Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Estrogen Receptor α Enhances the Rate of Oxidative DNA Damage by Targeting an Equine Estrogen Catechol Metabolite to the Nucleus

2009; Elsevier BV; Volume: 284; Issue: 13 Linguagem: Inglês

10.1074/jbc.m807860200

ISSN

1083-351X

Autores

Zhican Wang, Gihani T. Wijewickrama, Kuan-wei Peng, Birgit M. Dietz, Long Yuan, Richard B. van Breemen, Judy L. Bolton, Gregory R. J. Thatcher,

Tópico(s)

Genomics, phytochemicals, and oxidative stress

Resumo

Exposure to estrogens increases the risk of breast and endometrial cancer. It is proposed that the estrogen receptor (ER) may contribute to estrogen carcinogenesis by transduction of the hormonal signal and as a "Trojan horse" concentrating genotoxic estrogen metabolites in the nucleus to complex with DNA, enhancing DNA damage. 4-Hydroxyequilenin (4-OHEN), the major catechol metabolite of equine estrogens present in estrogen replacement formulations, autoxidizes to a redox-cycling quinone that has been shown to cause DNA damage. 4-OHEN was found to be an estrogen of nanomolar potency in cell culture using a luciferase reporter assay and, using a chromatin immunoprecipitation assay, was found to activate ERα binding to estrogen-responsive genes in MCF-7 cells. DNA damage was measured in cells by comparing ERα(+) versus ERα(-) cells and 4-OHEN versus menadione, a reactive oxygen species (ROS)-generating, but non-estrogenic, quinone. 4-OHEN selectively induced DNA damage in ERα(+) cells, whereas menadione-induced damage was not dependent on cellular ER status. The rate of 4-OHEN-induced DNA damage was significantly enhanced in ERα(+) cells, whereas ER status had no effect on the rate of menadione-induced damage. Imaging of ROS induced by 4-OHEN showed accumulation selective for the nucleus of ERα(+) cells within 5 min, whereas in ERα(-) or menadione-treated cells, no selectivity was observed. These data support ERα acting as a Trojan horse concentrating 4-OHEN in the nucleus to accelerate the rate of ROS generation and thereby amplify DNA damage. The Trojan horse mechanism may be of general importance beyond estrogen genotoxins. Exposure to estrogens increases the risk of breast and endometrial cancer. It is proposed that the estrogen receptor (ER) may contribute to estrogen carcinogenesis by transduction of the hormonal signal and as a "Trojan horse" concentrating genotoxic estrogen metabolites in the nucleus to complex with DNA, enhancing DNA damage. 4-Hydroxyequilenin (4-OHEN), the major catechol metabolite of equine estrogens present in estrogen replacement formulations, autoxidizes to a redox-cycling quinone that has been shown to cause DNA damage. 4-OHEN was found to be an estrogen of nanomolar potency in cell culture using a luciferase reporter assay and, using a chromatin immunoprecipitation assay, was found to activate ERα binding to estrogen-responsive genes in MCF-7 cells. DNA damage was measured in cells by comparing ERα(+) versus ERα(-) cells and 4-OHEN versus menadione, a reactive oxygen species (ROS)-generating, but non-estrogenic, quinone. 4-OHEN selectively induced DNA damage in ERα(+) cells, whereas menadione-induced damage was not dependent on cellular ER status. The rate of 4-OHEN-induced DNA damage was significantly enhanced in ERα(+) cells, whereas ER status had no effect on the rate of menadione-induced damage. Imaging of ROS induced by 4-OHEN showed accumulation selective for the nucleus of ERα(+) cells within 5 min, whereas in ERα(-) or menadione-treated cells, no selectivity was observed. These data support ERα acting as a Trojan horse concentrating 4-OHEN in the nucleus to accelerate the rate of ROS generation and thereby amplify DNA damage. The Trojan horse mechanism may be of general importance beyond estrogen genotoxins. An increased relative risk of breast cancer in postmenopausal women is strongly linked to several endocrine-related risk factors. One of these risk factors is long-term exposure to hormone or estrogen replacement therapy (HRT 3The abbreviations used are: HRT, hormone replacement therapy; ERT, estrogen replacement therapy; ChIP, chromatin immunoprecipitation; CM-DCF, 5-(and 6)-chloromethyl-2′,7′-dichlorofluorescein; CM-H2DCFDA, 5-(and 6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester; COMT, catechol-O-methyltransferase; DMSO, dimethyl sulfoxide; E2, 17β-estradiol; ER, estrogen receptor; ERE, estrogen-responsive element; 4-MeOEN, 4-methoxy equilenin; NAC, N-acteylcysteine; 4-OHTAM, 4-hydroxytamoxifen; 4-OHEN, 4-hydroxyequilenin; 8-oxo-dG, 8-oxo-7,8-dihydro-2′-deoxyguanosine; ROS, reactive oxygen species; MEM, minimum essential medium; PBS, phosphate-buffered saline; LC-MS/MS, liquid chromatography-tandem mass spectroscopy. or ERT). The most widely prescribed formulations in the United States contain conjugated human estrogens and B-ring unsaturated conjugated equine estrogens, the latter constituting approximately half of the estrogen content of these formulations (1Li J.J. Li S.A. Oberley T.D. Parsons J.A. Cancer Res. 1995; 55: 4347-4351PubMed Google Scholar). Observations from various clinical trials and epidemiological studies collectively support the hypothesis that estrogen contributes to breast cancer and is probably causative (2Colditz G.A. Hankinson S.E. Hunter D.J. Willett W.C. Manson J.E. Stampfer M.J. Hennekens C. Rosner B. Speizer F.E. N. Engl. J. Med. 1995; 332: 1589-1593Crossref PubMed Scopus (1467) Google Scholar, 3Key T. Appleby P. Barnes I. Reeves G. J. Natl. Cancer Inst. 2002; 94: 606-616Crossref PubMed Google Scholar, 4Grodstein F. Stampfer M.J. Colditz G.A. Willett W.C. Manson J.E. Joffe M. Rosner B. Fuchs C. Hankinson S.E. Hunter D.J. Hennekens C.H. Speizer F.E. N. Engl. J. Med. 1997; 336: 1769-1775Crossref PubMed Scopus (1138) Google Scholar, 5Lupulescu A. Cancer Investig. 1995; 13: 287-295Crossref PubMed Scopus (57) Google Scholar, 6Service R.F. Science. 1998; 279: 1631-1633Crossref PubMed Scopus (171) Google Scholar, 7Vogel V.G. Yeomans A. Higginbotham E. Breast Cancer Res. 1993; 28: 195-210Crossref Scopus (33) Google Scholar, 8Zumoff B. Proc. Soc. Exp. Biol. Med. 1998; 217: 30-37Crossref PubMed Scopus (87) Google Scholar). The large prospective Women's Health Initiative Study comparing postmenopausal women assigned HRT/ERT or placebo was terminated because of significant increases in breast cancer, stroke, and pulmonary embolism associated with therapy (9Rossouw J.E. Anderson G.L. Prentice R.L. LaCroix A.Z. Kooperberg C. Stefanick M.L. Jackson R.D. Beresford S.A. Howard B.V. Johnson K.C. Kotchen J.M. Ockene J. J. Am. Med. Assoc. 2002; 288: 321-333Crossref PubMed Scopus (13907) Google Scholar, 10Shumaker S.A. Legault C. Rapp S.R. Thal L. Wallace R.B. Ockene J.K. Hendrix S.L. Jones III, B.N. Assaf A.R. Jackson R.D. Kotchen J.M. Wassertheil-Smoller S. Wactawski-Wende J. J. Am. Med. Assoc. 2003; 289: 2651-2662Crossref PubMed Scopus (1863) Google Scholar). A recent analysis of data from the National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) registries showed that the age-adjusted incidence rate of breast cancer fell 6.7% in 2003 compared with 2002, which was linked to lowered use of HRT/ERT (11Ravdin P.M. Cronin K.A. Howlader N. Berg C.D. Chlebowski R.T. Feuer E.J. Edwards B.K. Berry D.A. N. Engl. J. Med. 2007; 356: 1670-1674Crossref PubMed Scopus (814) Google Scholar). The collective evidence supports contributions to estrogen-sensitive breast cancer from both the proliferative and antiapoptotic hormonal effects of estrogen itself (12Feigelson H.S. Henderson B.E. Carcinogenesis. 1996; 17: 2279-2284Crossref PubMed Scopus (313) Google Scholar, 13Henderson B.E. Feigelson H.S. Carcinogenesis. 2000; 21: 427-433Crossref PubMed Scopus (737) Google Scholar, 14Nandi S. Guzman R. Yang J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3650-3657Crossref PubMed Scopus (364) Google Scholar, 15Flototto T. Djahansouzi S. Glaser M. Hanstein B. Niederacher D. Brumm C. Beckmann M.W. Horm. Metab. Res. 2001; 33: 451-457Crossref PubMed Scopus (70) Google Scholar, 16Yager J.D. Davidson N.E. N. Engl. J. Med. 2006; 354: 270-282Crossref PubMed Scopus (1379) Google Scholar) and the genotoxic and mutagenic effects of estrogen metabolites (17Bolton J.L. Thatcher G.R.J. Chem. Res. Toxicol. 2008; 21: 93-101Crossref PubMed Scopus (203) Google Scholar, 18Gaikwad N.W. Yang L. Muti P. Meza J.L. Pruthi S. Ingle J.N. Rogan E.G. Cavalieri E.L. Int. J. Cancer. 2008; 122: 1949-1957Crossref PubMed Scopus (105) Google Scholar). In human breast tissue, estrogen metabolites have been detected (19Zhang Q. Aft R.L. Gross M.L. Chem. Res. Toxicol. 2008; 21: 1509-1513Crossref PubMed Scopus (16) Google Scholar), and DNA adducts of equine estrogens have been reported (20Embrechts J. Lemiere F. Van Dongen W. Esmans E.L. Buytaert P. Van Marck E. Kockx M. Makar A. J. Am. Soc. Mass Spectrom. 2003; 14: 482-491Crossref PubMed Scopus (84) Google Scholar). Human estrogen 4-hydroxy catechol metabolites, formed by the action of cytochrome P450, are proposed to be genotoxic through formation of DNA-reactive, electrophilic o-quinones and by formation of DNA-damaging, reactive oxygen species (ROS) through redox cycling (21Cavalieri E. Chakravarti D. Guttenplan J. Hart E. Ingle J. Jankowiak R. Muti P. Rogan E. Russo J. Santen R. Sutter T. Biochim. Biophys. Acta. 2006; 1766: 63-78PubMed Google Scholar, 22Bolton J.L. Toxicology. 2002; 177: 55-65Crossref PubMed Scopus (107) Google Scholar, 23Jefcoate C.R. Liehr J.G. Santen R.J. Sutter T.R. Yager J.D. Yue W. Santner S.J. Tekmal R. Demers L. Pauley R. Naftolin F. Mor G. Berstein L. J. Natl. Cancer Inst. Monogr. 2000; : 95-112Crossref PubMed Scopus (250) Google Scholar, 24Liehr J.G. Endocr. Rev. 2000; 21: 40-54Crossref PubMed Scopus (498) Google Scholar, 25Bolton J.L. Pisha E. Zhang F. Qiu S. Chem. Res. Toxicol. 1998; 11: 1113-1127Crossref PubMed Scopus (190) Google Scholar, 26Cavalieri E.L. Stack D.E. Devanesan P.D. Todorovic R. Dwivedy I. Higginbotham S. Johansson S.L. Patil K.D. Gross M.L. Gooden J.K. Ramanathan R. Cerny R.L. Rogan E.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10937-10942Crossref PubMed Scopus (686) Google Scholar). The equine estrogen equilenin is of special interest as a carcinogen because: 1) it is selectively oxidized to the more genotoxic 4-hydroxy catechol isomer (4-OHEN); and 2) 4-OHEN autoxidizes to a redox-cycling o-quinone without need for cytochrome P450 catalysis (27Zhang F. Chen Y. Pisha E. Shen L. Xiong Y. van Breemen R.B. Bolton J.L. Chem. Res. Toxicol. 1999; 12: 204-213Crossref PubMed Scopus (94) Google Scholar, 28Shen L. Pisha E. Huang Z. Pezzuto J. Krol E. Alam Z. van Breemen R. Bolton J. Carcinogenesis. 1997; 18: 1093-1101Crossref PubMed Scopus (83) Google Scholar). 4-OHEN-o-quinone induces a variety of different types of DNA damage both in vitro and in vivo, including single strand breaks (29Chen Y. Shen L. Zhang F. Lau S.S. van Breemen R.B. Nikolic D. Bolton J.L. Chem. Res. Toxicol. 1998; 11: 1105-1111Crossref PubMed Scopus (65) Google Scholar, 30Chen Y. Liu X. Pisha E. Constantinou A.I. Hua Y. Shen L. van Breemen R.B. Elguindi E.C. Blond S.Y. Zhang F. Bolton J.L. Chem. Res. Toxicol. 2000; 13: 342-350Crossref PubMed Scopus (80) Google Scholar), oxidized bases (31Liu X. Yao J. Pisha E. Yang Y. Hua Y. van Breemen R.B. Bolton J.L. Chem. Res. Toxicol. 2002; 15: 512-519Crossref PubMed Scopus (67) Google Scholar, 32Okamoto Y. Chou P.H. Kim S.Y. Suzuki N. Laxmi Y.R. Okamoto K. Liu X. Matsuda T. Shibutani S. Chem. Res. Toxicol. 2008; 21: 1120-1124Crossref PubMed Scopus (22) Google Scholar), apurinic sites, and formation of cyclic DNA adducts (20Embrechts J. Lemiere F. Van Dongen W. Esmans E.L. Buytaert P. Van Marck E. Kockx M. Makar A. J. Am. Soc. Mass Spectrom. 2003; 14: 482-491Crossref PubMed Scopus (84) Google Scholar, 33Shen L. Qiu S. Chen Y. Zhang F. van Breemen R.B. Nikolic D. Bolton J.L. Chem. Res. Toxicol. 1998; 11: 94-101Crossref PubMed Scopus (74) Google Scholar, 34Zhang F. Swanson S.M. van Breemen R.B. Liu X. Yang Y. Gu C. Bolton J.L. Chem. Res. Toxicol. 2001; 14: 1654-1659Crossref PubMed Scopus (80) Google Scholar). The estrogen receptor (ER) may play two key roles in mediating estrogen carcinogenesis: transduction of the hormonal signal and transport of genotoxic estrogen metabolites to the nucleus to complex with DNA. In the latter role, ER acts as a "Trojan horse," enhancing DNA damage. This hypothesis is persuasive for 4-OHEN because this catechol readily autoxidizes and redox cycles, theoretically generating large fluxes of ROS in the cell nucleus. However, 4-OHEN is autoxidized to a reactive quinone electrophile known to be trapped readily by glutathione and protein nucleophiles. It is not clear from previous work whether 4-OHEN represents a good ER ligand. Furthermore, the Trojan horse hypothesis has obvious weaknesses in that 4-OHEN may be trapped in the cytoplasm and may not be able to redox cycle as part of an ER-DNA complex. To test the hypothesis, the hormonal estrogenicity of 4-OHEN was assayed using cellular reporters; a comparison was made between ERα-positive and -negative cells testing 4-OHEN-induced DNA damage; a comparison was made with the ROS-generating, but non-estrogenic, quinone, menadione; and finally, nuclear localization of 4-OHEN and generation of ROS was determined by chromatin immunoprecipitation (ChIP) assay and fluorescence confocal microscopy. The Trojan horse model may be of general importance in the study of environmental estrogen genotoxins and the nuclear concentration of genotoxins by other nuclear receptors and transcription factors. The catechol estrogens were handled in accordance with NIH Guidelines for the Laboratory Use of Chemical Carcinogens (35National Institutes of Health NIH Guidelines for the Laboratory Use of Chemical Carcinogens. U. S. Government Printing Office, Washington, D. C.1981Google Scholar). Materials-All chemicals were purchased from Sigma or Fisher Scientific unless stated otherwise. 5-(and 6)-Chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate was purchased from Invitrogen. 4-OHEN was synthesized by treating equilin with Fremy's salt as described previously (36Han X. Liehr J.G. Carcinogenesis. 1995; 16: 2571-2574Crossref PubMed Scopus (144) Google Scholar) with minor modifications (27Zhang F. Chen Y. Pisha E. Shen L. Xiong Y. van Breemen R.B. Bolton J.L. Chem. Res. Toxicol. 1999; 12: 204-213Crossref PubMed Scopus (94) Google Scholar). The comet assay and Fpg FLARE comet assay kits for detection of DNA single strand breaks and oxidized bases were purchased from Trevigen (Gaithersburg, MD). All buffers and reagents used in ChIP assay were from Upstate Biotechnology (Lake Placid, NY), and antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Cell Culture Conditions-MDA-MB-231 cells were obtained from the American Type Culture Collection (Manassas, VA) and maintained in minimum essential medium (MEM) supplemented with 1% penicillin-streptomycin-fungizome, 6 μg/liter insulin, 1% GlutaMAX (Invitrogen), 5% fetal bovine serum (Atlanta Biologicals, Atlanta), and 5% CO2 at 37 °C. The S30 cell line, a stable ERα transfectant of the MDA-MB-231 cell line, was a generous gift from Dr. V. C. Jordan (Fox Chase Cancer Center, Philadelphia). The S30 cells were maintained in phenol red-free MEM supplemented with the same solution as the MDA-MB-231 cells except for the addition of 5% charcoal-dextran-treated fetal bovine serum and 500 μg/ml Geneticin. The MCF-7 cells were maintained in RPMI 1640 containing 10% fetal bovine serum, 1% penicillin-streptomycin-fungizome, 6 μg/liter insulin, and 1% GlutaMAX. The MCF-7:K1 cell line, a clonal derivative of MCF-7 cells, was a kind gift from Dr. J. Frasor (University of Illinois at Chicago) and was maintained in MEM supplemented with 1% penicillin-streptomycin-fungizome, 25 μg/ml gentamicin, 2 mm glutamine, 5% calf bovine serum (Hyclone, Logan, Utah), and 2 mg/ml sodium bicarbonate solution. Estrogen-free medium for MCF-7:K1 cells was prepared by supplementing charcoal-dextran-treated fetal bovine serum to phenol red-free MEM, whereas other components remained the same except omitting gentamicin. Transient Transfection and ERE-Luciferase Assays-Briefly, MCF-7 cells were cultured in estrogen-free media for 4 days before transfection. The cells were transfected with 2 μg of the pERE-luciferase plasmid, which contains three copies of the Xenopus laevis vitellogenin A2 ERE upstream of firefly luciferase. To normalize transfection efficiency, 1 μg of pRL-TK plasmid, which contained a cDNA encoding Renilla luciferase, was co-transfected with ERE-luciferase plasmid. Cells (4 × 105 cells/well) were transfected with ERE-luciferase, pretreated with or without 10 μm Ro-41-0960 (COMT inhibitor) for 24 h, and then treated with DMSO (0.05%), menadione (100 nm, 1 μm), E2 (1 nm), or 4-OHEN (100 nm) with or without 10 μm COMT inhibitor for 18 h. The luciferase activity in cell lysates was measured using the Dual-Luciferase assay system from Promega (Madison, WI) with a FLUOstar OPTIMA (BMG Labtech, Durham, NC). Data are reported as relative luciferase activity (firefly luciferase reading divided by the Renilla luciferase reading). Chromatin Immunoprecipitation Assay-Cells were cultured in estrogen-free media for 4 days before treatment with compounds. Cells were treated with DMSO, E2, or 4-OHEN for 45 min, washed with phosphate-buffered saline (PBS), and cross-linked with 1.5% formaldehyde at room temperature for 15 min. Cells were rinsed twice with ice-cold PBS, collected into lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl, pH 8, and 1× protease inhibitor tablet (Roche Applied Science)), and sonicated 20 times for 10 s at 10% strength (Fisher Model 300 Sonic Dismembrator) followed by centrifugation at 21,000 × g for 10 min at 4 °C. Each sample was reserved for the inputs prior to immunoprecipitation. Supernatants were collected and diluted in immunoprecipitation buffer (1% Triton X-100, 2 mm EDTA, 150 mm NaCl, 20 mm Tris-HCl, pH 8.1) containing 1× protease inhibitor followed by immunoclearing with 8 μg of sheared salmon sperm DNA and protein A-agarose slurry (40 μl of 50% slurry in TE buffer (10 mm Tris-HCl, pH 8.1, 1 mm EDTA)) for 2 h at 4 °C. After centrifugation at 5,000 × g for 1 min, immunoprecipitation was performed by gently mixing the supernatants with the antibodies against ERα (3.3 μg/ml, HC-20) or IgG (3.3 μg/ml, normal rabbit IgG) overnight at 4 °C. After immunoprecipitation, protein A-agarose slurry (40 μl) containing 8 μg of salmon sperm DNA was added, and the incubation was continued for another 2 h at 4 °C. Precipitates were obtained by centrifugation at 5,000 × g for 1 min and washed sequentially for 5 min each in TSE I (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, pH 8.1, 150 mm NaCl), TSE II (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris-HCl, pH 8.1, 500 mm NaCl), and LiCl buffer (0.25 m LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mm EDTA, 10 mm Tris-HCl, pH 8.1). Precipitates were then washed three times with TE buffer, and DNA was extracted three times with 1% SDS, 0.1 m NaHCO3. Eluates were pooled and heated at 65 °C for 16 h to reverse the formaldehyde cross-linking. DNA fragments were purified with a QIAquick PCR purification kit (Qiagen, Valencia, CA). The subsequent PCR experiment was performed to detect DNA fragments of estrogen sensitive-gene, such as the ERE sequence. The pS2-ERE forward and reverse primer sequences, from -4919 to -4806 (5′ to 3′), were GACGGAATGGGCTTCATGA and AGTGAGAGATGGCCGGAAAA, respectively. The pS2 upstream forward and reverse primer sequences (5′ to 3′), spanning the -446 to -339 region of the pS2 promoter, were GGGTCTCAGTGGTGGCAGTA and ACCGCTCATACCATCCAGTC, respectively. Single Cell Gel Electrophoresis Assay (Comet Assay)-The comet assay (37Singh N.P. McCoy M.T. Tice R.R. Schneider E.L. Exp. Cell Res. 1988; 175: 184-191Crossref PubMed Scopus (8975) Google Scholar) was carried out as recommended by the manufacturer. Briefly, after cells (1.5 × 105 cells/ml) were treated with various concentrations of test compounds, the attached cells were trypsinized, combined with suspended cells, and washed twice with chilled PBS, pH 7.4 (Ca2+- and Mg2+-free; Trevigen). The cell suspension was combined with 0.5% low melting agarose, and the mixture was immediately placed onto a CometSlide. The slides were incubated at 4 °C in the dark for gelling before immersion in prechilled lysis solution for 30 min at 4 °C and then incubated in freshly prepared alkali (pH > 13) solution for 45 min. The assay was adapted for measurement at earlier time points by quenching with excess N-acetylcysteine (NAC; 10 mm) for 1 min. As described above, cells were washed with cold PBS, trypsinized, and collected by centrifugation. The cells were further washed with cold PBS and collected by centrifugation. PBS (2 ml) was added to produce a suspension that was mixed with low melting agarose, placed on glass slides, and then incubated at 4 °C for 10 min in the dark. Alkali solution electrophoresis was performed for 10 min at 300 mA and 1 V/cm, and then the slides were immersed in prechilled 70% ethanol for 5 min and air-dried. The slides were then stained with SYBR Green and scored under a fluorescence microscope (Nikon Y-FL). The DNA damage from at least 100 cells/slide was scored in arbitrary units from 0 (intact DNA) to 4 (completely damaged DNA with tail only) (38Collins A.R. Dobson V.L. Dusinska M. Kennedy G. Stetina R. Mutat. Res. 1997; 375: 183-193Crossref PubMed Scopus (599) Google Scholar). Scores were calculated using Equation 1 in which NA (intact DNA) and NB - NE (completely damaged DNA) were the number of different kinds of comets. Score(S)=(NB+2NC+3ND+4NE)/(NA+NB+NC+ND+NE)×100Eq. 1 Modified Oxidative DNA Damage Comet Assay (Fpg FLARE Comet Assay)-Oxidized bases were determined using the Trevigen Fpg FLARE (fragment length analysis using repair enzymes) comet assay kit. Briefly, following treatment the cells were collected and washed as described previously and resuspended in PBS. The cell suspensions were combined with low melting agarose and transferred onto CometSlides. After fixing the cell/agar mixture to the slide at 4 °C, the cells were lysed at 4 °C in lysis buffer for 30 min. After equilibration with FLARE buffer (10 mm HEPES-KOH, pH 7.4, 0.1 m KCl) for 15 min, the slides were incubated at 37 °C for 60 min with the diluted Fpg enzyme, and appropriate buffer-only controls were included. Following equilibration with alkali solution, the slides underwent electrophoresis for 3 min at 300 mA. The slides were then fixed with 70% ethanol, stained with SYBR Green, and scored as described above using Equation 1. The difference between the scores of the Fpg-treated samples and buffer controls was proportional to the amount of oxidized bases in the cells. Analysis of 8-Oxo-dG in Breast Cancer Cells by LC-MS/MS-8-Oxo-dG analysis was carried out as described previously (31Liu X. Yao J. Pisha E. Yang Y. Hua Y. van Breemen R.B. Bolton J.L. Chem. Res. Toxicol. 2002; 15: 512-519Crossref PubMed Scopus (67) Google Scholar) with minor modifications. After incubation with test compounds, the floating cells were collected by centrifugation, and the attached cells were trypsinized and then harvested by centrifugation. The cells were combined and washed with 10 ml of PBS. After centrifugation, the cell pellets were homogenized in 3.5 ml of lysis buffer (320 mm sucrose, 10 mm Tris, pH 7.4, 5 mm MgCl2, 10 mm Triton X-100, and 50 mm mannitol). The nuclei pellets were treated for 30 min at 37 °C with RNase T1 (1000 units) and RNase A (0.2 mg) in solution buffer (1% SDS, 1 mm EDTA, 10 mm Tris, pH 7.4, 0.45 m NaCl) and further incubated with proteinase K (0.8 mg) for 30 min at 37 °C. NaCl and Tris were added to achieve final concentrations of 0.62 m and 20 mm, respectively. An equal volume of 1-butanol was added, the samples were thoroughly mixed and centrifuged, and the bottom aqueous layer was isolated. After isopropanol precipitation, the DNA was washed twice with 70% ethanol. The DNA was dissolved in 100 μl of buffer (25 mm ammonium acetate, pH 5.3, 0.1 mm ZnCl2), mixed with 2 μl of 10 mm Desferral, and hydrolyzed using nuclease P1 (4 units) and alkaline phosphatase (8 units) for 30 min at 37 °C. The enzymes were removed by ultrafiltration using a Microcon YM-30 centrifugal filter (Millipore). Stable isotopically labeled [15N5]8-oxo-dG was added to the ultrafiltrate as the surrogate standard, and the mixture was analyzed using LC-MS/MS on a Thermo (San Jose, CA) TSQ Quantum triple quadrupole mass spectrometer coupled with a Surveyor HPLC System and photodiode array detector. The samples were separated using a YMC (YMC Co., Wilmington, NC) AQ C18 column (2.0 × 250 mm) and guard column (4.0 × 20 mm) at a flow rate of 0.2 ml/min with a gradient mobile phase starting at 5% methanol/water and increasing to 10% methanol over 6 min, increasing to 20% methanol/water over another 6 min, increasing to 90% methanol/water for 5 min, and then equilibrium with 5% methanol/water for 15 min in one step. The native dG was determined by UV scanning from 240 nm to 290 nm. The 8-oxo-dG was detected using selected reaction monitoring and collision-induced dissociation for the fragmentation pathway of m/z 282 → 192 with a dwell time of 0.5 s/ion using negative ion electrospray (39Hua Y. Wainhaus S.B. Yang Y. Shen L. Xiong Y. Xu X. Zhang F. Bolton J.L. van Breemen R.B. J. Am. Soc. Mass Spectrom. 2001; 12: 80-87Crossref PubMed Scopus (79) Google Scholar). Determination of ROS by CM-H2DCFDA-Both S30 and MDA-MB-231 cells were grown (106 cells/ml) on each of eight wells on a sterile Nunc™ chambered coverglass and incubated for 48 h at 37 °C with 5% CO2 in phenol red-free MEM supplemented with 10% stripped fetal bovine serum medium. S30 and MDA-MB-231 cells were labeled with 10 μm CM-H2DCFDA for 30 min at 37 °C, 5% CO2 (40LeBel C.P. Ischiropoulos H. Bondy S.C. Chem. Res. Toxicol. 1992; 5: 227-231Crossref PubMed Scopus (2217) Google Scholar, 41Ubezio P. Civoli F. Free Radic. Biol. Med. 1994; 16: 509-516Crossref PubMed Scopus (132) Google Scholar). CM-H2DCFDA-treated cells were rinsed twice with PBS to remove the unincorporated dye, and 0.2 μg/ml Hoechst stain was added to the cells to detect nuclear staining. The cells were then treated with 4-OHEN (1 μm), menadione (1 μm), or DMSO (0.5%) for 5 min, and imaging was performed with a Zeiss LSM 510 laser-scanning confocal microscope with the detector gain adjusted to eliminate the background autofluorescence. The fluorescence signal from CM-H2DCFDA was monitored with a 488 nm argon/krypton laser and a 530 nm band pass filter. The Hoechst nuclear staining signal was monitored with a 345 nm UV laser and 420 nm band pass filter. A ×63 (1.2 numerical aperture) water immersion objective was used for all experiments. Images were analyzed using the analysis tool provided in the Zeiss biophysical software package. Statistical Analyses-ERE-luciferase assays and comet and FLARE comet studies were performed three times, and the results of 8-oxo-dG measurement using LC-MS/MS were obtained from two separate experiments. All data were expressed as the mean ± S.D. The statistical analysis of these results consisted of one-way analysis of variance with Dunnett's or Tukey's multiple comparison tests using GraphPad Prism version 4 for Windows. 4-OHEN Is a Poor Ligand for the Isolated ER but an Estrogen of Nanomolar Potency in Cell Culture-The first question to address was the estrogenicity of 4-OHEN in ERα-positive cells. Previous reports have shown low affinity in the radioligand competitive binding assay to recombinant full-length ERα, with significant variance probably because of the instability of 4-OHEN: IC50 = 1.5 ± 0.2 μm (31Liu X. Yao J. Pisha E. Yang Y. Hua Y. van Breemen R.B. Bolton J.L. Chem. Res. Toxicol. 2002; 15: 512-519Crossref PubMed Scopus (67) Google Scholar, 42Liu X. Pisha E. Tonetti D.A. Yao D. Li Y. Yao J. Burdette J.E. Bolton J.L. Chem. Res. Toxicol. 2003; 16: 832-837Crossref PubMed Scopus (37) Google Scholar). Furthermore, binding to ER by 4-methoxy equilenin (4-MeOEN), the product of COMT action on 4-OHEN, was not even detectable under the same assay conditions (43Chang M. Peng K.W. Kastrati I. Overk C.R. Qin Z.H. Yao P. Bolton J.L. Thatcher G.R. Endocrinology. 2007; 148: 4793-4802Crossref PubMed Scopus (12) Google Scholar). Nevertheless, 4-MeOEN was observed to be an estrogen agonist in both ERα(+) Ishikawa (EC50 = 0.16 ± 0.1 nm) and MCF-7 cells (EC50 = 6.5 ± 0.6 nm) (43Chang M. Peng K.W. Kastrati I. Overk C.R. Qin Z.H. Yao P. Bolton J.L. Thatcher G.R. Endocrinology. 2007; 148: 4793-4802Crossref PubMed Scopus (12) Google Scholar). Similarly, 4-OHEN was observed to be an agonist with nanomolar potency (EC50 = 5.7 ± 2.8 nm) as measured in ERα(+) MCF-7 cells transiently transfected with an ERE-luciferase reporter vector and treated for 18 h with test compound. As expected, co-administration of the selective estrogen receptor modulator 4-hydroxytamoxifen (4-OHTAM) or the pure estrogen antagonist ICI 182,780 inhibited the estrogenic activity of 4-OHEN (Fig. 1). As 4-MeOEN has been shown to be an estrogen of nanomolar potency, it was necessary to rule out COMT-mediated methylation of 4-OHEN as the cause of estrogenicity using the COMT inhibitor Ro-41-0960 (Fig. 1). Finally, menadione was confirmed to be devoid of estrogenic or antiestrogenic activity. 4-OHEN Binding Causes Translocation of ERα to the Nucleus of MCF-7 Cells-Although 4-OHEN is a full and potent estrogen, multiple mechanisms of nonclassical estrogenic signaling are being revealed involving membrane-associated ER (44Pedram A. Razandi M. Levin E.R. Mol. Endocrinol. 2006; 20: 1996-2009Crossref PubMed Scopus (433) Google Scholar). Both 4-MeOEN and 4-OHEN are reported to activate extracellular signal-regulated kinase at 5 min in MCF-7 cells, a target for rapid membrane-associated ER-mediated response (43Chang M. Peng K.W. Kastrati I. Overk C.R. Qin Z.H. Yao P. Bolton J.L. Thatcher G.R. Endocrinology. 2007; 148: 4793-4802Crossref PubMed Scopus (12) Google Scholar). Therefore it was deemed essential to demonstrate that activity resulted from nuclear localization and binding to DNA of 4-OHEN-liganded ERα. The status of the ligand-activated ERα present on the estrogen-responsive regions

Referência(s)