Portal de Periódicos da CAPES

MAGUIN, a Novel Neuronal Membrane-associated Guanylate Kinase-interacting Protein

1999; Elsevier BV; Volume: 274; Issue: 17 Linguagem: Inglês

10.1074/jbc.274.17.11889

1083-351X

Ikuko Yao, Yutaka Hata, Nobuyuki Ide, Kazuyo Hirao, Maki Deguchi, Hideo Nishioka, Akira Mizoguchi, Yoshimi Takai,

Neurobiology and Insect Physiology Research

Postsynaptic density (PSD)-95/Synapse-associated protein (SAP) 90 and synaptic scaffolding molecule (S-SCAM) are neuronal membrane-associated guanylate kinases. Because PSD-95/SAP90 and S-SCAM function as synaptic scaffolding proteins, identification of ligands for these proteins is important to elucidate the structure of synaptic junctions. Here, we report a novel protein interacting with the PDZ domains of PSD-95/SAP90 and S-SCAM and named it MAGUIN-1 (membrane-associated guanylate kinase-interacting protein-1). MAGUIN-1 has one sterile α motif, one PDZ, and one plekstrin homology domain. MAGUIN-1 is localized at the plasma membranevia the plekstrin homology domain and the C-terminal region and interacts with PSD-95/SAP90 and S-SCAM via a C-terminal PDZ domain-binding motif. MAGUIN-1 has a short isoform, MAGUIN-2, which lacks a PDZ domain-binding motif. MAGUINs are expressed in neurons and localized in the cell body and neurites and are coimmunoprecipitated with PSD-95/SAP90 and S-SCAM from rat crude synaptosome. MAGUIN-1 may play an important role with PSD-95/SAP90 and S-SCAM to assemble the components of synaptic junctions. Postsynaptic density (PSD)-95/Synapse-associated protein (SAP) 90 and synaptic scaffolding molecule (S-SCAM) are neuronal membrane-associated guanylate kinases. Because PSD-95/SAP90 and S-SCAM function as synaptic scaffolding proteins, identification of ligands for these proteins is important to elucidate the structure of synaptic junctions. Here, we report a novel protein interacting with the PDZ domains of PSD-95/SAP90 and S-SCAM and named it MAGUIN-1 (membrane-associated guanylate kinase-interacting protein-1). MAGUIN-1 has one sterile α motif, one PDZ, and one plekstrin homology domain. MAGUIN-1 is localized at the plasma membranevia the plekstrin homology domain and the C-terminal region and interacts with PSD-95/SAP90 and S-SCAM via a C-terminal PDZ domain-binding motif. MAGUIN-1 has a short isoform, MAGUIN-2, which lacks a PDZ domain-binding motif. MAGUINs are expressed in neurons and localized in the cell body and neurites and are coimmunoprecipitated with PSD-95/SAP90 and S-SCAM from rat crude synaptosome. MAGUIN-1 may play an important role with PSD-95/SAP90 and S-SCAM to assemble the components of synaptic junctions. postsynaptic density synapse-associated protein PSD-95/Dlg-A/ZO-1 guanylate kinase N-methyl-d-aspartate SAP90/PSD-95-associated protein synaptic scaffolding molecule glutathione S-transferase sterile α motif plekstrin homology synaptic plasma membrane mitogen-activated protein kinase Chinese hamster ovary Synaptic junctions are interneuronal cell-cell junctions differentiated for neurotransmission. Neurotransmitters are released from the synaptic vesicles into the synaptic cleft and bind to the receptors accumulated at the postsynapse, opening the ion channels and generating the second messengers involved in synaptic plasticity (reviewed in Ref. 1Hammond C. Cellular and Molecular Neurobiology. 1st Ed. Academic Press, Inc., San Diego, CA1996: 20-40Google Scholar). The components required for this process are organized at the synaptic junctions to play specific roles in felicitous orders. Several scaffolding proteins are reported to be involved in the assembly of components of synaptic junctions (reviewed in Refs. 2Kennedy M.B. Curr. Opin. Neurobiol. 1993; 3: 732-737Crossref PubMed Scopus (129) Google Scholar, 3Garner C. Kindler S. Trends Cell Biol. 1996; 19: 429-433Abstract Full Text PDF Scopus (63) Google Scholar, 4Kennedy M.B. Trends Neurosci. 1997; 20: 264-268Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 5Craven S.E. Bredt D.S. Cell. 1998; 93: 495-498Abstract Full Text Full Text PDF PubMed Scopus (429) Google Scholar, 6Hata Y. Nakanishi H. Takai Y. Neurosci. Res. 1998; 32: 1-7Crossref PubMed Scopus (74) Google Scholar). Postsynaptic density (PSD)1-95/synapse-associated protein (SAP) 90 has three PSD-95/Dlg-A/ZO-1 (PDZ) domain, one Src homology 3 domain, and one guanylate kinase (GK) domain (7Cho K.-O. Hunt C.A. Kennedy M.B. Neuron. 1992; 9: 929-942Abstract Full Text PDF PubMed Scopus (1008) Google Scholar, 8Kistner U. Wenzel B.M. Veh R.W. Cases-Langhoff C. Garner A.M. Appeltauer U. Voss B. Gundelfinger E.D. Garner C.C. J. Biol. Chem. 1993; 268: 4580-4583Abstract Full Text PDF PubMed Google Scholar). The PDZ domain is a protein-interacting module (reviewed in Refs. 9Ponting C.P. Phillips C. Trends Biochem. Sci. 1995; 20: 102-103Abstract Full Text PDF PubMed Scopus (163) Google Scholar, 10Kennedy M.B. Trends Biochem Sci. 1995; 20: 350Abstract Full Text PDF PubMed Scopus (169) Google Scholar, 11Fanning A.S. Anderson J.M. Curr. Biol. 1996; 6: 1385-1388Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 12Sheng M. Neuron. 1996; 17: 575-578Abstract Full Text Full Text PDF PubMed Scopus (296) Google Scholar), and PSD-95/SAP90 binds the C termini of N-methyl-d-aspartate (NMDA) receptors, K+ channels, neuroligins, synGAP, and CRIPT through distinct PDZ domains to assemble these components at the synaptic junctions (13Kornau H.-C. Schenker L.T. Kennedy M.B. Seeburg P.H. Science. 1995; 269: 1737-1740Crossref PubMed Scopus (1631) Google Scholar, 14Kim E. Niethammer M. Rothschild A. Jan Y.N. Sheng M. Nature. 1995; 378: 85-88Crossref PubMed Scopus (900) Google Scholar, 15Irie M. Hata Y. Takeuchi M. Ichtchenko K. Toyoda A. Hirao K. Takai Y. Rosahl T.W. Sudhof T.C. Science. 1997; 277: 1511-1515Crossref PubMed Scopus (612) Google Scholar, 16Kim J.H. Liao D. Lau L.-F. Huganir R.L. Neuron. 1998; 20: 683-691Abstract Full Text Full Text PDF PubMed Scopus (510) Google Scholar, 17Chen H.J. Rojas-Soto M. Oguni A. Kennedy M.B. Neuron. 1998; 20: 895-904Abstract Full Text Full Text PDF PubMed Scopus (486) Google Scholar, 18Niethammer M. Valtschanoff J.G. Kapoor T.M. Allison D.W. Weinberg R.J. Craig A.M. Sheng M. Neuron. 1998; 20: 693-707Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar). PSD-95/SAP90 interacts with SAP90/PSD-95-associated protein (SAPAP) (also called GK-associated protein and hDLG-associated protein) (19Kim E. Naisbitt S. Hsueh Y.-P. Rao A. Rothschild A. Craig A.M. Sheng M. J. Cell Biol. 1997; 136: 669-678Crossref PubMed Scopus (434) Google Scholar, 20Takeuchi M. Hata Y. Hirao K. Toyoda A. Irie M. Takai Y. J. Biol. Chem. 1997; 272: 11943-11951Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar, 21Satoh K. Yanai H. Senda T. Kohu K. Nakamura T. Okumura N. Matsumine A. Kobayashi S. Toyoshima K. Akiyama T. Genes Cells. 1997; 2: 415-424Crossref PubMed Scopus (112) Google Scholar), and a recently identified protein, BEGAIN (brain-enriched guanylate kinase-interacting protein) via the GK domain (22Deguchi M. Hata Y. Takeuchi M. Ide N. Hirao K. Yao I. Irie M. Toyoda A. Takai Y. J. Biol. Chem. 1998; 273: 26269-26272Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Glutamate receptor-interacting protein has seven PDZ domains and binds α amino-3-hydroxy-5-methyl-4-isoxazaole propionic acid receptorsvia the fourth and fifth PDZ domains (23Dong H. O'Brien R.J. Fung E.T. Lanahan A.A. Worley P.F. Huganir R.L. Nature. 1997; 386: 279-284Crossref PubMed Scopus (758) Google Scholar). The ligands for other PDZ domains of glutamate receptor-interacting protein have not been so far reported. Synaptic scaffolding molecule (S-SCAM) was originally identified as a SAPAP-interacting protein (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). We have first reported that S-SCAM has one GK, two WW, and five PDZ domains (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). The GK domain of S-SCAM is shorter than that of PSD-95/SAP90. The WW domain is a protein-interacting module binding a proline-rich sequence (25Chen H.I. Sudol M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7819-7823Crossref PubMed Scopus (489) Google Scholar). The recent version of simple modular architecture research tool recognizes an additional PDZ domain at the N terminus of S-SCAM (26Schultz J. Milpetz F. Bork P. Ponting C.P. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5857-5864Crossref PubMed Scopus (3029) Google Scholar). We number these PDZ domains consecutively from 0 to 5 (PDZ0, -1, -2, -3, -4, and -5) to keep consistency with the first report. Among six PDZ domains, PDZ1 and -5 bind to the C termini of neuroligin and NMDA receptors, respectively (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). Because S-SCAM has more PDZ domains than PSD-95/SAP90, it may integrate more components of synaptic junctions. Based on this assumption, we have performed a yeast two-hybrid screening using the PDZ domains of S-SCAM to obtain a novel neuronal molecule. Eventually, this molecule binds not only to S-SCAM but also to PSD-95/SAP90. We have named this protein MAGUIN-1 (membrane-associated guanylate kinase-interacting protein-1). Rat brain yeast two-hybrid library was constructed using pVP16 vector and screened (27Hata Y. Butz S. Sudhof T.C. J. Neurosci. 1996; 16: 2488-2494Crossref PubMed Google Scholar). Rat brain cDNA libraries were screened with the [α-32P]dCTP-labeled random-primed probes (27Hata Y. Butz S. Sudhof T.C. J. Neurosci. 1996; 16: 2488-2494Crossref PubMed Google Scholar). Various expression vectors were constructed by conventional molecular biology techniques and polymerase chain reaction method using pBTM116, pBTM116–2, pCMV Myc, pCMV Myc2, pClneo Myc, pGex5X-3 (Amersham Pharmacia Biotech), pGex4T-1 (Amersham Pharmacia Biotech), and pGexKG. pBTM116–2, pCMV Myc, and pClneo Myc were constructed from pBTM116, pCMV5, and pClneo, respectively (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). pCMV Myc2 was constructed by ligating aattcgagatctcgggtaccacgcgtatcgatatcgcggccg/ctagcggccgcgatatcgatacgcgtggtacccgagatctcg into EcoRl/Xbal sites of pCMV Myc. pCMV PSD-95, pCMV S-SCAM, and pClneo Myc S-SCAM-1, -2, -3, and -4 were described previously (20Takeuchi M. Hata Y. Hirao K. Toyoda A. Irie M. Takai Y. J. Biol. Chem. 1997; 272: 11943-11951Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar,24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). pBTM116 S-SCAM-13, -14, and -16 and pClneo Myc S-SCAM-9, -10, and -11 contain the amino acid residues 413–1114, 413–1277, 728–1277, 603–1023, 906–1277, and 772–1277 of S-SCAM, respectively. pBTM116 MAGUIN-9, pGex4T-1 MAGUIN-1, pGex5X-3 MAGUIN-12, pCMV Myc MAGUIN-1f, and pClneo Myc MAGUIN-n, -m, and -c contain the amino acid residues 846–1032, 716–858, 846–1032, 1–1032, 1–469, 458–858, and 568–1032 of MAGUIN-1, respectively. pGex5X-3 MAGUIN-16 and pCMV Myc MAGUIN-2f contain the amino acid residues 568–896 and 1–896 of MAGUIN-2, respectively. pCMV Myc PSD-95-1, -5, and -6 contain the amino acid residues 1–724, 1–407, and 432–724 of PSD-95/SAP90, respectively. Rabbit polyclonal antibodies were raised against the products of pGex4T-1 MAGUIN-1 and pGex5X-3 MAGUIN-16. The monoclonal anti-Myc-tag antibody, 9E10, was obtained from American Type Culture Collection. The anti-γ-aminobutyric acid A receptor antibody was purchased from Chemicon. The anti-NMDAR1 antibody was a generous gift of Dr. Nils Brose (Max Planck Institute). The anti-S-SCAM antibody was described (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). COS cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum under 10% CO2 at 37 °C and transfected with DEAE-dextran (20Takeuchi M. Hata Y. Hirao K. Toyoda A. Irie M. Takai Y. J. Biol. Chem. 1997; 272: 11943-11951Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). COS cells of two 10-cm plates were homogenized in 0.5 ml of 20 mm Tris/HCl, pH 7.4, containing 100 mm NaCl and 1% (w/v) Triton X-100 and centrifuged at 100,000 × gfor 30 min. The supernatant was used as a COS cell extract. 0.5-ml aliquots of the COS cell extract were incubated with 200 pmol of various GST constructs fixed on 20 μl of glutathione-Sepharose 4B beads. After the beads were washed with 50 mm Tris/HCl, pH 7.4, containing 100 mm NaCl and 1% (w/v) Triton X-100, proteins on the beads were detected with the immunoblottings using the appropriate antibodies. The crude synaptosomal fraction was prepared from four rat brains as described (24Hirao K. Hata Y. Ide N. Takeuchi M. Irie M. Yao I. Deguchi M. Toyoda A. Sudhof T.C. Takai Y. J. Biol. Chem. 1998; 273: 21105-21110Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). The fraction was homogenized in 16 ml of 50 mm Hepes/NaOH, pH 8.0, containing 100 mm NaCl, 5 mm EDTA, 1% (w/v) deoxycholic acid, and 1% (w/v) Nonidet P-40 and centrifuged at 100,000 × g for 30 min to collect the supernatant. 4-ml aliquots of the supernatant were incubated with the anti-PSD-95/SAP90 antibody, the anti-S-SCAM antibody, or the preimmune serum fixed on 20 μl of protein G-Sepharose Fast Flow beads. After the beads were washed four times with 50 mm NaOH/Hepes, pH 8.0, containing 100 mm NaCl, and 1% (w/v) Triton X-100, proteins on the beads were detected with the immunoblottings using the appropriate antibodies. CHO cells were transfected with various eukaryote expression vectors using TransFast Transfection Reagent (Promega). After 48 h, the cells were collected and homogenized in 300 μl of 20 mm Hepes/NaOH, pH 7.4, by sonication. 80 μl of the homogenate was kept for the analysis, and the remaining samples were centrifuged at 100,000 ×g for 30 min to separate the supernatant and the pellet. The pellet was homogenized in 220 μl of 20 mm Hepes/NaOH, pH 7.4, containing 1% (w/v) Triton X-100 and centrifuged at 10,000 × g for 10 min to separate the supernatant and the pellet. Other procedures, including subcellular fractionation of rat brain, primary cultures of rat hippocampal neurons, immunocytostaining, SDS-polyacrylamide gel electrophoresis, and protein determination, were performed as described (20Takeuchi M. Hata Y. Hirao K. Toyoda A. Irie M. Takai Y. J. Biol. Chem. 1997; 272: 11943-11951Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar). Northern and Western blottings were performed using multiple tissue Northern blots (CLONTECH) and ECL reagents (Amersham Pharmacia Biotech), respectively. We performed the yeast two-hybrid screening using baits containing the PDZ domains of S-SCAM (pBTM116 S-SCAM-13, -14, and -16). We obtained 34 positive independent clones from 5 × 106 clones of a rat brain yeast two-hybrid library. The sequences of 22 clones were novel, and we performed Northern blot analysis for these clones. The messages of two clones (pPrey 4233 and pPrey 4514) were detected only in the brain. During the study, the sequence of human brain-specific angiogenesis inhibitor-1 was reported, and pPrey 4514 turned out to be rat brain-specific angiogenesis inhibitor-1. We obtained the presumptive full-length coding sequences of pPrey 4233 through the conventional hybridization screening using a rat brain cDNA library and polymerase chain reaction using rat brain cDNAs as templates. Two isoforms were detected and named MAGUIN-1 and -2. MAGUIN-1 had 1032 amino acids and was composed of one sterile α motif (SAM) domain, one PDZ domain, and one plekstrin homology (PH) domain (Fig.1 A). MAGUIN-1 had Thr-His-Val at the C terminus, which corresponded to the PDZ domain-binding motif. pPrey 4233 contained the C-terminal 319 residues of MAGUIN-1 (amino acids 714–1032, underlined in Fig. 1 A). MAGUIN-2 contained the N-terminal 895 amino acids of MAGUIN-1 and is terminated with Ser as the last (896th) residue, lacking the PDZ domain-binding motif (Fig. 1 B). The SAM domain of MAGUINs is about 30% homologous to those of Caenorhabditis elegans R01H10.8 and yeast byr2 and about 15% homologous to that of yeastSTE50 (Fig. 2 A) (28Ponting C.P. Protein Sci. 1995; 4: 1928-1930Crossref PubMed Scopus (142) Google Scholar, 29Schultz J. Ponting C.P. Hofman K. Bork P. Protein Sci. 1997; 6: 249-253Crossref PubMed Scopus (270) Google Scholar, 30Wang Y. Xu H.P. Riggs M. Rodgers L. Wigler M. Mol. Cell. Biol. 1991; 11: 3554-3563Crossref PubMed Scopus (150) Google Scholar, 31Ramezani R.M. Xu G. Hollenberg C.P. Mol. Gen. Genet. 1992; 236: 145-154Crossref PubMed Scopus (41) Google Scholar). The PDZ domain of MAGUINs is about 40% homologous to that ofC. elegans R01H10.8 (Fig. 2 B). The homology with the PDZ domain of PSD-95/SAP90 or CASK is about 15%, and among others the residues of the first α helix are rather well conserved (Fig.2 B) (32Doyle A.D. Lee A. Lewis J. Kim E. Sheng M. MacKinnon R. Cell. 1996; 85: 1067-1076Abstract Full Text Full Text PDF PubMed Scopus (976) Google Scholar, 33Cabral J.H. Petosa C. Sutcliffe M.J. Raza S. Byron O. Poy F. Marfatia S.M. Chishti A.H. Liddington R.C. Nature. 1996; 382: 649-652Crossref PubMed Scopus (292) Google Scholar). The PH domain of MAGUINs is about 20% homologous to those of C. elegans R01H10.8, human dynamin, and rsec7 (Fig. 2 C) (34van der Bliek A.M. Redelmeier T.E. Damke H. Tisdale E.J. Meyerowitz E.M. Schmid S.L. J. Cell Biol. 1993; 122: 553-563Crossref PubMed Scopus (591) Google Scholar, 35Telemenakis I. Benseler F. Stenius K. Sudhof T.C. Brose N. Eur. J. Cell Biol. 1997; 74: 143-149PubMed Google Scholar). This region of MAGUINs is about 55% homologous to human KIAA0403 (Fig. 2 C). Although the complete coding sequence of KIAA0403 is not reported, it may be a human isoform of MAGUINs. Because C. elegans R01H10.8 has a similar molecular structure, it may be a C. eleganshomologue of MAGUINs.Figure 2Sequence alignment of each domain of MAGUINs. Residues are shown in single-letter codes. The residues conserved among four, three, and two proteins are indicated on thegreen, orange, and light or dark blue backgrounds, respectively. A, alignment of the SAM domains of MAGUINs, C. elegans R01H10.8, yeastbyr2, and STE50. B, alignment of the PDZ domain of MAGUINs with the PDZ domain of C. elegans R01H10.8, the PDZ domain of CASK, and the third PDZ domain of PSD-95/SAP90. The amino acids of α helixes and β sheets are indicated in boxes.C, alignment of the PH domains of MAGUINs, C. elegans R01H10.8, KIAA0403, dynamin, and rsec7.View Large Image Figure ViewerDownload (PPT) To confirm the interaction of MAGUIN-1 with S-SCAM, the extract of COS cells expressing S-SCAM was incubated with either GST-MAGUIN-12 containing the C terminus of MAGUIN-1 or GST-MAGUIN-16 containing the C terminus of MAGUIN-2. The C terminus of MAGUIN-1 interacted with S-SCAM, whereas the C terminus of MAGUIN-2 did not (Fig.3 A). MAGUIN-1 was coimmunoprecipitated with S-SCAM from the rat crude synaptosomal fraction (Fig. 3, B and C). To determine the interacting region of S-SCAM with MAGUIN-1, various Myc-tagged constructs of S-SCAM were incubated with GST-MAGUIN-12 containing the C terminus of MAGUIN-1 (Fig.4 A). Myc-S-SCAM-1, -4, -11, and -10 interacted, whereas Myc-S-SCAM-2, -3, and -9 did not (Fig.4 B), suggesting that the fourth and fifth PDZ domains were involved in the interaction. From the reverse yeast two-hybrid screening using pBTM116 MAGUIN-9 as a bait, the PDZ domains of PSD-95/SAP90, PSD93/chapsyn110, and SAP97 were obtained (36Brenman J.E. Chao D. Gee S.H. McGee A.W. Craven S.E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1446) Google Scholar, 37Kim E. Cho K.-O. Rothschild A. Sheng M. Neuron. 1996; 17: 103-113Abstract Full Text Full Text PDF PubMed Scopus (476) Google Scholar, 38Muller B.M. Kistner U. Veh R.W. Cases-Langhoff C. Becker B. Gundelfinger E.D. Garner C.C. J. Neurosci. 1995; 15: 2354-2366Crossref PubMed Google Scholar), suggesting that MAGUIN-1 interacted with not only S-SCAM but also PSD-95/SAP90 and its isoforms. MAGUIN-1 was coimmunoprecipitated with PSD-95/SAP90 from the rat crude synaptosomal fraction (Fig.5 A). The interaction of MAGUIN-1 with the PDZ domains of PSD-95/SAP90 was confirmed using Myc-tagged constructs of PSD-95/SAP90 and the GST construct of MAGUIN-1 (Fig. 5 B).Figure 4MAGUIN-1-interacting domain of S-SCAM. A, schematic description of various Myc-tagged constructs of S-SCAM. The letter (a–g) to the leftof each construct corresponds to the letter of eachlane in panel B. B, the extract of COS cells expressing various Myc-tagged constructs of S-SCAM were incubated with GST-MAGUIN-12 fixed on the glutathione beads, and the proteins attached to the beads were detected with the anti-Myc antibody. Lane a, pClneo Myc S-SCAM-1; lane b, pClneo Myc S-SCAM-2;lane c, pClneo Myc S-SCAM-3; lane d, pClneo Myc S-SCAM-4; lane e, pClneo Myc S-SCAM-9; lane f, pClneo Myc S-SCAM-10; lane g, pClneo Myc S-SCAM-11.View Large Image Figure ViewerDownload (PPT)Figure 5Interaction of MAGUIN-1 with PSD-95/SAP90. A, coimmunoprecipitation of MAGUIN-1 with PSD-95/SAP90. The Triton X-100 extract of the rat crude synaptosomal fraction was incubated with either the anti-PSD-95/SAP90 serum or the preimmune serum on protein G-Sepharose beads, and the proteins attached to the beads were immunoblotted with the anti-MAGUIN antibody.Lane 1, the original Triton X-100 extract of rat crude synaptosome before the incubation; lane 2, with the preimmune serum; lane 3, with the anti-PSD-95/SAP90 antibody. B, interaction of MAGUIN-1 with the PDZ domains of PSD-95/SAP90. The extract of COS cells expressing various Myc-tagged PSD-95/SAP90 was incubated with GST-MAGUIN-12 (the C-terminal construct of MAGUIN-1) or GST-MAGUIN-16 (the C-terminal construct of MAGUIN-2) fixed on the glutathione beads, and the proteins attached to the beads were detected with the anti-Myc antibody. Lanes 1–3, the full-length of PSD-95/SAP90; lanes 4–6, the PDZ domains of PSD-95/SAP90; lanes 7-9, the Src homology 3 and GK domains of PSD-95/SAP90. Lanes 1, 4, and7, the original samples before the incubation; lanes 2, 5, and 8, after the incubation with GST-MAGUIN-12; lanes 3, 6, and 9, after the incubation with GST-MAGUIN-16.View Large Image Figure ViewerDownload (PPT) Northern blot analysis revealed 4.4- and 5.4-kilobase pair messages only in brain (Fig. 6). The two messages with different sizes may reflect differential polyadenylation. No message was detected in heart, spleen, lung, liver, kidney, skeletal muscles, or testis. In the subcellular fractionation of rat brain, MAGUINs were detected mainly in the synaptic plasma membrane (SPM) and PSD fractions (Fig.7 A). Two bands with different molecular sizes may represent protein degradation, post-translational modifications, or alternative splicing isoforms. In rat hippocampal neurons, MAGUINs were distributed in the cell body and the neurites and colocalized with NMDAR1 (Fig. 7 B).Figure 7Subcellular localization of MAGUINs. A, Western blot analysis of the subcellular fractions of rat brain. Equal aliquots of the subcellular fractions of rat brain (25 μg of protein each) were immunoblotted with the anti-MAGUIN antibody.Lane 1, the homogenate fraction; lane 2, the nuclear pellet fraction; lane 3, the crude synaptosomal fraction; lane 4, the synaptosomal cytosol fraction;lane 5, the crude synaptosomal pellet fraction; lane 6, the crude synaptic vesicle fraction; lane 7, the lysed synaptosomal membrane fraction; lane 8, the SPM fraction; lane 9, the 0.5% (w/v) Triton X-100-soluble fraction of the SPM; lane 10, the 0.5% (w/v) Triton X-100-insoluble fraction of the SPM; lane 11, the 1% (w/v) Triton X-100-soluble fraction of the SPM; lane 12, the 1% (w/v) Triton X-100-insoluble fraction of the SPM. B, expression of MAGUINs in rat primary cultured hippocampal neurons. Rat hippocampal neurons were immunostained with the polyclonal mouse anti-MAGUIN antibody. The scale bar indicates 10 μm.View Large Image Figure ViewerDownload (PPT) The PH domain is known to interact with the phospholipid membrane (reviewed in Refs. 39Pawson T. Nature. 1995; 373: 573-580Crossref PubMed Scopus (2234) Google Scholar and40Cohen G.B. Ren R. Baltimore D. Cell. 1995; 80: 237-248Abstract Full Text PDF PubMed Scopus (926) Google Scholar). To test whether MAGUINs associate with the plasma membrane through the PH domain, various Myc-tagged constructs of MAGUINs were transfected in CHO cells (Fig.8 A). Full-length MAGUIN-1 and -2 and the construct containing the PH domain with the C-terminal stretch were localized at the plasma membrane (Fig. 8 B,1f, 2f, and m). The construct containing the SAM and PDZ domains was distributed in the cytosol (Fig.8 B, n). The construct containing the C-terminal region of MAGUIN-1 was localized at the plasma membrane, although it lacked the PH domain (Fig. 8 B, c). The similar results were obtained in the subcellular fractionation of CHO cells transfected with these constructs. Full-length MAGUIN-1 was recovered in the membrane fraction (Fig.9 A). The N-terminal construct containing the SAM and PDZ domains was distributed more in the cytosol than in the membrane fraction (Fig. 9 B). The PH domain with the C-terminal stretch was recovered in the membrane fraction (Fig.9 C). The C-terminal construct was recovered mainly in the membrane fraction with a smaller amount in the cytosol (Fig.9 D). Because the construct containing only the PH domain was not expressed, we could not determine whether the PH domain was directly involved in the membrane association of MAGUIN-1. However, these findings suggest that MAGUIN-1 associates with the plasma membrane through the region containing the PH domain and the C-terminal stretch of the PH domain. The N-terminal, PH domain, and C-terminal constructs were Triton X-100-soluble, whereas the full-length construct of MAGUIN-1 was Triton X-100-insoluble (Fig. 9), suggesting that the whole structure of MAGUIN-1 is necessary for the interaction with the Triton X-100-insoluble structures.Figure 9Subcellular localization of MAGUIN-1 in CHO cells. CHO cells were transfected with various Myc-tagged constructs of MAGUIN-1. The homogenates of the cells were subfractionated into the cytosol, membrane, Triton X-100-soluble, and Triton X-100-insoluble fractions. Comparable amounts of fractions were immunoblotted with the monoclonal anti-Myc antibody. Lanes 1, homogenate; lanes 2, cytosol; lanes 3, membrane; lanes 4, Triton X-100-soluble; lanes 5, Triton X-100-insoluble. A, pCMV Myc MAGUIN-1f (the full length of MAGUIN-1). B, pClneo Myc MAGUIN-n (the SAM and PDZ domains). C, pClneo Myc MAGUIN-m (the PH domain with the C-terminal stretch). D, pClneo Myc MAGUIN-c (the C-terminal region of MAGUIN-1).View Large Image Figure ViewerDownload (PPT) In the last set of experiments, we tested whether MAGUIN-1 affected the subcellular localization of PSD-95/SAP90 and S-SCAM in the transfected cells. PSD-95/SAP90 and S-SCAM were distributed in the Triton X-100-soluble fraction in CHO cells (Fig.10, A and B). MAGUIN-1 and -2 were distributed in the Triton X-100-insoluble fraction (Fig. 9 A and data not shown). PSD-95/SAP90 and S-SCAM were recruited into the Triton X-100-insoluble fraction, when coexpressed with MAGUIN-1 (Fig. 10, C and D). In contrast, PSD-95/SAP90 and S-SCAM remained in the Triton X-100-soluble fraction, when coexpressed with MAGUIN-2 (data not shown). In this paper, we have identified a novel ligand for S-SCAM and named it MAGUIN-1. We have also reported its short isoform, MAGUIN-2. MAGUIN-1 binds to PSD-95/SAP90 as well as to S-SCAM. MAGUINs have a unique combination of protein modules including SAM, PDZ, and PH domains. SAM domain is proposed to mediate protein binding or DNA binding (reviewed in Refs. 28Ponting C.P. Protein Sci. 1995; 4: 1928-1930Crossref PubMed Scopus (142) Google Scholar and 29Schultz J. Ponting C.P. Hofman K. Bork P. Protein Sci. 1997; 6: 249-253Crossref PubMed Scopus (270) Google Scholar). The subcellular localization of MAGUINs precludes a DNA binding role, but some protein may interact with MAGUINs via the SAM domain. The PDZ domain is a well known protein module that binds to the C terminus of other proteins (reviewed in Refs. 2Kennedy M.B. Curr. Opin. Neurobiol. 1993; 3: 732-737Crossref PubMed Scopus (129) Google Scholar, 3Garner C. Kindler S. Trends Cell Biol. 1996; 19: 429-433Abstract Full Text PDF Scopus (63) Google Scholar, 4Kennedy M.B. Trends Neurosci. 1997; 20: 264-268Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 5Craven S.E. Bredt D.S. Cell. 1998; 93: 495-498Abstract Full Text Full Text PDF PubMed Scopus (429) Google Scholar, 6Hata Y. Nakanishi H. Takai Y. Neurosci. Res. 1998; 32: 1-7Crossref PubMed Scopus (74) Google Scholar). The study using the peptide library revealed the existence of two classes of the PDZ domains (41Songyang Z. Fanning A.S. Fu C. Xu J. Marfatia S.M. Chisti A.H. Crompton A. Chan A.C. Anderson J.M. Cantley L.C. Science. 1997; 275: 73-77Crossref PubMed Scopus (1224) Google Scholar). Class I PDZ domains, such as those of PSD-95/SAP90, select the peptides containing Glu-(Ser/Thr)-Xaa-(Val/Ile) (Xaa is any amino acid) at the C terminus, whereas class II PDZ domains, such as that of CASK, select the peptides with hydrophobic or aromatic side chains at the C-terminal three residues (41Songyang Z. Fanning A.S. Fu C. Xu J. Marfatia S.M. Chisti A.H. Crompton A. Chan A.C. Anderson J.M. Cantley L.C. Science. 1997; 275: 73-77Crossref PubMed Scopus (1224) Google Scholar). The PDZ domains are also reported to interact with other PDZ domains (36Brenman J.E. Chao D. Gee S.H. McGee A.W. Craven S.E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1446) Google Scholar, 42Srivastava S. Osten P. Vilim F.S. Khatri L. Inman G. States B. Daly C. DeSouza S. Abagyan R. Valtschanoff J.G. Weinberg R.J. Ziff E.B. Neuron. 1998; 21: 581-591Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar). The PDZ domain is composed of two α helixes and six β sheets, and the second α helix and second β sheet provide a carboxyl-binding loop (32Doyle A.D. Lee A. Lewis J. Kim E. Sheng M. MacKinnon R. Cell. 1996; 85: 1067-1076Abstract Full Text Full Text PDF PubMed Scopus (976) Google Scholar, 33Cabral J.H. Petosa C. Sutcliffe M.J. Raza S. Byron O. Poy F. Marfatia S.M. Chishti A.H. Liddington R.C. Nature. 1996; 382: 649-652Crossref PubMed Scopus (292) Google Scholar). The residues of this loop of MAGUINs are diverged from those of PSD-95/SAP90 or CASK, suggesting that the ligand for the PDZ domain of MAGUINs has the C-terminal residues different from either group 1 or group 2 consensus motif (41Songyang Z. Fanning A.S. Fu C. Xu J. Marfatia S.M. Chisti A.H. Crompton A. Chan A.C. Anderson J.M. Cantley L.C. Science. 1997; 275: 73-77Crossref PubMed Scopus (1224) Google Scholar). No interacting protein was obtained from the yeast two-hybrid screening using the PDZ domain of MAGUINs as a bait (data not shown), and whether the PDZ domain of MAGUINs functions as a protein-interacting module needs to be investigated. The PH domain binds to inositol phosphates and phosphoinositides and regulates the membrane association of many signaling proteins (reviewed in Refs. 39Pawson T. Nature. 1995; 373: 573-580Crossref PubMed Scopus (2234) Google Scholar and 40Cohen G.B. Ren R. Baltimore D. Cell. 1995; 80: 237-248Abstract Full Text PDF PubMed Scopus (926) Google Scholar). We could not determine whether the PH domain was required for the membrane association, but we observed that MAGUIN-1 binds to the plasma membrane through the region containing the PH domain and the C-terminal region. This finding suggests that the PH domain can support the membrane attachment, as well as the C-terminal region. The C-terminal stretch of the PH domain of β-adrenergic receptor kinase is reported to bind the βγ subunits of heterotrimeric GTP-binding proteins (Gβγ) (43Touhara K. Inglese J. Pitcher J.A. Shaw G. Lefkowitz R.J. J. Biol. Chem. 1994; 269: 10217-10220Abstract Full Text PDF PubMed Google Scholar). The C-terminal stretch of the PH domain of MAGUINs is diverged from that of β-adrenergic receptor kinase, and the interaction of MAGUIN-1 with Gβγ is not detected (data not shown). However, because the C-terminal region of MAGUIN-1 also mediates the membrane association, this region also has a binding activity for lipid or some membrane protein. MAGUIN-1 is a common ligand for PSD-95/SAP90 and S-SCAM, which are both neuronal multiple PDZ domain-containing proteins. PSD-95/SAP90 and S-SCAM bind NMDA receptors, K+ channels, and neuroligin through distinct PDZ domains and assemble these molecules at synaptic junctions. PSD-95/SAP90 further interacts with neuronal nitric-oxide synthase, synGAP, and CRIPT (16Kim J.H. Liao D. Lau L.-F. Huganir R.L. Neuron. 1998; 20: 683-691Abstract Full Text Full Text PDF PubMed Scopus (510) Google Scholar, 17Chen H.J. Rojas-Soto M. Oguni A. Kennedy M.B. Neuron. 1998; 20: 895-904Abstract Full Text Full Text PDF PubMed Scopus (486) Google Scholar, 18Niethammer M. Valtschanoff J.G. Kapoor T.M. Allison D.W. Weinberg R.J. Craig A.M. Sheng M. Neuron. 1998; 20: 693-707Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 36Brenman J.E. Chao D. Gee S.H. McGee A.W. Craven S.E. Santillano D.R. Wu Z. Huang F. Xia H. Peters M.F. Froehner S.C. Bredt D.S. Cell. 1996; 84: 757-767Abstract Full Text Full Text PDF PubMed Scopus (1446) Google Scholar). synGAP regulates the activity of a small GTP-binding protein, Ras (16Kim J.H. Liao D. Lau L.-F. Huganir R.L. Neuron. 1998; 20: 683-691Abstract Full Text Full Text PDF PubMed Scopus (510) Google Scholar, 17Chen H.J. Rojas-Soto M. Oguni A. Kennedy M.B. Neuron. 1998; 20: 895-904Abstract Full Text Full Text PDF PubMed Scopus (486) Google Scholar). During this study, aDrosophila gene that genetically interacts with kinase suppressor of ras (ksr) has been reported and namedconnector enhancer of ksr (cnk) (44Therrien M. Wong A.M. Rubin G.M. Cell. 1998; 95: 343-353Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar).cnk functions in the Ras/mitogen-activated protein kinase (MAPK) pathway, and the product of cnk physically binds Raf kinase. CNK has a molecular structure similar to that of MAGUINs. Therefore, MAGUIN-1 may also bind Raf kinase and links it to PSD-95/SAP90 and S-SCAM. The yeast two-hybrid screening using the GK domain of PSD-95/SAP90 revealed SPA-1-like protein besides SAPAP and BEGAIN (22Deguchi M. Hata Y. Takeuchi M. Ide N. Hirao K. Yao I. Irie M. Toyoda A. Takai Y. J. Biol. Chem. 1998; 273: 26269-26272Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). SPA-1 is a GAP protein for Rap1 (45Kurachi H. Wada Y. Tsukamoto N. Maeda M. Kubota H. Hattori M. Iwaki K. Minato N. J. Biol. Chem. 1997; 272: 28081-28088Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar), and Rap1 plays roles in the MAPK pathway (46York R.D. Yao H. Dillon T. Ellig C.L. Eckert S.P. McCleskey E.W. Stork P.J. Nature. 1998; 392: 622-626Crossref PubMed Scopus (762) Google Scholar). We have not confirmed the interaction of SPA-1-like protein with PSD-95/SAP90 using other methods and have not tested whether it has a GAP activity. However, these findings suggest a model that the components implicated in the Ras/MAPK pathway are assembled through the complex of PSD-95/SAP90 and MAGUIN-1. This model is interesting, because the Ras/MAPK pathway is suggested to be implicated in the synaptic plasticity (reviewed in Ref. 47Finkbeiner S. Greenberg M.E. Neuron. 1996; 16: 233-236Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar). We are now testing this model. MAGUIN-1 is Triton X-100-insoluble and recruits PSD-95/SAP90 and S-SCAM into the Triton X-100-insoluble fraction. SAPAP has a similar activity for PSD-95/SAP90 and S-SCAM (22Deguchi M. Hata Y. Takeuchi M. Ide N. Hirao K. Yao I. Irie M. Toyoda A. Takai Y. J. Biol. Chem. 1998; 273: 26269-26272Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). 2K. Hirao, unpublished observation. These findings suggest that PSD-95/SAP90 and S-SCAM are connected to the Triton X-100-insoluble structures via the PDZ domain by MAGUIN-1 and via the GK domain by SAPAP. MAGUIN-2 does not bind to PSD-95/SAP90 or S-SCAM. MAGUIN-2 may compete with MAGUIN-1 for the same ligands, such as Raf kinase, and switch off these ligands from the network around PSD-95/SAP90 and S-SCAM. C. elegans R01H10.8 also has a structure similar to that of MAGUINs and may be a homologue of MAGUINs (28Ponting C.P. Protein Sci. 1995; 4: 1928-1930Crossref PubMed Scopus (142) Google Scholar). C. eleganshas a putative S-SCAM homologue, K01A.6. Analysis of the mutants of R01H10.8 and K01A.6 may enlighten the physiological function of MAGUINs and the significance of the interaction of MAGUIN-1 with S-SCAM. We thank Nils Brose (Max Planck Institute) for the monoclonal anti-NMDAR1 antibody.