Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Nitric Oxide Fully Protects against UVA-induced Apoptosis in Tight Correlation with Bcl-2 Up-regulation

1999; Elsevier BV; Volume: 274; Issue: 10 Linguagem: Inglês

10.1074/jbc.274.10.6130

ISSN

1083-351X

Autores

Christoph V. Suschek, Verena Krischel, D. Bruch‐Gerharz, Denise Berendji, Jean Krutmann, Klaus‐Dietrich Kröncke, Victoria Kolb-Bachofen,

Tópico(s)

Redox biology and oxidative stress

Resumo

A variety of toxic and modulating events induced by UVA exposure are described to cause cell death via apoptosis. Recently, we found that UV irradiation of human skin leads to inducible nitric-oxide synthase (iNOS) expression in keratinocytes and endothelial cells (ECs). We have now searched for the role of iNOS expression and nitric oxide (NO) synthesis in UVA-induced apoptosis as detected by DNA-specific fluorochrome labeling and in DNA fragmentation visualized by in situ nick translation in ECs. Activation with proinflammatory cytokines 24 h before UVA exposure leading to iNOS expression and endogenous NO synthesis fully protects ECs from the onset of apoptosis. This protection was completely abolished in the presence of the iNOS inhibitorl-N 5-(1-iminoethyl)-ornithine (0.25 mm). Additionally, preincubation of cells with the NO donor (Z)-1-[N(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate at concentrations from 10 to 1000 μm as an exogenous NO-generating source before UVA irradiation led to a dose-dependent inhibition of both DNA strand breaks and apoptosis. In search of the molecular mechanism responsible for the protective effect, we find that protection from UVA-induced apoptosis is tightly correlated with NO-mediated increases in Bcl-2 expression and a concomitant inhibition of UVA-induced overexpression of Bax protein. In conclusion, we present evidence for a protective role of iNOS-derived NO in skin biology, because NO either endogenously produced or exogenously applied fully protects against UVA-induced cell damage and death. We also show that the NO-mediated expression modulation of proteins of the Bcl-2 family, an event upstream of caspase activation, appears to be the molecular mechanism underlying this protection. A variety of toxic and modulating events induced by UVA exposure are described to cause cell death via apoptosis. Recently, we found that UV irradiation of human skin leads to inducible nitric-oxide synthase (iNOS) expression in keratinocytes and endothelial cells (ECs). We have now searched for the role of iNOS expression and nitric oxide (NO) synthesis in UVA-induced apoptosis as detected by DNA-specific fluorochrome labeling and in DNA fragmentation visualized by in situ nick translation in ECs. Activation with proinflammatory cytokines 24 h before UVA exposure leading to iNOS expression and endogenous NO synthesis fully protects ECs from the onset of apoptosis. This protection was completely abolished in the presence of the iNOS inhibitorl-N 5-(1-iminoethyl)-ornithine (0.25 mm). Additionally, preincubation of cells with the NO donor (Z)-1-[N(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate at concentrations from 10 to 1000 μm as an exogenous NO-generating source before UVA irradiation led to a dose-dependent inhibition of both DNA strand breaks and apoptosis. In search of the molecular mechanism responsible for the protective effect, we find that protection from UVA-induced apoptosis is tightly correlated with NO-mediated increases in Bcl-2 expression and a concomitant inhibition of UVA-induced overexpression of Bax protein. In conclusion, we present evidence for a protective role of iNOS-derived NO in skin biology, because NO either endogenously produced or exogenously applied fully protects against UVA-induced cell damage and death. We also show that the NO-mediated expression modulation of proteins of the Bcl-2 family, an event upstream of caspase activation, appears to be the molecular mechanism underlying this protection. Exposure of eukaryotic cells to UVA radiation results in cellular inactivation and death (1Tyrrell R.M. Keyse S.M. J. Photochem. Photobiol. B. 1990; 4B: 349-361Crossref Scopus (268) Google Scholar, 2Godar D.E. Lucas A.D. Photochem. Photobiol. 1995; 62: 108-113Crossref PubMed Scopus (107) Google Scholar). UVA-induced oxidative damage has been reported to occur in lipids (3Roshchupkin D.I. Pelenitsyn A.B. Potapenko A.Y. Talitsky V.V. Vladimirov Y.A. Photochem. Photobiol. 1975; 21: 63-69Crossref PubMed Scopus (42) Google Scholar), coenzymes (4Cunningham M.L. Johnson J.S. Giovanazzi S.M. Peak M.J. Photochem. Photobiol. 1985; 42: 125-128Crossref PubMed Scopus (133) Google Scholar), and DNA (5Peak J.G. Peak M.J. Mutat. Res. 1991; 246: 187-191Crossref PubMed Scopus (103) Google Scholar). On the level of organelles, nucleated mammalian cells exposed to UVA radiation were reported to bear damaged cellular structures, notably the microtubuli (6Zamansky G.B. Chou I.-N. J. Invest. Dermatol. 1987; 89: 603-606Abstract Full Text PDF PubMed Google Scholar), the plasma membrane, the nuclear membranes, and the rough endoplasmic reticulum (7Thomas D.P. Godar D.E. Bailey G.W. Hall E.L. Proceedings, Forty-ninth Annual Meeting, Electron Microscopy Society of America. San Francisco Press, San Francisco, CA1991: 104-105Google Scholar, 8Godar D.E. Beer J.Z. Urbach F. Biological Responses to Ultraviolet A Radiation. Valdenmar Publishing Co., Overland Park, KS1992: 65-73Google Scholar). Besides causing membrane damage, UVA radiation is also known to result in DNA damage, mostly in the form of single-strand breaks and protein-DNA cross-links. The amount of UVA radiation-mediated damage to membranes and DNA was found to correlate with the onset of cell death via apoptosis (5Peak J.G. Peak M.J. Mutat. Res. 1991; 246: 187-191Crossref PubMed Scopus (103) Google Scholar, 9Godar D.E. Thomas D.P. Miller S.A. Lee W. Photochem. Photobiol. 1993; 57: 1018-1026Crossref PubMed Scopus (51) Google Scholar). Apoptosis is a distinct form of cell death controlled by an internally encoded suicide program. The morphological changes associated with apoptosis include the condensation of nucleoplasm, blebbing of cytoplasmic membranes, and fragmentation of the cell into apoptotic bodies that are rapidly phagocytosed by neighboring cells. The biochemical markers of apoptosis include activation of a caspase cascade, DNA fragmentation into nucleosomal fragments, and cleavage of various caspase substrates (10Steller H. Science. 1995; 267: 1445-1449Crossref PubMed Scopus (2444) Google Scholar, 11Hale A.J. Smith C.A. Sutherland L.C. Stoneman V.E.A. Longthorne V.L. Culhane A.C. Williams G.T. Eur. J. Biochem. 1996; 236: 1-26Crossref PubMed Scopus (617) Google Scholar), including gelsolin, leading to rounding and detachment of cells (12Kothakota S. Azuma T. Reinhard C. Klippel A. Tang J. Chu K. McGarry T.J. Kirschner M.W. Koths K. Kwiatkowski D.J. Williams L.T. Science. 1997; 278: 294-299Crossref PubMed Scopus (1050) Google Scholar), and nuclear lamin, allowing for nuclear fragmentation (13White E. Genes Dev. 1996; 10: 1-15Crossref PubMed Scopus (1328) Google Scholar, 14Rowan S. Fisher D.E. Leukemia (Baltimore). 1997; 11: 457-465Crossref PubMed Scopus (112) Google Scholar). A plethora of anti-oxidant and antiapoptotic defense mechanisms exist in mammalian cells. These can be broadly classified into the expression of enzymes, including superoxide dismutase, catalase, and several peroxidases, compounds to quench reactive oxygen intermediates like ascorbate, ureic acid, carotenoids, and glutathione (15Black H.S. Photochem. Photobiol. 1987; 46: 213-221Crossref PubMed Scopus (307) Google Scholar), or apoptosis-protective proteins such as Bcl-2 as critical factors controlling the apoptosis program (14Rowan S. Fisher D.E. Leukemia (Baltimore). 1997; 11: 457-465Crossref PubMed Scopus (112) Google Scholar). Recently, it has also been shown that the radical nitric oxide (NO), 1The abbreviations used are: EC, endothelial cell; NO, nitric oxide; NOS, nitric-oxide synthase; iNOS, inducible NOS; IL-1β, interleukin 1β; TNF-α, tumor necrosis factor α; DETA/NO, (Z)-1-[N-(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate; DETA, denitrosilated DETA/NO; NIO, l-N 5-(1-iminoethyl)-ornithine; PBS, phosphate-buffered saline; FCS, fetal calf serum; PCR, polymerase chain reaction. which is known to exert cytotoxic effects and mediate onset of apoptosis in a variety of mammalian cells (16Kröncke K.-D. Fehsel K. Kolb-Bachofen V. Nitric Oxide. 1997; 1: 107-120Crossref PubMed Scopus (475) Google Scholar), may also protect against the injurious actions of superoxide, hydrogen peroxide, and alkyl peroxides (17Wink D.A. Hanbauer I. Grisham M.B. Laval F. Nims R.W. Laval J. Cook J. Paclli R. Liebmann J. Krishna M. Ford P.C. Mitchell J.B. Curr. Top. Cell. Regul. 1996; 34: 159-187Crossref PubMed Scopus (262) Google Scholar) as putative mediators of UV radiation-induced cytotoxicity. NO and equal amounts of citrulline are synthesized from the guanidino nitrogen of l-arginine by nitric-oxide synthases (NOSs) found in endothelial cells and neurons and upon activation in macrophages and many other cell types. This enzyme family consists of three isoenzymes: the endothelial ecNOS and the neuronal ncNOS are constitutively expressed and calcium/calmodulin-regulated and produce regulated and low amounts of NO for short pulses, whereas the cytokine-inducible and calcium-independent isoenzyme (iNOS) synthesizes large amounts of NO for long periods of time (18Kröncke K.-D. Fehsel K. Kolb-Bachofen V. Biol. Chem. 1995; 376: 327-343Crossref PubMed Scopus (169) Google Scholar, 19Förstermann U. Closs E.I. Pollock J.S. Nakane M. Schwarz P. Gath I. Kleinert H. Hypertension. 1994; 23: 1121-1131Crossref PubMed Scopus (1012) Google Scholar). During inflammatory processes cytokines are known modulators of endothelial cell functions (20Prober J.S. Cotran R.S. Physiol. Rev. 1990; 70: 427-451Crossref PubMed Scopus (1139) Google Scholar). One prominent effect that cytokines can exert in endothelial cells is the induction of iNOS, followed by high output NO synthesis (21Lamas S. Michel T. Collins T. Brenner B.M. Marsden P.A. J. Clin. Invest. 1992; 90: 879-887Crossref PubMed Scopus (80) Google Scholar, 22Kilbourn R.G. Belloni P. J. Natl. Cancer Inst. 1990; 82: 772-776Crossref PubMed Scopus (445) Google Scholar). The iNOS-generated NO is thought to serve mainly as nonspecific immune protection (23Liew F.Y. Cox F.E.G. Immunol. Today. 1991; 12: A17-A21Abstract Full Text PDF PubMed Scopus (307) Google Scholar), and prolonged iNOS activity was described as dangerous for the host, as evidenced by its role in the pathogenesis of septic shock and cytokine-induced hypotension (24Kilbourn R.G. Griffith O.W. J. Natl. Cancer Inst. 1992; 84: 827-831Crossref PubMed Scopus (264) Google Scholar), the suppression of various cellular functions (25Mills C.D. J. Immunol. 1991; 146: 2719-2723PubMed Google Scholar, 26Holt P.G. Oliver J. Bilyk N. McMenamin C. McMenamin P.G. Kraal G. Thepen T. J. Exp. Med. 1993; 177: 397-407Crossref PubMed Scopus (462) Google Scholar, 27Corbett J.A. Sweetland M.A. Wang J.L. Lancaster Jr., J.R. McDaniel M.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1731-1735Crossref PubMed Scopus (408) Google Scholar), inflammatory tissue destruction (28Kolb H. Kolb-Bachofen V. Diabetologia. 1992; 35: 796-797PubMed Google Scholar), and the induction of apoptosis (18Kröncke K.-D. Fehsel K. Kolb-Bachofen V. Biol. Chem. 1995; 376: 327-343Crossref PubMed Scopus (169) Google Scholar). Recently, UV irradiation has been shown to modulate local NO production in human skin (29Deliconstantinos G. Villiotu V. Stravides J.C. Br. J. Pharmacol. 1995; 114: 1257-1265Crossref PubMed Scopus (123) Google Scholar). Additionally, our observation of a strong epidermal as well as endothelial iNOS expression in UV-irradiated normal skin (30Kuhn A. Fehsel K. Lehmann P. Krutmann J. Rizicka T. Kolb-Bachofen V. J. Invest. Dermatol. 1998; 111: 149-153Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar) led us to search for a possible role of cutaneous UV-induced NO formation. Here, we tested the role of iNOS-generated as well as exogenously added NO in the UVA-induced apoptosis of resting or cytokine-activated ECs, respectively. The experiments presented here demonstrate for the first time a NO-mediated modulation of the Bcl family of proteins as a strong protective mechanism rescuing ECs from UVA-induced cell death. Recombinant human interleukin 1β (IL-1β), recombinant human tumor necrosis factor α (TNF-α), and recombinant murine IFN-γ were obtained from HBT (Leiden, Netherlands). Endothelial cell growth supplement, Neutral Red (3% solution), type I collagen, collagenase (from Clostridium histolyticum), rabbit anti-human von Willebrand factor antiserum, and Hoechst dye H33342 were from Sigma. Monoclonal antibody Ox43 was from Serotec (Camon, Wiesbaden, Germany). The rabbit anti-rat Bcl-2 antibody and Bax antisera were from PharMingen (San Diego, CA). Peroxidase-conjugated porcine anti-rabbit IgG was from DAKO (Hamburg, Germany), and peroxidase-conjugated goat anti-mouse IgG was fromZymed Laboratories Inc. Trypsin, EDTA, fetal calf serum (FCS, endotoxin-free), RPMI 1640 medium (endotoxin-free), biotin-dUTP, Kornberg polymerase, dGTP, dATP, dCTP, dithiothreitol, oligo(dT)16 primer, reverse transcriptase, andTaq polymerase were purchased from Boehringer Mannheim or Life Technologies, Inc. 3,3′-Diaminobenzidine was from Serva GmbH (Heidelberg, Germany). The interleukin-converting enzyme inhibitor Z-VAD was obtained from Enzyme Systems (Livermore, CA). The NO donor (Z)-1-[N-(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA/NO) was kindly provided by Prof. H. Weber (Heinrich-Heine-University of Düsseldorf, Düsseldorf, Germany). Denitrosilated DETA/NO (DETA) was obtained by incubating stock solutions (50 mm) of DETA/NO for 10 days at 37 °C. The iNOS inhibitorl-N5-(1-iminoethyl)-ornithine (NIO) was a kind gift from Boehringer Mannheim. We used a Sellas-2000 lamp (Sellas Medizinische Geräte GmbH, Geveisberg, Germany) emitting the UVA1 spectrum (340–390 nm) as a UVA source. ECs were isolated by outgrowth from male Wistar rat aortic rings exactly as described previously (31McGuire P.G. Orkin R.W. Lab. Invest. 1987; 57: 94-104PubMed Google Scholar). Aortic segments were placed on top of a collagen gel (1.8 mg collagen/ml) in 24-well tissue culture plates and incubated in RPMI 1640 medium with 20% FCS and 100 μg endothelial cell growth supplement/ml in a humidified incubator at 37 °C in a 95% air/5% CO2atmosphere for 5 days. Aortic explants were then removed, and cells were detached with 0.25% collagenase in Hanks' balanced salt solution and replated onto plastic culture dishes in RPMI 1640 medium with 20% FCS. Cells were subcultured for up to eight passages, and removal from culture dishes for each passage was performed by treatment with trypsin/EDTA. Cells were passaged from tissue culture dishes onto sterile glass coverslips and allowed to grow as subconfluent monolayers. Cells were washed with PBS and fixed with acetone at −20 °C for 10 min, followed by inhibition of endothelial peroxidase activity with 0.3% H2O2 in ethanol and three washing steps in Tris-buffered saline. After blocking unspecific binding with 0.5% bovine serum albumin in Tris-buffered saline for 30 min and rinsing, specimens were incubated with a 1:50 dilution of rabbit anti-human-von Willebrand factor antiserum, which was previously shown to cross-react with the rat antigen (32Suschek C. Fehsel K. Kröncke K.-D. Sommer A. Kolb-Bachofen V. Am. J. Pathol. 1994; 145: 685-695PubMed Google Scholar), in a moist chamber for 45 min. After an additional wash, slides were incubated in a 1:50 dilution of peroxidase-conjugated porcine anti-rabbit IgG for 45 min at room temperature. After washing, peroxidase activity was visualized with 0.05% diaminobenzidine plus 0.015% H2O2 for 10 min at room temperature. Control cultures were incubated with a nonrelevant rabbit hyperimmune serum instead of the first antiserum. Positive controls (human platelets) and negative controls (rat alveolar macrophages and the fibroblastoma cell line L929) were also tested with this anti-von Willebrand factor antiserum. The rat vascular endothelium-specific monoclonal antibody Ox43 (33Robinson A.P. White T.M. Mason D.W. J. Immunol. 1986; 57: 231-237Google Scholar) was used in a 1:50 dilution. A peroxidase-conjugated goat anti-mouse IgG was diluted 1:50 before use. Otherwise, conditions were as described above. All measurements were performed with cells from passages two to eight. Endothelial cells (2 × 105) were cultured in 12-well tissue culture plates or on 8-well chamber Tec glass slides in a humidified incubator at 37 °C in a 95% air/5% CO2 atmosphere in RPMI 1640 medium with 20% FCS. For iNOS induction and endogenous NO production, endothelial cells were activated 24 h before UVA irradiation (2, 4, 6, 8, and 10 J/cm2) by the addition of IL-1β (200 units/ml), IL-1β plus TNF-α (500 units/ml), or IL-1β plus TNF-α plus IFN-γ (100 units/ml). Inhibition of the cytokine-induced iNOS activity was reached by adding the iNOS inhibitor NIO (0.25 or 0.5 mm) to the activated endothelial cell cultures. NIO was present in the culture medium during cytokine activation as well as during and 24 h after UVA irradiation. Additionally, 24 h before UVA irradiation, resident endothelial cells were incubated with the NO donor DETA/NO or DETA alone at the concentrations indicated. 10 min before UVA exposure, cells were washed extensively with PBS and covered with 1 ml of Hanks' balanced salt solution/HEPES or RPMI 1640 medium without phenol red; after irradiation, cells were washed in PBS, and RPMI 1640/FCS medium was added. 24 h after irradiation, the relative number of living ECs was detected by neutral red staining (34Finter N.B. J. Gen. Virol. 1969; 5: 419-425Crossref Google Scholar). Cells were incubated for 90 min with neutral red (1:100 dilution of the 3% solution) and then washed twice with PBS. Cells were then dried and lysed by isopropanol containing 0.5% of 1 n HCl. Extinctions of the supernatants were then measured at 530 nm. Additionally, the viability of endothelial cells was routinely controlled at the beginning and end of every experiment using the trypan blue exclusion assay. After 24 h of incubation, nitrite was determined in these control culture supernatants using the diazotization reaction as modified by Wood et al. (35Wood K.S. Buga G.M. Byrns R.E. Ignarro L.J. Biochem. Biophys. Res. Commun. 1990; 170: 80-87Crossref PubMed Scopus (160) Google Scholar) and using NaNO2 as a standard. DNA strand breaks of cells grown on 8-well chamber Tec slides were visualized by the in situ nick translation method (36Fehsel K. Kolb-Bachofen V. Kolb H. Am. J. Pathol. 1991; 139: 251-254PubMed Google Scholar) 1–24 h after UVA irradiation (2–10 J/cm2). In acetone-fixed cells, endogenous peroxidase activity was blocked with methanol plus 0.3% H202 for 30 min. The nick translation mixture contained 3 μm biotin-dUTP, 5 units/100 μl Kornberg polymerase, 3 μm each of dGTP, dATP, and dCTP, 50 mm Tris-HCL, pH 7.5, 5 mmMgC12, and 0.1 mm dithiothreitol, and the reaction was performed at room temperature for 20 min. Slides were washed in PBS and processed for immunocytochemical detection of biotin-labeled UTP by peroxidase-labeled avidin, followed by an enzyme reaction using 3,3′-diaminobenzidine as the substrate. In each sample, a minimum of 500 cells were counted, and labeled nuclei were expressed as a percentage of the total number of nuclei. 1–24 h after UVA irradiation (2–10 J/cm2), endothelial cells grown in 12-well culture plates were washed with PBS and stained with Hoechst dye H33342 (8 μg/ml) for 5 min, and nuclei were visualized using a Zeiss fluorescence microscope. In each sample, a minimum of 400 cells were counted, and condensed or fragmented nuclei were expressed as a percentage of the total number of nuclei. Total cellular RNA (1 μg each), prepared 16 h after irradiation, from adherent growing nonirradiated and UVA-irradiated (6 J/cm2) ECs that were resting or cytokine-activated (addition of 200 units/ml IL-1β + 500 units/ml TNF-α + 100 units/ml IFN-γ 24 h before UVA irradiation), or preincubated with DETA/NO or DETA (1 mmeach for 24 h before UVA irradiation) (37Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (64659) Google Scholar) was used for cDNA synthesis (38Gubler W. Hoffman B. Gene (Amst.). 1983; 25: 263-269Crossref PubMed Scopus (3344) Google Scholar). Reverse transcription was carried out at 42 °C for 60 min, using the oligo(dT)16 primer. The cDNA was then used as a template for PCR, primed by either the oligonucleotides TATGATAACCGGGAGATCGTG (sense; bases 26–45 of rat Bcl-2 cDNA) and CAGATGCCGGTTCAGGTACTC (antisense; bases 526–546 of rat Bcl-2 cDNA) for specific Bcl-2 amplification (39Tilly J.L. Tilly K.I. Kenton M.L. Johnson A.L. Endocrinology. 1995; 136: 232-241Crossref PubMed Google Scholar) or the oligonucleotides CAAGAAGCTGAGCGAGTGTCT (sense; bases 62–82 of rat Bax cDNA) and GGTTCTGATCAGCTCGGGCAC (antisense; bases 279–299 of rat Bax cDNA) for specific Bax amplification (39Tilly J.L. Tilly K.I. Kenton M.L. Johnson A.L. Endocrinology. 1995; 136: 232-241Crossref PubMed Google Scholar). For specific rat glyceraldehyde-3-phosphate dehydrogenase cDNA amplification, the oligonucleotides CAACTACATGGTTTACATGTTCC (sense; rat glyceraldehyde-3-phosphate dehydrogenase cDNA bases 153–175) and GGACTGTGGTCATGAGTCCT (antisense; rat glyceraldehyde-3-phosphate dehydro- genase cDNA bases 549–568) were used (40Sirsjö A. Söderkvist P. Sundquist T. Calsson M. Öst M. Gidlöf A. FEBS Lett. 1994; 338: 191-196Crossref PubMed Scopus (58) Google Scholar). Additionally, to exclude unspecific amplification by mRNA or DNA contamination, control PCR was performed with all additives but without cDNA or with the RNA probes, respectively. PCR was carried out following standard protocols (41Saiki R.K. Geefand D.H. Stoffel S. Scharf S. Higuchi R. Horn G.T. Mullis M.K. Erlich H.A. Science. 1988; 239: 487-491Crossref PubMed Scopus (14401) Google Scholar) with the following cycle profile: 33 cycles with 30 s at 94 °C, 30 s at 58 °C, and 30 s at 72 °C for Bcl-2 or Bax mRNA amplification and 25 cycles with 30 s at 94 °C, 30 s at 62 °C, and 30 s at 72 °C for glyceraldehyde-3-phosphate dehydrogenase mRNA amplification. A final incubation step was performed at 72 °C for 10 min. An aliquot of each reaction was subjected to electrophoresis on 1.5% agarose gels. Bands were visualized by ethidium bromide staining. After a 16-h incubation after UVA irradiation (6 J/cm2), resting, cytokine-activated (200 units/ml IL-1β + 500 units/ml TNF-α + 100 units/ml IFN-γ), EC cultures preincubated with DETA/NO (1 mm for 24 h before UVA irradiation) or DETA (1 mm for 24 h before UVA irradiation) were washed, and adherent growing cells were lysed, scraped from the dishes, transferred to a microcentrifuge tube, and boiled for 5 min exactly as described previously (42Yang J. Liu X. Bhalla K. Kim C.N. Ibrado A.M. Cai J. Peng T.-I. Jones D.P. Wang X. Science. 1997; 275: 1129-1132Crossref PubMed Scopus (4452) Google Scholar). Proteins (50 μg/lane) were separated by electrophoresis in a 12% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. To control equal loading of total protein in all lanes, blots were stained with Ponceau S solution immediately after transfer. Blots were incubated for 2 h with blocking buffer (2% bovine serum albumin, 5% non-fat milk powder, and 0.1% Tween 20 in PBS buffer), incubated for 1 h with a 1:1000 dilution of the anti-Bcl-2 or anti-Bax antiserum, washed, incubated for 1 h with a 1:1000 dilution of the secondary horseradish peroxidase-conjugated porcine anti-rabbit IgG antibody, incubated for 5 min in ECL reagent (Pierce, Rockford, IL), placed into a plastic bag, and exposed to an enhanced autoradiographic film. Data are given as arithmetical means ± S.D. Values were calculated using Student's ttest (two-tailed for independent samples). UVA irradiation of endothelial cells in a dose-dependent manner leads to cell death via apoptosis. Resting ECs were exposed to UVA radiation with increasing intensities as indicated. The relative number of viable or dead cells was determined using neutral red staining or trypan blue exclusion, respectively. Nuclear fragmentation or DNA strand breaks were visualized using Hoechst DNA dye H33342 or the in situ nick translation method, respectively. Irradiation of ECs with UVA in a dose-dependent manner led to endothelial cell death (Fig. 1). We find that 24 h after maximal UVA irradiation with 10 J/cm2, 37 ± 7% of the initial cell number are still adherent; of these, about half were trypan blue-positive (Fig.1 A). Thus, maximal UVA irradiation leads to the cell death of 80% of cells within 24 h. About 60% of cells detach from the dish as a first indication for ongoing apoptosis, in which cellular detachment and cytoskeletal disruption occur. Half-maximal cytotoxicity was found at a UVA dose of 6 ± 1 J/cm2 (Fig.1 A). Indeed, at and above 6 J/cm2, staining with Hoechst DNA dye or in situ nick translation revealed nuclear alterations such as chromatin condensation and fragmentation, as well as DNA strand breaks in 35–80% of adherent cells (Figs. 1 Band 2, C andD).Figure 2UVA irradiation of endothelial cells leads to apoptosis and DNA strand breaks. Resident or Z-VAD-treated (30 μm) ECs were exposed to UVA radiation (6 J/cm2), and after 16 h, apoptotic nuclei or nuclear DNA strand breaks were visualized using Hoechst DNA dye H33342(A, C, and E) or the in situ nick translation method (B, D, and F), respectively. UVA irradiation leads to nuclear chromatin condensation and nuclear fragmentation (C) as well as DNA strand breaks in most of the nuclei (D) as indicators of ongoing apoptosis, whereas Z-VAD (30 μm) inhibits the development of these apoptosis symptoms (E and F). A andB, nonirradiated control cultures. Magnification: ×650 inA and E, ×700 in C, ×300 in B, D, and F.View Large Image Figure ViewerDownload (PPT) Next we examined the time course of UVA-induced cell death, nuclear damage, and DNA damage; between 8 and 16 h after irradiation with 6 (Fig. 1 C) or 10 J/cm2 (Fig. 1 F), we found a highly significant increase in the number of nuclei with DNA strand breaks, indicating that DNA damage is not an immediate consequence of UVA irradiation. At ≥16 h after UVA irradiation, the number of altered nuclei increased to 35–65% of adherent cells at 6 J/cm2 or 40–90% of adherent cells at 10 J/cm2. Three lines of evidence argue in favor of apoptosis as the main course of cell death. As shown in Fig. 2, Hoechst staining of UVA-irradiated cells led to the formation of shrunken pygnotic nuclei and nuclear fragmentation (Fig. 2 C). Furthermore, DNA strand breaks occur (Fig. 2 D) in focal areas of unbroken nuclei 16 h after half-maximal UVA irradiation (6 J/cm2). Finally, incubation of ECs with the caspase inhibitor Z-VAD (30 μm) for 6 h before and for 24 h after UVA irradiation completely inhibits all morphological alterations of nuclei (Fig. 2, E and F). ECs were activated by proinflammatory cytokines (200 units/ml IL-1β, 500 units/ml TNF-α, and 100 units/ml IFN-γ). Activation led to the production of NO as evidenced by increased nitrite concentrations in culture supernatants. Incubation of endothelial cell cultures with different combinations of cytokines (200 units/ml IL-1β, IL-1β plus 500 units/ml TNF-α, and IL-1β plus TNF-α plus 100 units/ml IFN-γ) shows a specific pattern of iNOS activity (Fig.3 A), exactly as described previously (32Suschek C. Fehsel K. Kröncke K.-D. Sommer A. Kolb-Bachofen V. Am. J. Pathol. 1994; 145: 685-695PubMed Google Scholar, 43Suschek C. Rothe H. Fehsel K. Enczmann J. Kolb-Bachofen V. J. Immunol. 1993; 151: 3283-3291PubMed Google Scholar). The cultures of resident or activated cells were exposed to UVA radiation, and the relative number of living cells was determined after an additional 24 h. A highly significant protection against UVA-induced cell death in close correlation to the amount of NO produced was observed (Fig. 3,B–D). EC cultures incubated with the single cytokine IL-1β show a half-maximal iNOS activity, leading to 3.5 ± 0.6 nmol of nitrite in culture supernatants. This leads to significantly protective effects against UVA-induced cell death (40 ± 5% surviving cells at 8 J/cm2; 33 ± 5% surviving cells at 10 J/cm2). Maximal endothelial iNOS activity was achieved after incubation with the cytokine combinations IL-1β plus TNF-α (10.7 ± 1.0 nmol of nitrite) or Il-1β plus TNF-α plus IFN-γ (11.8 ± 1.7 nmol of nitrite) and resulted in a highly significant protection (90 ± 6% of surviving cells at 6 J/cm2; 82 ± 7% of surviving cells at 10 J/cm2). When activation of ECs was performed in the presence of the NOS inhibitor NIO (0.25 mm), complete abrogation of the protective effects further indicated that iNOS activity does indeed mediate the protective mechanism (Fig.3 C). Cell survival after UVA irradiation shows a linear correlation with iNOS activity as measured by nitrite concentrations in culture supernatants (Fig. 3 D). Additionally, parallel to these experiments, apoptotic nuclei and DNA strand breaks were visualized 16 h after half-maximal UVA irradiation (6 J/cm2). In cytokine-activated cultures (IL-1β plus TNF-α plus IFN-γ), cells are fully protected from UVA-induced apoptosis (Fig. 4,A and B) as seen in comparison to resident and UVA-irradiated cells (Fig. 2, C and D) where apoptosis is frequent. Inhibition of endothelial NO production by the addition of NIO (0.25 mm) abrogates this protection (Fig.4, C and D). To test whether NO alone is sufficient to mediate the above described protection, resident ECs were incubated 24 h before UVA irradiation with various concentrations of the chemical NO donor DETA/NO. Neutral red staining of living cells performed 24 h after UVA irradiation revealed that at and above concentrations of 50 μm DETA/NO, protection was always significant (Fig.5 A). With 1 mmDETA/NO, full protection was achieved (86 ± 9% of surviving cells

Referência(s)