Histamine Antagonizes Tumor Necrosis Factor (TNF) Signaling by Stimulating TNF Receptor Shedding from the Cell Surface and Golgi Storage Pool
2003; Elsevier BV; Volume: 278; Issue: 24 Linguagem: Inglês
10.1074/jbc.m212662200
ISSN1083-351X
AutoresJun Wang, Rafia S. Al‐Lamki, Hui Zhang, Nancy C. Kirkiles-Smith, Mary Lou Gaeta, S Thiru, Jordan S. Pober, John R. Bradley,
Tópico(s)Lipid Membrane Structure and Behavior
ResumoTumor necrosis factor (TNF) activates pro-inflammatory functions of vascular endothelial cells (EC) through binding to receptor type 1 (TNFR1) molecules expressed on the cell surface. The majority of TNFR1 molecules are localized to the Golgi apparatus. Soluble forms of TNFR1 (as well as of TNFR2) can be shed from the EC surface and inhibit TNF actions. The relationships among cell surface, Golgi-associated, and shed forms of TNFR1 are unclear. Here we report that histamine causes transient loss of surface TNFR1, TNFR1 shedding, and mobilization of TNFR1 molecules from the Golgi in cultured human EC. The Golgi pool of TNFR1 serves both to replenish cell surface receptors and as a source of shed receptor. Histamine-induced shedding is blocked by TNF-α protease inhibitor, an inhibitor of TNF-α-converting enzyme, and through the H1 receptor via a MEK-1/p42 and p44 mitogen-activated protein kinase pathway. Cultured EC with histamine-induced surface receptor loss become transiently refractory to TNF. Histamine injection into human skin engrafted on immunodeficient mice similarly caused shedding of TNFR1 and diminished TNF-mediated induction of endothelial adhesion molecules. These results both clarify relationships among TNFR1 populations and reveal a novel anti-inflammatory activity of histamine. Tumor necrosis factor (TNF) activates pro-inflammatory functions of vascular endothelial cells (EC) through binding to receptor type 1 (TNFR1) molecules expressed on the cell surface. The majority of TNFR1 molecules are localized to the Golgi apparatus. Soluble forms of TNFR1 (as well as of TNFR2) can be shed from the EC surface and inhibit TNF actions. The relationships among cell surface, Golgi-associated, and shed forms of TNFR1 are unclear. Here we report that histamine causes transient loss of surface TNFR1, TNFR1 shedding, and mobilization of TNFR1 molecules from the Golgi in cultured human EC. The Golgi pool of TNFR1 serves both to replenish cell surface receptors and as a source of shed receptor. Histamine-induced shedding is blocked by TNF-α protease inhibitor, an inhibitor of TNF-α-converting enzyme, and through the H1 receptor via a MEK-1/p42 and p44 mitogen-activated protein kinase pathway. Cultured EC with histamine-induced surface receptor loss become transiently refractory to TNF. Histamine injection into human skin engrafted on immunodeficient mice similarly caused shedding of TNFR1 and diminished TNF-mediated induction of endothelial adhesion molecules. These results both clarify relationships among TNFR1 populations and reveal a novel anti-inflammatory activity of histamine. The immunological and inflammatory capacities of vascular endothelial cells (EC) 1The abbreviations used are: EC, endothelial cells; TNF, tumor necrosis factor; TNFR, tumor necrosis factor receptor; TACE, TNF-α-converting enzyme; MAP, mitogen-activated protein; MEK, MAP kinase/extracellular signal-regulated kinase kinase; PKC, protein kinase C; FACS, fluorescence-activated cell sorter; HUVEC, human umbilical vein EC; PMA, phorbol 12-myristate 13-acetate; PBS, phosphate-buffered saline; FCS, fetal calf serum; TBS, Tris-buffered saline; BSA, bovine serum albumin; RT, reverse transcriptase; gfp, green fluorescent protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IKK, IκB kinase; ELISA, enzyme-linked immunosorbent assay; IL, interleukin; PIPES, 1,4-piperazinediethanesulfonic acid; CT, threshold cycle; LPR, late phase reaction; TAPI, TNF-α protease inhibitor; l-NMMA, NG-monomethyl-l-arginine. are activated in response to binding of homotrimeric TNF with cell surface receptors of 55 (TNFR1 or CD120a) or 75 (TNFR2 or CD 120b) kDa (1Madge L.A. Pober J.S. Exp. Mol. Pathol. 2001; 70: 317-325Crossref PubMed Scopus (263) Google Scholar). TNFR1 is the predominant receptor involved in new EC gene expression, although TNFR2 may increase the sensitivity of EC to TNF (2Slowik M.R. De Luca L.G. Fiers W. Pober J.S. Am. J. Pathol. 1993; 143: 1724-1730PubMed Google Scholar). New gene transcription results from activation of parallel signaling pathways involving several protein kinases, notably IκB kinase (IKK), various MAP kinases (including c-Jun N-terminal kinase, p42/44 MAP kinase and p38 MAP kinase), and protein kinase B (also known as Akt) (1Madge L.A. Pober J.S. Exp. Mol. Pathol. 2001; 70: 317-325Crossref PubMed Scopus (263) Google Scholar). IKK is central to the TNF activation response because this kinase uniquely phosphorylates IκB proteins, such as IκBα, triggering their degradation and thereby releasing sequestered transcription factor, NFκB (3Ledgerwood E.C. Pober J.S. Bradley J.R. Lab. Invest. 1999; 79: 1041-1050PubMed Google Scholar). NFκB is essential for the transcription of almost all of the pro-inflammatory gene products induced by TNF. IKK activation through TNFR1 is initiated by recruitment of the adaptor protein TNF receptor-associated death domain-containing protein to the cytoplasmic death domain of the ligand-occupied receptor molecule. Although the majority of TNFR1 molecules are located within the Golgi apparatus, TNF receptor-associated death domain associates with surface-expressed but not Golgi-associated receptors (4Bradley J.R. Thiru S. Pober J.S. Am. J. Pathol. 1995; 146: 27-32PubMed Google Scholar, 5Jones S.J. Ledgerwood E.C. Prins J.B. Galbraith J. Johnson D.R. Pober J.S. Bradley J.R. J. Immunol. 1999; 162: 1042-1048PubMed Google Scholar). The significance of the Golgi pool of TNFR1 molecules is unclear. One hypothesis is that it may act as a reservoir to increase surface receptor expression density, thereby sensitizing EC to the actions of TNF. There is precedence for this idea in smooth muscle cells, in which the TNF receptor family member Fas localizes predominantly to the Golgi, from where it can be translocated to the cell surface, thereby sensitizing cells to Fas ligand-induced killing (6Bennett M. Macdonald K. Chan S.W. Luzio J.P. Simari R. Weissberg P. Science. 1998; 282: 290-293Crossref PubMed Scopus (654) Google Scholar). Both types of TNF receptors can be released from the cell surface by the actions of a metalloproteinase called TNF-α-converting enzyme (TACE) (7Reddy P. Slack J.L. Davis R. Cerretti D.P. Kozlosky C.J. Blanton R.A. Shows D. Peschon J.J. Black R.A. J. Biol. Chem. 2000; 275: 14608-14614Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar). The shed extracellular domains of the receptors are soluble in water and are referred to as sTNFR1 or sTNFR2 (8Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (562) Google Scholar). Receptor shedding, which can reduce the surface expression of TNFR1 and TNFR2, may desensitize cells to TNF actions. Additionally, because TNFRs maintain their ability to bind ligand, they may serve as physiological neutralizing agents for TNF (9Van Zee K.J. Kohno T. Fischer E. Rock C.S. Moldawer L.L. Lowry S.F. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4845-4849Crossref PubMed Scopus (785) Google Scholar, 10Hale K.K. Smith C.G. Baker S.L. Vanderslice R.W. Squires C.H. Gleason T.M. Tucker K.K. Kohno T. Russell D.A. Cytokine. 1995; 7: 26-38Crossref PubMed Scopus (102) Google Scholar), further dampening inflammatory responses. This idea is supported by the observation that patients with structural mutations in TNFR1 that prevent shedding by TACE are hypersensitive to TNF (11Galon J. Aksentijevich I. McDermott M.F. O'Shea J.J. Kastner D.L. Curr. Opin. Immunol. 2000; 12: 479-486Crossref PubMed Scopus (233) Google Scholar). Thus a second potential function of the Golgi pool of TNFR1 molecules is to serve as a reservoir for sTNFR1, reducing EC responses. TACE, which was initially identified as pro-inflammatory because of its role in TNF secretion (12Black R.A. Rauch C.T. Kozlosky C.J. Peschon J.J. Slack J.L. Wolfson M.F. Castner B.J. Stocking K.L. Reddy P. Srinivasan S. Nelson N. Boiani N. Schooley K.A. Gerhart M. Davis R. Fitzner J.N. Johnson R.S. Paxton R.J. March C.J. Cerretti D.P. Nature. 1997; 385: 729-733Crossref PubMed Scopus (2728) Google Scholar, 13Moss M.L. Jin S.L. Milla M.E. Bickett D.M. Burkhart W. Carter H.L. Chen W.J. Clay W.C. Didsbury J.R. Hassler D. Hoffman C.R. Kost T.A. Lambert M.H. Leesnitzer M.A. McCauley P. McGeehan G. Mitchell J. Moyer M. Pahel G. Rocque W. Overton L.K. Schoenen F. Seaton T. Su J.L. Becherer J.D. Nature. 1997; 385: 733-736Crossref PubMed Scopus (1490) Google Scholar), may be either pro- or anti-inflammatory depending on whether it acts on an effector (e.g. macrophage) or target (e.g. endothelial) cell, releasing ligand or receptors, respectively. Pharmacological studies have suggested that TACE activity in cells may be regulated by several mechanisms. For example, TNFR shedding in many cell types can be initiated by phorbol esters, implicating a role for PKC, the target of phorbol ester action (7Reddy P. Slack J.L. Davis R. Cerretti D.P. Kozlosky C.J. Blanton R.A. Shows D. Peschon J.J. Black R.A. J. Biol. Chem. 2000; 275: 14608-14614Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 14Hwang C. Gatanaga M. Granger G.A. Gatanaga T. J. Immunol. 1993; 151: 5631-5638PubMed Google Scholar, 15Merlos-Suarez A. Arribas J. Biochem. Soc. Trans. 1999; 27: 243-246Crossref PubMed Scopus (17) Google Scholar). Shedding of amyloid precursor protein from HEK293 cells, which is also mediated by TACE, is blocked by inhibitors of MEK-1, the activator of p42 and p44 MAP kinases (16Mills J. Laurent C.D. Lam F. Beyreuther K. Ida N. Pelech S.L. Reiner P.B. J. Neurosci. 1997; 17: 9415-9422Crossref PubMed Google Scholar). In this case, PKC may lie upstream of MEK-1. Salicylates, at concentrations that induce apoptosis, trigger TNFR shedding from EC via a pathway blocked by an inhibitor of p38 MAP kinase (17Madge L.A. Sierra-Honigmann M.R. Pober J.S. J. Biol. Chem. 1999; 274: 13643-13649Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). It is unclear whether these differences are agonist-specific, cell-specific, or both. Physiological activators of TACE in EC are unknown. Histamine is a vasoactive autacoid, released by activated human mast cells or basophils, that produces a rapid but transient EC response. Two well described effects of histamine are EC contraction, resulting in loss of permselectivity and subsequent development of edema, and EC synthesis of vasodilators, such as prostaglandin I2 and NO (18Bolz S.S. Pohl U. Cardiovasc. Res. 1997; 36: 437-444Crossref PubMed Scopus (46) Google Scholar). Histamine-mediated vascular leak and vasodilation underlie the classic "wheal and flare" response of allergy. Histamine also stimulates regulated secretion of stored EC proteins, such as von Willebrand factor and surface translocation of others such as P-selectin (19Asako H. Kurose I. Wolf R. DeFrees S. Zheng Z.L. Phillips M.L. Paulson J.C. Granger D.N. J. Clin. Invest. 1994; 93: 1508-1515Crossref PubMed Scopus (152) Google Scholar). Previous studies (20Zavoico G.B. Ewenstein B.M. Schafer A.I. Pober J.S. J. Immunol. 1989; 142: 3993-3999PubMed Google Scholar) have shown that TNF pretreatment potentiates some histamine responses, such as vasodilator synthesis, but not others such as von Willebrand factor secretion. Histamine acts through trimeric G protein-coupled receptors (H1, H2, H3, or H4) and may elicit calcium transients, protein kinase C activation, and MAP kinase activation (21Robinson A.J. Dickenson J.M. Br. J. Pharmacol. 2001; 133: 1378-1386Crossref PubMed Scopus (29) Google Scholar). Histamine does not activate IKK in EC and may actually inhibit activation of NFκB via calcium-dependent production of NO (22Spiecker M. Darius H. Kaboth K. Hubner F. Liao J.K. J. Leukocyte Biol. 1998; 63: 732-739Crossref PubMed Scopus (188) Google Scholar). In the present study, we have investigated the effect of histamine on TNFR1 expression in human EC. We find that this agent causes both mobilization of receptor from the Golgi pool and shedding of receptor into the medium. This action appears to utilize H1 type receptors and is mediated by a MEK-1/p42 and p44 MAP kinase pathway. These responses correlate with transiently diminished TNF-mediated endothelial activation, identifying a new function for histamine and supporting the hypotheses that the Golgi receptor pool is a reservoir for both cell surface and shed receptors. Materials—Mouse monoclonal anti-human TNFR1, TNFR2, and control IgG, Quantikine human TNFR1 and TNFR2 ELISA kits, human recombinant TNF-α and human recombinant IL-1 were all purchased from R&D Systems Europe (Abingdon, UK). Goat anti-mouse fluorescein isothiocyanate-conjugated antibody was from Dako (Glostrup, Denmark). Goat anti-human TACE antibody and rabbit anti-human IκB-α antibody were from Santa Cruz Biotechnology. Horse anti-goat and goat anti-rabbit horseradish peroxidase-conjugated antibodies were from Vector Laboratories and Bio-Rad, respectively. TNF-α protease inhibitor (TAPI), a specific inhibitor of TACE, was purchased from Peptides International (Louisville, KY). Proteinase inhibitor mixture was from Roche Diagnostics. The ECL system was from Amersham Biosciences. Bisindolylmaleimide, PD98059, and SB202810 were from Calbiochem. Sulfo-NHS-biotin and Neutravidin were from Pierce. Unless otherwise indicated, all reagents were from Sigma. Cell Culture—Human umbilical vein EC (HUVEC) were isolated from human umbilical cords and serially cultured in modified M199 culture medium, containing 20% v/v heat-inactivated bovine fetal calf serum (FCS), 100 μg/ml heparin sodium salt, 30 μg/ml endothelial cell growth supplement, 2 mm l-glutamine, 60 units/ml penicillin, and 0.5 μg/ml streptomycin at 37 °C, in 5% CO2 on gelatin-coated tissue culture plastic (Appleton Woods, UK) as described previously (23Bradley J.R. Thiru S. Pober J.S. Am. J. Pathol. 1995; 147: 627-641PubMed Google Scholar). Cells were used at passages 2–4. Such cultures are free of detectable leukocytes by immunostaining for CD45. Measurement of Cell Surface TNF Receptor Expression by Flow Cytometry—HUVEC were seeded into 6-well tissue culture plates (1.5 × 105 cells per well), and 24 h later the confluent cells were treated with histamine 100 μm for 0.5–16 h. For experiments using brefeldin A (10 μg/ml) or TAPI (25 μm), EC were pretreated with either agent for half an hour before treatment with histamine. After each treatment, cells were harvested using a nonenzymatic cell suspension solution (EDTA in Hanks' balanced salt solution), washed twice with 1% FCS in PBS, and then incubated with primary antibody on ice for 40 min. Cells were then washed twice and incubated with secondary antibody for another 40 min on ice. EC were then washed three times and resuspended in 500 μl of 2% paraformaldehyde in PBS. Fixed cells were analyzed by flow cytometry using FACSCalibur machine (BD Biosciences). Data were analyzed using WinMDI 2.8 software. Detection of Soluble Receptors by ELISA—HUVEC were seeded into 6-well tissue culture plate as described above 24 h before each experiment. Cells were then washed in media containing 10% heat-inactivated FCS and then treated with histamine or PMA for 1 h. In experiments using brefeldin A or TAPI, the agents were added half an hour before addition of histamine or PMA; other agents were added 15 min before treatment with histamine or PMA. After treatment the media from each well were collected and centrifuged at 1500 rpm (380 × g) for 5 min, and the clarified supernatants were collected and stored at –20 °C for 1–2 weeks until analyzed. ELISAs for sTNFR1 and sTNFR2 were performed following the manufacturer's instructions. Developed assay plates were read at wavelength 450 and 540 nm with Titertek Multiscan plate reader, and the results were calculated using a stand- ard curve generated each time an assay was performed. Cell Surface Labeling and Sample Preparation for TACE—HUVECs grown to confluence in T75 flasks (3 × 106) were washed twice in ice-cold PBS, pH 8.0. The membrane-impermeable biotinylation reagent, NHS-SS-Biotin was added to a final concentration of 0.5 mg/ml in PBS, and the cells were incubated at 4 °C for 30 min. The cells were then washed twice with ice-cold PBS and incubated with complete media at 37 °C for 15 min. Cells were then treated with 100 μm histamine or 0.1 μm PMA for 30 min. After treatment, the supernatants were removed, and the cells were then lysed using 25 mm Tris base, 135 mm NaCl, 2.6 mm KCl, 1% Nonidet P-40, protein inhibitor mixture, 1 mm phenylmethylsulfonyl fluoride, and 25 μm TAPI for 30 min. Lysates were centrifuged at 10,000 rpm for 5 min, and the clarified supernatant was transferred to tubes containing Neutravidin beads. After incubation for 1 h the beads were centrifuged down and washed. The supernatant (cytosolic fraction) or beads (containing the biotinylated membrane proteins) were boiled in sample buffer (125 mm Tris/HCl, 15% sucrose, 4% SDS, 10 mm EDTA, 0.1 mg/ml bromphenol blue, 4% mercaptoethanol) for 3 min and analyzed by immunoblotting as described below. IκB-α Degradation Assay—HUVEC were grown to confluence in 6-well plates and then treated with or without 100 μm histamine for various time points. The medium containing shed receptors was then removed, and complete medium with or without 50 units/ml TNF or 1 ng/ml IL-1 was added for 15 min. (For the experiment of effect of TAPI, 25 μm TAPI was added half an hour before histamine treatment.) Cells were then washed with ice-cold PBS twice and lysed in 25 mm Tris base, 135 mm NaCl, 2.6 mm KCl, 1% Nonidet P-40, protein inhibitor mixture, and 1 mm phenylmethylsulfonyl fluoride for 30 min. Samples were centrifuged, and the supernatants were collected and boiled in sample buffer (75 mm Tris/HCl, 10% sucrose, 0.2 mg/ml bromphenol blue, 2% SDS) for 3 min prior to analysis by immunoblotting as described below. Protein concentration was determined using BCA protein assay kits (Pierce). Immunoblotting—Proteins (25 μg) in sample buffer were separated by SDS-PAGE and then transferred to nitrocellulose membrane and immunoblotted (5Jones S.J. Ledgerwood E.C. Prins J.B. Galbraith J. Johnson D.R. Pober J.S. Bradley J.R. J. Immunol. 1999; 162: 1042-1048PubMed Google Scholar). Polyclonal anti-TACE and anti-IκB-α antibodies were used at a dilution of 1:500 and detected by enhanced chemiluminescence using ECL according to the manufacturer's instructions. Serial dilution of samples for immunoblotting confirmed that the density of bands was within the linear range of detection. Confocal Immunofluorescence or Fluorescence Microscopy—HUVEC grown to confluence on coverslips were treated with 0.75 μl/ml of Golgi Probe (Cambridge Bioscience, Cambridge, UK) for 30 min, and then treated with or without 100 μm histamine or 0.1 μm PMA for 1 h at 37 °C before fixation and staining. EC were fixed by adding 1 ml of 2% paraformaldehyde in PBS to the 1 ml of complete growth media in which the treatments were performed. This step and all subsequent steps were performed at room temperature. After fixing for 2 min cells were washed three times with PBS, 1% BSA. Where indicated, fixed EC were permeabilized by incubating in 0.1% Triton X-100 for 1 min and then washed twice with PBS, 1% BSA. Cells were then incubated with mouse monoclonal anti-hTNFR1 in PBS, 1% BSA for 1 h. After washing three times with PBS, 1% BSA, EC were incubated with secondary fluorescein isothiocyanate-conjugated antibody for 45 min. EC were washed twice with PBS, 1% BSA and once in PBS, and coverslips were mounted in Citifluor (Agar Scientific Ltd., Essex, UK) before viewing in a Leica TCS-NT Confocal Microscope (Leica Microsystems Ltd., Milton Keynes, UK). TNFR1 fusion constructs containing enhanced green fluorescent protein (gfp-TNFR1) were introduced into HUVEC by transient transfection. In brief, HUVEC grown to 70% confluence on 100-mm diameter plastic culture plates were transfected ∼18 h after passage with gfp-TNFR1 (24Gaeta M.L. Johnson D.R. Kluger M.S. Pober J.S. Lab. Invest. 2000; 80: 1185-1194Crossref PubMed Scopus (33) Google Scholar) using a modified DEAE-dextran protocol as described previously (25Karmann K. Min W. Fanslow W.C. Pober J.S. J. Exp. Med. 1996; 184: 173-182Crossref PubMed Scopus (98) Google Scholar). Transfection efficiencies typically were between 15 and 25%. 24 h after transfection cells were plated onto fibronectin-coated glass-bottom culture plates (MatTek, Ashland, MA). After 24 h replicate wells were either pretreated with or without 25 μm TAPI (Peptides International), and then mock-treated or exposed to 100 μm histamine for the indicated times and imaged live using a Zeiss confocal microscope running LSM 510 software. Effects of Histamine on Human Skin—The in vivo effects of histamine on human skin were examined using immunodeficient (SCID/beige) C.B-17 mice stably engrafted with two 1-cm2 split thickness grafts as described previously (49Murray A.G. Petzelbauer P. Hughes C.C. Costa J. Askenase P. Pober J.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9146-9150Crossref PubMed Scopus (114) Google Scholar). Cadaveric human skin was obtained from discarded specimens harvested by the skin bank at Yale University School of Medicine, and skin was engrafted under a protocol approved by the Yale Animal Care and Use Committee and by the Yale Human Investigation Committee. To examine the effects of histamine on TNFR1 expression, grafts were injected with 10 μl of histamine (Histatrol, composed of 0.1 mg/ml histamine base and 0.275 mg/ml histamine phosphate, Center Laboratories, Port Washington, NY) or 10 μl of saline or untreated and harvested 30 min later. The tissue was then prepared for immunoelectron microscopy (see below). To examine the effects of TNF responses, one skin graft on each mouse was injected with 10 μl of histamine, and the other graft was injected with physiological saline, 30 min prior to TNF (R&D Systems, Minneapolis, MN) administration. Two mice at each dose (0, 3, 30, 100, 300, and 1000 ng) of TNF were injected subcutaneously in the scapular region, well separated from the graft site. Animals were euthanized, and skin grafts were harvested 6 h after TNF injection. Harvested grafts were snap-frozen in liquid nitrogen and stored at –80 °C until assay for mRNA content (see below). Electron Microscopy of Skin Grafts—Human skin graft tissue was dissected in pieces of less than 1 mm in thickness and fixed by immersion in 2% formaldehyde (J. T. Baker Inc.) in 0.1 m PIPES buffer, pH 7.6, for 1.5 h at 4 °C. The tissue was processed for freeze substitution and low temperature embedding for immunogold electron microscopy as described previously (26Al Lamki R.S. Wang J. Skepper J.N. Thiru S. Pober J.S. Bradley J.R. Lab. Invest. 2001; 81: 1503-1515Crossref PubMed Scopus (110) Google Scholar). In brief tissue was cryo-protected in 30% propylene glycol for 1 h at 4 °C, frozen in melting propane cooled in liquid nitrogen, and substituted against methanol containing 0.1% uranyl acetate at –90 °C for 24 h, at –70 °C for 24 h, and at –50 °C for 24 h. The tissue was then impregnated with Lowicryl HM 20 over a period of 3 days, and the resin was polymerized by ultraviolet irradiation at a temperature of –50 °C. Ultrathin sections 70 nm in thickness were cut on a Leica Ultracut-S (Leica Vienna) ultramicrotome and mounted on Formvar-coated grids. Immunogold Labeling for Electron Microscopy—The grids were incubated, section down, for 0.5 h at room temperature in blocking buffer containing 10% FCS in TBS to suppress nonspecific antibody binding. Excess blocking buffer was removed, and they were incubated overnight, at room temperature, with either mouse anti-hTNFR-1 or mouse anti-hCytokeratin (MNF116, Dako, UK) at 1:5 dilution in blocking buffer. Omission of primary antibody and use of isotype-specific primary antibody or nonimmune serum were used as negative controls. After rinsing extensively with TBS, the grids were incubated with goat anti-mouse conjugated with either 1- or 20-nm colloidal gold particles (British Biocell International Ltd., Cardiff, UK) diluted 1:100 in the blocking solution for 1 h at room temperature. Following a thorough rinse in TBS, grids labeled with 1-nm colloidal gold were incubated with silver enhancement solution (British Biocell International Ltd., Cardiff, UK) for 4 min and washed in deionized water. All grids were then contrast-stained with uranyl acetate and lead citrate for 15 s each. They were then viewed in a Philips TEM 410 electron microscope (Cambridge, UK) at an accelerating voltage of 80 kV. To quantify the labeling of membrane/extracellular versus intracellular TNFR1, gold particles were counted in 10 fields containing on average 8 keratinocytes at a magnification of ×3000 using a small screen attached to the microscope. Counting was repeated using 3 different grids for each experiment. Quantitative RT-PCR—Total RNA was isolated from skin grafts as follows. Frozen skin was placed into 1 ml of Trizol (Invitrogen) and homogenized using a Polytron tissue grinder until smooth. Samples were further processed according to the manufacturer's instructions and modified by centrifugation of the homogenate at 12,000 × g at 4 °C for 10 min to remove insoluble materials. Following Trizol extraction, RNA was further purified using a Qiagen RNeasy (Valencia, CA) clean-up protocol with a DNase digestion step. First strand synthesis was performed using TaqMan Gold RT-PCR kit (Applied Biosystems of PerkinElmer Life Sciences) following the manufacturer's instructions. Random hexamers were used as primers to transcribe 700 ng of total RNA per 35-μl reaction, and RT reactions were performed in a PTC-150 Minicycler (MJ Research; Watertown, MA). Real time quantitative RT-PCR was performed using the TaqMan assay and PCR amplifications in Bio-Rad iCycler IQ Multicolor Real Time Detection System (Bio-Rad) as described previously (50Heide C.A. Stevens J. Livak K.J. Williams P.M. Genome Res. 1996; 6: 986-994Crossref PubMed Scopus (5040) Google Scholar). Briefly, a solution of 2× TaqMan Universal PCR Master Mix (Applied Biosystems, PerkinElmer Life Sciences) containing primers and probes were prepared and aliquoted into individual wells of iCycler iQ PCR Plates (Bio-Rad) and cDNA as added to give a final volume of 25 μl. Conditions for PCRs included 2 min at 50 °C, 10 min at 95 °C, and 50 cycles of denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min. Threshold cycle (CT) during the exponential phase of amplification was determined by real time monitoring of fluorescent emission after cleavage of sequence-specific probes by nuclease activity of Taq polymerase. An increase in fluorescence is proportional to the amount of PCR product, and the amplification cycle at which the reporter dye fluorescence passes a selected base line is the CT. Low CT values reflect a high copy number and vice versa. CT values were exported to Excel for calculations. ICAM-1, ICAM-2, E-selectin, and GAPDH RNA levels were quantified. ICAM-2 is not regulated by TNF and was used as an internal control gene to normalize values for ICAM-1. E-selectin was normalized to GAPDH. Primers for ICAM-1 were purchased from Applied Biosystems of PerkinElmer Life Sciences. Primers for E-selectin, ICAM-2, and GAPDH were designed using Primer 3 software and synthesized by the Keck Foundation Bioresource Laboratory at Yale University. Sequences are as follows: E-selectin forward, CATGGAGACCATGCAGTGTA; E-selectin reverse, GGATTTGTCACAGCATCACA; ICAM-2 forward, CTGACTGTGGCCCTCTTCAC; ICAM-2 reverse, CACGTGTACCTCGAATACCTTCTC; GAPDH forward, GAAGGTGAAGGTCGGAGTC; and GAPDH reverse, GAAGATGGTGATGGGATTTC. Probes were purchased from Applied Biosystems of PerkinElmer Life Sciences with 6-carboxyfluorescein as the emitter at the 5′ end and 6-carboxytetramethylrhodamine as the quencher at the 3′ end. Statistics—The significance of differences between experimental values was assessed by means of the paired Student's t test. Effects of Histamine on Endothelial Cell Surface TNF Receptor Expression and Shedding—As reported previously, cultured HUVEC express TNFR2 and to a lesser extent TNFR1 on their cell surface (2Slowik M.R. De Luca L.G. Fiers W. Pober J.S. Am. J. Pathol. 1993; 143: 1724-1730PubMed Google Scholar). Treatment of confluent EC monolayers with histamine (100 μm) for 30 min reduced cell surface expression levels of both receptors as detected by FACS analysis. The level of TNFR1 on the cell surface had recovered to basal level by 1 h, whereas the recovery of TNFR2 was slower (Table I).Table IHistamine transiently reduces endothelial cell surface TNF receptor expressionHistamine treatmentCorrected values of mean fluorescence intensityTNFR1TNFR2h01.79 ± 0.42.82 ± 0.20.51.16 ± 0.5aValues are p < 0.01 compared to zero time.1.75 ± 0.1bValues are p < 0.05.11.58 ± 0.12.11 ± 0.3bValues are p < 0.05.21.48 ± 0.62.08 ± 0.2bValues are p < 0.05.41.56 ± 0.52.15 ± 0.4bValues are p < 0.05.161.63 ± 0.62.72 ± 0.3a Values are p < 0.01 compared to zero time.b Values are p < 0.05. Open table in a new tab Concomitant with its effects of surface receptor expression, histamine treatment induced an increase in soluble TNFR1 and TNFR2 shed into the culture media. Receptor shedding was maximal during the 1st h of histamine treatment (Fig. 1). Over this time period histamine-induced shedding of TNFR1 was agonist concentration-dependent and inhibited by the histamine H1 receptor antagonist diphenhydramine but not by the H2 antagonist cimetidine (Table II). Similar results were found for shedding of TNFR2, although the total amount shed was less. Cumulatively, these data suggest that histaminestimulated TNFR reduction on the surface was caused by histamine-stimulated receptor shedding.Table IIHistamine induces shedding in a dose-dependent manner through its H1 receptorTreatmentsTNFR1 concentrationpg / mlNo treatment7.04
Referência(s)