (STAT, signal transducer and activator of transcription) were present in the nuclei of these cells and that the binding to their specific DNA binding sites was stimulated by interleukin-7 and interleukin-15. DNA binding studies also revealed the presence of three additional DNA factors in cutaneous T cell lymphoma cells that bound to the same sequences and could also be stimulated by interleukin-7 and interleukin-15. One of these novel factors was also present in the adult T cell leukemia cell line Jurkat and malignant T cells from the blood of Sézary syndrome patients, but not in normal peripheral blood lymphocytes. It may therefore be a marker of T cell leukemia. It seems to interfere with the binding of STAT1 to the sis inducible element, suggesting that the DNA binding activity of STAT1 in cutaneous T cell lymphoma cells is disturbed. electrophoretic mobility shift assay Janus kinase mycosis fungoides sis inducible element Sézary syndrome signal transducer and activator of transcription Cutaneous T cell lymphoma (CTCL) is a group of lymphoproliferative disorders of the skin (Burg et al., 1997Burg G. Kempf W. Häffner A.C. et al.Cutaneous Lymphomas.Curr Probl Dermatol. 1997; 9: 139-204Crossref Scopus (80) Google Scholar). The most frequent forms of CTCL are mycosis fungoides (MF) and its leukemic counterpart the Sézary syndrome (SS). MF usually progresses very slowly (over a period of 5–20 y) but leads mostly to death by systemic spread of CTCL tumors or immune disbalance and superinfections. In addition to generalized erythroderma, patients with SS also have malignant T cells in the blood. Their life expectancy is generally shorter (3 y) than that of patients who suffer from MF. Except in late stages of disease lymphocyte accumulation in CTCL remains restricted to the skin. This fact implies that CTCL cells may remain dependent on growth factors preferentially produced in the skin. Candidates for such factors are interleukin-7 (IL-7), which is produced by keratinocytes among other cell types (Dalloul et al., 1992Dalloul A. Laroche L. Bagot M. et al.Interleukin-7 is a growth factor for Sézary lymphoma cells.J Clin Invest. 1992; 90: 1054-1060Crossref PubMed Scopus (138) Google Scholar;Matsue et al., 1993Matsue H. Bergstresser P.R. Takashima A. Keratinocyte-derived IL-7 serves as a growth factor for dendritic epidermal T cells in mice.J Immunol. 1993; 151: 6012-6019PubMed Google Scholar), and IL-15, which is expressed in normal skin (Mohamadzadeh et al., 1995Mohamadzadeh M. Takashima A. Dougherty I. Knop J. Bergstresser P.R. Cruz P.D. Ultraviolet B radiation up-regulates the expression of IL-15 in human skin.J Immunol. 1995; 155: 4492-4496PubMed Google Scholar;Blauvelt et al., 1996Blauvelt A. Asada H. Klaus-Kovtun V. Altman D.J. Lucey D.R. Katz S.I. Interleukin-15 mRNA is expressed by human keratinocytes, Langerhans cells, and blood derived dendritic cells and is downregulated by ultraviolet B radiation.J Invest Dermatol. 1996; 106: 1047-1052Crossref PubMed Scopus (108) Google Scholar). Both IL-7 and IL-15 have been shown to increase the survival of freshly isolated CTCL cells in vitro (Döbbeling et al., 1998Döbbeling U. Dummer R. Laine E. Potoczna N. Qin J.Z. Burg G. IL-15 is an autocrine/paracrine viability factor for cutaneous T cell lymphoma cells.Blood. 1998; 92: 252-258PubMed Google Scholar). IL-15 is also produced by CTCL cells in the skin of patients (Döbbeling et al., 1998Döbbeling U. Dummer R. Laine E. Potoczna N. Qin J.Z. Burg G. IL-15 is an autocrine/paracrine viability factor for cutaneous T cell lymphoma cells.Blood. 1998; 92: 252-258PubMed Google Scholar), and increasing endogenous IL-15 production during tumor progression (Asadullah et al., 2000Asadullah K. Haeussler-Quade A. Gellrich S. et al.IL-15 and IL-16 overexpression in cutaneous T-cell lymphomas: stage-dependent increase in mycosis fungoides progression.Exp Dermatol. 2000; 9: 248-251https://doi.org/10.1034/j.1600-0625.2000.009004248.xCrossref PubMed Scopus (42) Google Scholar) may help CTCL cells to become independent of IL-15 produced in the cutaneous environment. IL-15 has been identified as a T cell growth stimulating cytokine produced by many cell types and tissues (Grabstein et al., 1994Grabstein K.H. Eisenman J. Shanebeck K. et al.Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor.Science. 1994; 264: 965-968Crossref PubMed Scopus (1284) Google Scholar). The receptors of IL-2, IL-7, and IL-15 are structurally related: the IL-15 receptor contains the β and γ chain of the IL-2 receptor and a recently identified specific α chain (Giri et al., 1994Giri J.G. Ahdieh M. Eisenman J. et al.Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15.EMBO J. 1994; 13: 2822-2830Crossref PubMed Scopus (946) Google Scholar;Giri et al., 1995Giri J.G. Kumaki S. Ahdieh M. et al.Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor.EMBO J. 1995; 14: 3654-3663Crossref PubMed Scopus (548) Google Scholar;Grabstein et al., 1994Grabstein K.H. Eisenman J. Shanebeck K. et al.Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor.Science. 1994; 264: 965-968Crossref PubMed Scopus (1284) Google Scholar). IL-15 could replace IL-2 in several systems (Giri et al., 1994Giri J.G. Ahdieh M. Eisenman J. et al.Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15.EMBO J. 1994; 13: 2822-2830Crossref PubMed Scopus (946) Google Scholar;Grabstein et al., 1994Grabstein K.H. Eisenman J. Shanebeck K. et al.Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor.Science. 1994; 264: 965-968Crossref PubMed Scopus (1284) Google Scholar;Armitage et al., 1995Armitage R.J. Macduff B.M. Eisenman J. Paxton R. Grabstein K.H. IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation.J Immunol. 1995; 154: 483-490PubMed Google Scholar), but mostly proved to be less effective than IL-2. The IL-7 high affinity receptor also contains the IL-2 receptor γ chain (seeNowak, 1993Nowak R. 'Bubble boy' paradox resolved.Science. 1993; 262 (1818): 1818Crossref PubMed Scopus (9) Google Scholar, for review). The IL-2 receptor β and γ chains interact with the tyrosine kinases Janus kinase 1 (Jak1) and Jak3 (Miyazaki et al., 1994Miyazaki T. Kawahara A. Fuji H. et al.Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits.Science. 1994; 266: 1045-1047Crossref PubMed Scopus (479) Google Scholar;Russell et al., 1994Russell S.M. Johnson J.A. Noguchi M. et al.Interaction of IL-2R beta and gamma c chains with Jak1 and Jak3: implications for XSCID XCID.Science. 1994; 266: 1042-1045Crossref PubMed Scopus (565) Google Scholar), which in turn activate the transcription factors STAT3 (signal transducer and activator of transcription 3) and STAT5 (Giri et al., 1994Giri J.G. Ahdieh M. Eisenman J. et al.Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15.EMBO J. 1994; 13: 2822-2830Crossref PubMed Scopus (946) Google Scholar;Nielsen et al., 1994Nielsen M. Svejgard A. Skov S. Odum N. Interleukin-2 induces tyrosine phosphorylation and nuclear translocation of STAT3 in human T lymphocytes.Eur J Immunol. 1994; 24: 3082-3086Crossref PubMed Scopus (65) Google Scholar;Fujii et al., 1995Fujii H. Nakagawa Y. Schindler U. Kawahara A. Mori H. Taniguchi T. Activation of STAT5 by interleukin 2 requires a carboxy-terminal region of the interleukin 2 receptor beta chain but is not essential for the proliferative signal transmission.Proc Natl Acad Sci USA. 1995; 92: 5482-5486Crossref PubMed Scopus (190) Google Scholar;Wakao et al., 1995Wakao H. Harada N. Kitamura T. Mui A.L.F. Miyajima A. Interleukin 2 and erythropoietin activate STAT5/MGF via distinct pathways.EMBO J. 1995; 14: 2527-2535Crossref PubMed Scopus (212) Google Scholar). The STAT family factors bind to DNA elements that mediate the effects of hormones and growth factors such as prolactin, platelet derived growth factor, erythropoietin, granulocyte macrophage colony stimulating factor, and interferons. As the IL-7 and IL-15 receptors contain one or two subunits that are also part of the IL-2 receptor, one may therefore expect that IL-7 and IL-15 may cause the same effects as IL-2 (Miyazaki et al., 1995Miyazaki T. Liu Z.J. Kawahara A. et al.Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc, and lck cooperate in hemapoietic cell proliferation.Cell. 1995; 81: 223-231Abstract Full Text PDF PubMed Scopus (344) Google Scholar). Recent findings do indeed point in this direction (Johnston et al., 1995Johnston J.A. Bacon C.M. Finbloom D.S. et al.Tyrosine phosphorylation and activation of STAT5, STAT3, and Janus kinases by interleukins 2 and 15.Proc Natl Acad Sci USA. 1995; 92: 8705-8709Crossref PubMed Scopus (325) Google Scholar;Schindler and Darnell, 1995Schindler C. Darnell J.E. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway.Annu Rev Biochem. 1995; 64: 621-651Crossref PubMed Scopus (1609) Google Scholar). It may also be possible, however, that the recently identified IL-15 receptor α subunit activates additional STAT factors. To study which STAT factors are activated by IL-7 and IL-15 we used the IL-7/IL-15 dependent CTCL cell line SeAx (Kaltoft et al., 1987Kaltoft K. Bisballe S. Rasmussen H.F. Thesstrup-Pedersen K. Thomsen K. Sterry W. A continuous T-cell line from a patient with Sézary syndrome.Arch Dermatol Res. 1987; 279: 293-298Crossref PubMed Scopus (97) Google Scholar) as a test system. These cells are able to survive 4–6 d in the absence of both cytokines. To determine the effects of IL-7 and IL-15, the cells were kept for 3 d in the absence of both interleukins and after this time the cells were stimulated with IL-7 or IL-15 or left unstimulated. This system allows us to distinguish the effects of IL-2, IL-7, and IL-15 and to detect irregularities of interleukin signal transduction in CTCL cells. The cell line HUT 78 (SS) was obtained from the European Collection of Animal Cell Cultures. The cell lines MyLa 2059 (MF) and SeAx (SS) were kind gifts of Dr. Keld Kaltoft, University of Aarhus, Denmark. HUT 78, MyLa 2059, and Sézary cells from patients at our department were grown in HEPES-buffered RPMI 1640 medium with 2 mM glutamine, supplemented with 10% fetal bovine serum (FBS), 0.25 mg per ml amphotericin B, 100 U penicillin G, 100 U streptomycin, and 1 mM pyruvate. SeAx cells were grown under the same conditions with the exception that 10% human serum instead of 10% FBS was used. The concentrations of the cytokines were as follows: IL-2, 50 ng per ml (100 U); IL-7, 5 ng per ml (10 U); IL-15, 10 ng per ml (10 U). Skin biopsies and blood samples were taken primarily for diagnostic purposes with informed consent of the patients. The specimens used were surplus material available after all the routine diagnostic procedures. The assignment to a certain stage was done according to the recommendations of the EORTC Cutaneous Lymphoma Project Group. Sézary cells from patients' blood were isolated by Ficoll gradient centrifugation and sorted by two-color fluorescence-activated cell sorter using antibodies against CD 4 and the vβ region of their T cell receptor (Dummer et al., 1996Dummer R. Heald P.W. Nestle F.O. et al.Sézary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-g receptor β-chain).Blood. 1996; 88: 1383-1389PubMed Google Scholar). EMSA were performed according toBarberis et al., 1987Barberis A. Superti-Furga G. Busslinger M. Mutually exclusive interaction of the CCAAT-binding factor and of a displacement protein with overlapping sequences of a histone gene promoter.Cell. 1987; 50: 347-359Abstract Full Text PDF PubMed Scopus (258) Google Scholar. Double stranded γ-32P ATP labeled oligonucleotides (30,000 cpm) containing the STAT factor binding motifs of the sis inducible element (SIE) and the IL-4 responsive element (IL-4RE) were incubated with 3 µg of nuclear extracts of the investigated cells in binding buffer consisting of 10 mM HEPES pH 7.9, 60 mM KCl, 4% Ficoll, 1 mM dithiothreitol, and 1 mM ethylenediamine tetraacetic acid (EDTA) pH 8.0. Two micrograms of poly[d(I-C)] (poly deoxy-inosinic-deoxy-citidylic acid) were used as competitor for unspecific DNA binding activities. The total volume of the reaction was 30 µl. In the "supershift" experiments, 2–4 µg of the corresponding antibody (Santa Cruz Biotechnology, TransCruz gel supershift reagent) were added. Nuclear extracts were prepared according toGerber et al., 1992Gerber H.P. Georgiev O. Harshman K. Schaffner W. In vitro transcription complementation assay with mini extracts of transiently transfected COS-1 cells.Nucl Acids Res. 1992; 20: 5855-5856Crossref PubMed Scopus (11) Google Scholar. The reaction mixture was incubated for 30 min at 4°C and then loaded on a 4% native polyacrylamide gel (0.25 × Tris borate EDTA buffer). The electrophoresis was run at 4°C for 8–10 h in 0.25 × TBE buffer at 10 V per cm. The oligonucleotide sequences for the SIE and IL-4RE were 5′ GTGCATTTCCCGTAAATCTTGTCTACA 3′ and 5′ GAGCCTGATTTCCCCGAAATGATGAGC 3′, respectively. The oligonucleotides were synthesized by Microsynth (Balgach, Switzerland). For Western blotting 15–30 µg protein of nuclear extracts or 30–60 µg protein of cytoplasmatic extracts were loaded on a 7.5%-9% sodium dodecyl sulfate polyacrylamide gel and separated by polyacrylamide gel electrophoresis. The percentage of polyacrylamide used depended on the molecular weight of the protein to be investigated. The proteins were transferred to a nitrocellulose filter using a Mini Trans Blot Cell (Bio-Rad) following the instructions of the supplier. Unspecific antibody binding sites were blocked by incubation of the filter overnight at 4°C in Tris-buffered saline (TBS), pH 8.0, 0.3% Tween 20, and 2% milk powder. The filter was incubated with the corresponding first antibody (Santa Cruz Biotechnology, 1:1000 dilution) for 4 h at room temperature in TBS, 0.3% Tween 20, and 1% milk powder. The incubation with the second antibody (antirabbit, Santa Cruz Biotechnology, 1:1000 dilution) was done in TBS, 0.3% Tween 20 for 4 h at room temperature. The signal was detected by incubation with BM purple AP substrate (Roche Biochemicals) following the instructions of the supplier. On studying the SIE oligonucleotide for STAT factors in nuclear extracts from SeAx cells by EMSA we detected two DNA-protein complexes CS1 and CS2 (CS, complex with SIE), which were stimulated by IL-2, IL-7, and IL-15 Figure 1a. The stimulation occurred within 30 min, indicating that already present transcription factors were directly activated and that no protein synthesis was necessary. To determine whether these complexes contain STAT proteins, we added specific antibodies directed against STAT1-STAT6 to the DNA binding reaction. The recognition of a DNA binding protein either causes the disruption of the protein-DNA complex, when the antibody is directed at the DNA binding domain of the tested protein, or creates a supershift complex, consisting of the DNA oligonucleotide, DNA binding protein, and the antibody. These supershift complexes migrate even more slowly than the DNA-protein complexes. Testing the complexes in SeAx cells with antibodies against STAT1–STAT 6, we found that CS2 was disrupted by an antibody against STAT3, indicating that this complex contained STAT3 Figure 1b. CS1 was not significantly affected by any STAT antibody. In some experiments we found a slight reduction of CS1 by STAT1 antibodies, but the result was markedly weaker than the supershift that we obtained with the SIE and interferon-γ stimulated peripheral blood lymphocytes from normal donors (data not shown). The nuclear extracts from the HUT 78 and MyLa cell lines also contained CS1 and CS2. CS1 is probably specific for leukemia T cell lines, as it was found in the acute T cell leukemia cell line Jurkat, but not in hepatoma (HepG2), breast cancer (MCF-7), or melanoma cells (J.-Z.Q. and U.D., unpublished data). We therefore called the CS1 forming factor SBPT (SIE binding protein in T cell lymphoma/leukemia). Also in HUT 78 and MyLa 2059 cells CS2 was disrupted by a STAT3 antibody, and CS1 behaved as in SeAx cells Figure 1c. In MyLa 2059 cells an additional complex (CSM) was found, which could be disrupted by antibodies against STAT2 and STAT5 Figure 1d. In later experiments we found that CSM could also be visualized when higher amounts of nuclear extracts of HUT 78 and SeAx were loaded (not shown). The signal of CS2 in MyLa cells was somewhat reduced by antibodies against STAT4 and STAT5. As we found no DNA binding of STAT4 on a STAT4-specific oligo (see below), we interpret this signal reduction as a cross-reaction between STAT3 and STAT4 antibodies. The same explanation may also be true for the reduction of the CS2 signal by the STAT5 antibody, as STAT5 is present in the CSM complex. The presence of low amounts of STAT5 in CS2 cannot be formally excluded, however. In MyLa 2059 and HUT 78 the stimulating effect of IL-2, IL-7, and IL-15 was much weaker, which was probably due to the high basal levels of the SIE binding activities in these cell lines (data not shown). The complexes below CS2 were not always reproducible and may be due to sequence-unspecific DNA binding proteins. As not all STAT factors bind to the same sequence we tested another sequence, which is known to bind STAT factors: the IL-4RE (Hou et al., 1994Hou J. Schindler U. Henzel W.J. Ho C.H. Brasseur M. McKnight S.L. An interleukin-4-induced transcription factor.IL-4 Stat Sci. 1994; 265: 1701-1706Google Scholar). Using the IL-4RE and nuclear extracts from SeAx cells we found two main complexes, C-IL-4RE 1 and C-IL-4RE 2. IL-7 and IL-15 increased the DNA binding of both complexes. In normal peripheral blood lymphocytes (Figure 2b, lane 1) IL-15 induced another complex, which perhaps is also present in the CTCL cell lines in low amounts. Supershift experiments with antibodies against STAT1–STAT6 Figure 2b showed that C-IL-4RE 2 was totally supershifted by an antibody against STAT5 and partially supershifted by antibodies against STAT2 and STAT6. From this result one can conclude that C-IL-4RE 2 consists mostly of STAT5 and a lower amount of STAT2 and STAT6. The presence of several supershift bands suggests that C-IL-4RE 2 consists of different homodimers and heterodimers of these molecules. C-IL-4RE 1 showed no supershift with any STAT antibody and only a weak reduction of the signal was observed when the STAT1 antibody was used. In contrast to the other factors the C-IL-4RE 1 forming factor could also bind to mutated IL-4RE, which lacked the characteristic thymidine triplet (J.-Z.Q. and U.D., unpublished data). In HUT 78 and MyLa 2059 cells C-IL-4RE 2 was also present and reacted with antibodies against STAT2, STAT5, and STAT6 Figure 2c, d. Using the so-called IL-4 gamma interferon activation sequence by which STAT 4 has been identified, we observed no DNA binding of STAT4, and only a weak interaction of STAT2, STAT5, and STAT6 with this oligo could be found (data not shown). To see whether the STAT factors that we found in the supershift experiments were intact and of the expected size we performed Western blots using nuclear extracts of the three CTCL cell lines. All the STAT factors seen in the supershift experiments (STAT2, STAT3, STAT5, STAT6) were detected by Western blotting Figure 3 in all three cell lines. STAT1 and STAT4, which showed no DNA binding in EMSA, were also tested and surprisingly STAT1 was detected in all three nuclear extracts Figure 3a. When we used the gamma interferon activating sequence in supershift experiments, however, a STAT1-specific antibody revealed DNA binding of STAT1 to these sequences (U.D., J.-Z.Q., and C.-L.Z., unpublished data). The only size difference of STAT proteins in the CTCL cell lines was seen for STAT2. In HUT 78 and MyLa 2059 cells a STAT2 form of 105 kDa was prevalent, whereas in SeAx cells a 120 kDa form dominated Figure 3b. In all the three cell lines we found the wild-type STAT3 protein. Some preparations of the K-15 and C-20 antibodies detected proteins of 120–130 kDa Figure 3c and 60 kDa (not shown); however, in contrast to the STAT3 wt signal these bands were not always reproducible. No consistent signal for a larger mutant STAT3 protein in MyLa 2059 cells that has been previously reported byNielsen et al., 1994Nielsen M. Svejgard A. Skov S. Odum N. Interleukin-2 induces tyrosine phosphorylation and nuclear translocation of STAT3 in human T lymphocytes.Eur J Immunol. 1994; 24: 3082-3086Crossref PubMed Scopus (65) Google Scholar was detected, although we used the same two antibodies. No signal of the expected size of 88 kDa was detected for STAT4 Figure 3d. The signals seen in this blot may derive from mutant or STAT4-related proteins from which only expressed sequence tags (EST) or partial cDNAs have been cloned. Both STAT5 proteins, STAT5a and STAT5b, were present in all three cell lines Figure 3e. In general, the concentrations of STAT factors were highest in MyLa 2059 cells and lowest in SeAx cells when equal amounts of protein were loaded. When we tested the skin lesions of CTCL patients for the presence of STAT1, STAT2, STAT3, STAT5, and STAT6, we found cytoplasmic staining in the malignant T cells of all six MF and six SS patients tested. The expression and distribution of STAT1, STAT2, STAT3, and STAT6 were nearly identical and correspond to the four samples given in Figure 4 a, b, c, d for STAT3. The staining was predominant in the cytoplasm, but nuclear staining was also detected in skin lesions of all tested CTCL patients. In one half of the patients we observed significant nuclear staining in many malignant cells Figure 4c, d, whereas in the other half only a few cells showed nuclear staining Figure 4a, b. There was no strict correlation between nuclear localization and disease progression. All samples tested by a STAT5 antibody showed strong STAT5 staining in the nucleus Figure 4e, f, g, h. Strong nuclear STAT5 staining was already evident in early stages (Figure 4b, top left) and did not increase significantly in later stages. As no antibodies against SBPT are available and no functional nuclear extracts from skin biopsy material can be prepared, we investigated nuclear extracts of malignant T cells freshly isolated from the blood of patients with SS for the presence of SBPT. EMSA showed that a complex migrating at the same position as CS1 in the CTCL cell lines was present in all seven patients tested, whereas CS2, which may represent STAT3, was present in only one patient Figure 5a. In one patient a very strong CS1 signal was found - possibly two different complexes migrating closely together composed this signal. As in SeAx cells IL-7 and IL-15 could stimulate the CS1 complex in malignant T cells of patients Figure 5b. This complex also did not react significantly with STAT antibodies. Due to this behavior and the common migration behavior on the gel we suppose that CS1 is the same in all the tested samples and represents SBPT. As SBPT is absent in the peripheral blood lymphocytes of healthy donors we suppose that it is indicative for CTCL cells in the blood. When we performed corresponding experiments with the IL-4RE we found no binding of STATs to this DNA sequence (J.-Z.Q. and U.D., unpublished data). Our results show that the STAT factors 1, 2, 3, 5, and 6 are constitutively active in CTCL cell lines and that they can be stimulated by IL-7 and IL-15 in SeAx cells. This is also true for the presumed novel factors that bind to the SIE and the IL-4RE. The five STATs are also present in the nuclei of malignant T cells in CTCL skin lesions, where STAT5, as in the cell lines, seems to be the most prominent factor. The binding of STAT1 to the SIE may be inhibited by the novel SIE binding factor SBPT. With respect to constitutive STAT activities, CTCL cells resemble leukemic cells from acute myeloid leukemia, Burkitt's lymphoma, and adult T cell leukemia patients (Gouilleux-Gruart et al., 1996Gouilleux-Gruart V. Gouilleux F. Dasaint C. et al.STAT-related transcription factors are constitutively activated in peripheral blood cells from acute leukemia patients.Blood. 1996; 87: 1692-1697Crossref PubMed Google Scholar;Weber-Nordt et al., 1996Weber-Nordt R.M. Egen C. Wehinger J. Ludwig W. Gouilleux-Gruart V. Mertelsmann R. Fink J. Constitutive action of STAT proteins in primary lymphoid and myeloid leukemia cells and in Epstein-Barr virus (EBV) -related lymphoma cell lines.Blood. 1996; 88: 809-816Crossref PubMed Google Scholar; Takemoto et al., 1997Takemoto S. Mulloy J.C. Cereseto A. et al.Proliferation of adult T cell leukemia/lymphoma cells is associated with the constitutive activation of JAK/STAT proteins.Proc Natl Acad Sci USA. 1997; 94: 13897-13902Crossref PubMed Scopus (225) Google Scholar). In general the unstimulated STAT factor binding is higher in the IL-7/IL-15 independent cell lines HUT 78 and MyLa 2059 than in the IL-7/IL-15 dependent SeAx cells. IL-7 and IL-15 increase the DNA binding of STAT and the novel STAT motifs binding factors in SeAx cells and thus compensate for the lower constitutive activity of these factors in this cell line. As SeAx cells survive in the absence of IL-7 or IL-15 only for 4–6 d, a certain threshold level of STAT factor activities may be necessary for the survival of these cells. Due to their high constitutive DNA binding activities, IL-7 and IL-15 increase the DNA binding of STATs in HUT 78 and MyLa 2059 cells only weakly (data not shown). Despite the inactivity of STATs, SBPT is also constitutively present in the nuclei of unstimulated malignant T cells of SS patients. As the DNA binding activity of this protein is not detected in the blood of normal donors, it may play a role for the cancerogenesis of CTCL. SBPT may be typical for leukemia T cell lines, as it was found in the acute T cell leukemia cell line Jurkat, but not in peripheral blood lymphocytes of heathy donors. It was also absent in hepatoma (HepG2), cervix carcinoma (HeLa), breast cancer (MCF-7), and melanoma cells (J.-Z.Q. and U.D., unpublished data). IL-7 and IL-15 stimulated in SeAx cells a broader range of STAT and novel STAT motifs binding factors than has been reported for other cell lines (Schindler and Darnell, 1995Schindler C. Darnell J.E. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway.Annu Rev Biochem. 1995; 64: 621-651Crossref PubMed Scopus (1609) Google Scholar;Leonard and O'Shea, 1998Leonard W.J. O'Shea J.J. Jaks and STATs: biological implications.Annu Rev Immunol. 1998; 16: 293-322Crossref PubMed Scopus (1394) Google Scholar). Our results indicate that the specificity of IL-7 and IL-15 signaling to STAT factors has been lost in CTCL cell lines: even STAT2, a factor that is selectively induced by interferon-α, was stimulated by these two interleukins. This loss of specificity and the constitutive binding activity of STAT factors cannot be explained by a constitutive stimulation through the IL-7 and IL-15 regulated tyrosine kinases Jak1 and Jak3 (Haque et al., 1997Haque S.J. Wu Q. Kammer W. et al.Receptor-associated constitutive protein tyrosine phosphatase activity controls the kinase function of JAK1.Proc Natl Acad Sci USA. 1997; 94: 8563-8568Crossref PubMed Scopus (63) Google Scholar) alone, as they should only stimulate STAT3 and STAT5. Other tyrosine kinases that have been reported to stimulate STAT DNA binding, such as c-Src (Yu et al., 1995Yu C.L. Meyer D.J. Campbell G.S. Larner A.C. Carter-Su C. Schwartz J. Jove R. Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein.Science. 1995; 269: 81-83Crossref PubMed Scopus (804) Google Scholar;Olayioye et al., 1999Olayioye M.A. Beuvink I. Horsch K. Daly J.M. Hynes N.E. ErbB receptor induced activation of STAT transcription factors by Src tyrosine kinases.J Biol Chem. 1999; 274: 17209-17218Crossref PubMed Scopus (305) Google Scholar) or Bmx (Saharinen et al., 1997Saharinen P. Ekman N. Sarvas K. Parker P. Alitalo K. Silvennoinen O. The Bmx tyrosine kinase induces activation of the STAT signaling pathway, which is specifically inhibited by protein kinase Cdelta.Blood. 1997; 90: 4341-4353Crossref PubMed Google Scholar;Wen et al., 1999Wen X. Lin H.H. Shih H.M. Kung H.J. Ann D.K. Kinase activation of the non-receptor tyrosine kinase Etk/Bmx alone is sufficient to transactivate STAT-mediated gene expression in salivary and lung epithelial cells.J Biol Chem. 1999; 274: 38204-38210Crossref PubMed Scopus (61) Google Scholar), may also be involved in the constitutive activation of STATs in CTCL cells. The constitutive activities of STATs may be due to the functional loss of STAT inhibitors. Recently a family of STAT inhibitors SOCS1-SOCS3 (suppressor of cytokine signaling), which is involved in a feedback regulation of STAT activation, has been identified (Endo et al., 1997Endo T.A. Masuhara M. Yokouchi M. et al.A new protein containing an SH2 domain that inhibits JAK kinases.Nature. 1997; 387: 921-924https://doi.org/10.1038/43213Crossref PubMed Scopus (1191) Google Scholar;Naka et al., 1997Naka T. Narazaki M. Hirata M. et al.Structure and function of a new STAT-induced STAT inhibitor.Nature. 1997; 387: 924-928https://doi.org/10.1038/43219Crossref PubMed Scopus (1102) Google Scholar;Starr et al., 1997Starr R. Wilson T.A. Viney E.M. et al.A family of cytokine-inducible inhibitors of signalling.Nature. 1997; 387: 917-921https://doi.org/10.1038/43206Crossref PubMed Scopus (1736) Google Scholar). A failure of these regulators could cause the perpetuation of a cytokine signal. Indeed, it was found that CTCL cell lines lack functioning SOCS3 proteins (Brender et al., 2001Brender C. Nielsen M. Kaltoft K. et al.STAT3-mediated constitutive expression of SOCS-3 in cutaneous T cell lymphoma.Blood. 2001; 97: 1056-1062Crossref PubMed Scopus (112) Google Scholar). The high concentrations of some STATs, especially STAT5, in the cytoplasm of CTCL cells in skin lesions suggest that over-expressed STATs could also titrate STAT inhibitors and that therefore a fraction of these proteins can migrate into the nucleus. The Western blots detected the two known forms of STAT2 (p105 and p120). For STAT3 our findings with MyLa 2059 cells differ from those ofNielsen et al., 1997Nielsen M. Kaltoft K. Nordahl M. et al.Constitutive activation of a slowly migrating isoform of STAT3 in mycosis fungoides: tyrpphostin AG490 inhibits STAT3 activation and growth of mycosis fungoides tumor cell lines.Proc Natl Acad Sci USA. 1997; 94: 6764-6769Crossref PubMed Scopus (205) Google Scholar, who detected a slowly migrating form of STAT3 but no STAT2 and STAT5 binding. Their findings may be due to the long culture time of this cell line. STAT3 is constitutively present in all three cell lines and in the malignant T cells of one patient. The presence of STAT3 in the malignant T cells of at least one patient suggests that the activation of STAT3 is a late but normally occurring event during the progression of CTCL. It may be that Sézary cells get the ability to proliferate in very late stages, as we found expression of the proliferation-promoting c-myc and junD genes in Sézary cells of patients with very high numbers of leukemic T cells (Qin et al., 1999Qin J.Z. Dummer R. Burg G. Döbbeling U. Constitutive and IL-7/ IL-15 stimulated DNA-binding of Myc, Jun, and novel Myc-like proteins in cutaneous T cell lymphoma (CTCL) cells.Blood. 1999; 93: 260-267PubMed Google Scholar). No STAT4 protein of the expected size and DNA binding could be detected in nuclear extracts of CTCL cells. The absence of this protein or its inability to become activated may explain why IL-12 induces no STAT4-mediated gene expression in CTCL cells (Showe et al., 1999Showe L.C. Fox F.E. Williams D. Au K. Niu Z. Rook A.H. Depressed IL-12 mediated signal transduction in T cells from patients with Sézary syndrome is associated with the absence of IL-12 receptor beta 2 mRNA and highly reduced levels of STAT4.J Immunol. 1999; 163: 4073-4079PubMed Google Scholar). We detected no DNA binding of STAT proteins in the leukemic T cells of SS patients.Zhang et al., 1996Zhang Q. Nowak I. Vonderheid E.C. et al.Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin 2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sézary syndrome.Proc Natl Acad Sci USA. 1996; 93: 9148-9153Crossref PubMed Scopus (194) Google Scholar reported phosphorylated STAT5 proteins in 70% of their SS patients; however, they did not analyze their DNA binding activities. Thus it may be possible that STAT5 needs additional serine phosphorylation for effective binding to the IL-4RE. CTCL cells are a good source of new IL-7 and IL-15 stimulated transcription factors as, besides SBPT, we have already discovered two novel E-box binding proteins in these cells (Qin et al., 1999Qin J.Z. Dummer R. Burg G. Döbbeling U. Constitutive and IL-7/ IL-15 stimulated DNA-binding of Myc, Jun, and novel Myc-like proteins in cutaneous T cell lymphoma (CTCL) cells.Blood. 1999; 93: 260-267PubMed Google Scholar). The stimulation of the DNA binding of these factors is specific, as it occurs within less than 30 min and is therefore not due to de novo protein synthesis; it can occur during a general recovery from interleukin starvation of the cells after the addition of IL-7 or IL-15. The specificity of the effects is also underscored by the fact that the transcription factors c-Myc, Max, and OCT-1 (Qin et al., 1999Qin J.Z. Dummer R. Burg G. Döbbeling U. Constitutive and IL-7/ IL-15 stimulated DNA-binding of Myc, Jun, and novel Myc-like proteins in cutaneous T cell lymphoma (CTCL) cells.Blood. 1999; 93: 260-267PubMed Google Scholar) are not stimulated by these two interleukins. IL-7, IL-15, and the STATs may play an important role for the survival of CTCL cells, as we observed that they increased the binding of STAT2, STAT5, STAT6, and c-Myb to their binding sites in the promoter of the bcl-2 gene and consequently increased the amount of Bcl-2 protein in CTCL cells (Qin et al., 2001Qin J.Z. Zhang C.L. Kamavashev J. Dummer R. Burg G. Döbbeling U. IL-7 and IL-15 regulate the expression of the bcl-2 and c-myb genes in cutaneous T cell lymphoma (CTCL) cells.Blood. 2001; 98 (in press)Crossref PubMed Scopus (98) Google Scholar). CTCL cells may gain IL-7 and IL-15 independence when signal transduction molecules like tyrosine kinases mutate to constitutively active enzymes. The authors would like to thank Dr. Keld Kaltoft for the generous gift of the MyLa 2059 and SeAx cell lines and M. Johnson and M. Bär for the preparation of the photographs. This work was supported by the Swiss Cancer League (grant KFS 275–1-1996 to G.B.), the Swiss National Science Foundation (grant 3100-43244.95/1) to G.B., the United Bank of Switzerland (UBS), and the Kanton of Zürich.