Arsenic Trioxide Augments Chk2/p53-mediated Apoptosis by Inhibiting Oncogenic Wip1 Phosphatase
2008; Elsevier BV; Volume: 283; Issue: 27 Linguagem: Inglês
10.1074/jbc.m800560200
ISSN1083-351X
AutoresAkinori Yoda, Kyoko Toyoshima, Yasuhide Watanabe, Nobuyuki Onishi, Yuki Hazaka, Yusuke Tsukuda, Junichi Tsukada, Takeshi Kondo, Yoshiya Tanaka, Yasuhiro Minami,
Tópico(s)Cancer-related Molecular Pathways
ResumoThe oncogenic Wip1 phosphatase (PPM1D) is induced upon DNA damage in a p53-dependent manner and is required for inactivation or suppression of DNA damage-induced cell cycle checkpoint arrest and of apoptosis by dephosphorylating and inactivating phosphorylated Chk2, Chk1, and ATM kinases. It has been reported that arsenic trioxide (ATO), a potent cancer chemotherapeutic agent, in particular for acute promyelocytic leukemia, activates the Chk2/p53 pathway, leading to apoptosis. ATO is also known to activate the p38 MAPK/p53 pathway. Here we show that phosphatase activities of purified Wip1 toward phosphorylated Chk2 and p38 in vitro are inhibited by ATO in a dose-dependent manner. Furthermore, DNA damage-induced phosphorylation of Chk2 and p38 in cultured cells is suppressed by ectopic expression of Wip1, and this Wip1-mediated suppression can be restored by the presence of ATO. We also show that treatment of acute promyelocytic leukemia cells with ATO resulted in induction of phosphorylation and activation of Chk2 and p38 MAPK, which are required for ATO-induced apoptosis. Importantly, this ATO-induced activation of Chk2/p53 and p38 MAPK/p53 apoptotic pathways can be enhanced by siRNA-mediated suppression of Wip1 expression, further indicating that ATO inhibits Wip1 phosphatase in vivo. These results exemplify that Wip1 is a direct molecular target of ATO. The oncogenic Wip1 phosphatase (PPM1D) is induced upon DNA damage in a p53-dependent manner and is required for inactivation or suppression of DNA damage-induced cell cycle checkpoint arrest and of apoptosis by dephosphorylating and inactivating phosphorylated Chk2, Chk1, and ATM kinases. It has been reported that arsenic trioxide (ATO), a potent cancer chemotherapeutic agent, in particular for acute promyelocytic leukemia, activates the Chk2/p53 pathway, leading to apoptosis. ATO is also known to activate the p38 MAPK/p53 pathway. Here we show that phosphatase activities of purified Wip1 toward phosphorylated Chk2 and p38 in vitro are inhibited by ATO in a dose-dependent manner. Furthermore, DNA damage-induced phosphorylation of Chk2 and p38 in cultured cells is suppressed by ectopic expression of Wip1, and this Wip1-mediated suppression can be restored by the presence of ATO. We also show that treatment of acute promyelocytic leukemia cells with ATO resulted in induction of phosphorylation and activation of Chk2 and p38 MAPK, which are required for ATO-induced apoptosis. Importantly, this ATO-induced activation of Chk2/p53 and p38 MAPK/p53 apoptotic pathways can be enhanced by siRNA-mediated suppression of Wip1 expression, further indicating that ATO inhibits Wip1 phosphatase in vivo. These results exemplify that Wip1 is a direct molecular target of ATO. Arsenic trioxide (As2O3; ATO) 3The abbreviations used are: ATO, arsenic trioxide; ATM, ataxia telangiectasia-mutated; ATR, ATM- and Rad3-related; ATRA, all-trans-retinoic acid; APL, acute promyelocytic leukemia; APO, arsenic pentoxide; ER, estrogen receptor; GST, glutathione S-transferase; HA, hemagglutinin; MAPK, mitogen-activated protein kinase(s); MBP, maltose-binding protein; WCL, whole cell lysate; WT, wild type; ROS, reactive oxygen species; FCS, fetal calf serum; 4OHT, 4-hydroxytamoxifen; NAC, N-acetyl-l-cysteine; siRNA, small interfering RNA; PAG, polyacrylamide gel; PVDF, polyvinylidene difluoride; PBS, phosphate-buffered saline; DAPI, 4′,6-diamidino-2-phenylindole; DK, dead kinase. 3The abbreviations used are: ATO, arsenic trioxide; ATM, ataxia telangiectasia-mutated; ATR, ATM- and Rad3-related; ATRA, all-trans-retinoic acid; APL, acute promyelocytic leukemia; APO, arsenic pentoxide; ER, estrogen receptor; GST, glutathione S-transferase; HA, hemagglutinin; MAPK, mitogen-activated protein kinase(s); MBP, maltose-binding protein; WCL, whole cell lysate; WT, wild type; ROS, reactive oxygen species; FCS, fetal calf serum; 4OHT, 4-hydroxytamoxifen; NAC, N-acetyl-l-cysteine; siRNA, small interfering RNA; PAG, polyacrylamide gel; PVDF, polyvinylidene difluoride; PBS, phosphate-buffered saline; DAPI, 4′,6-diamidino-2-phenylindole; DK, dead kinase. has been used therapeutically for several thousand years as a part of traditional Chinese medicine, and it is widely used as an effective anticancer drug for acute promyelocytic leukemia (APL) (1Chen G.Q. Zhu J. Shi X.G. Ni J.H. Zhong H.J. Si G.Y. Jin X.L. Tang W. Li X.S. Xong S.M. Shen Z.X. Sun G.L. Ma J. Zhang P. Zhang T.D. Gazin C. Naoe T. Chen S.J. Wang Z.Y. Chen Z. Blood. 1996; 88: 1052-1061Crossref PubMed Google Scholar, 2Miller Jr., W.H. Schipper H.M. Lee J.S. Singer J. Waxman S. Cancer Res. 2002; 62: 3893-3903PubMed Google Scholar, 3Douer D. Tallman M.S. J. Clin. Oncol. 2005; 23: 2396-2410Crossref PubMed Scopus (213) Google Scholar). Most APL cases are characterized by a specific chromosomal translocation t(15; 17), which results in the rearrangement of the PML (for promyelocytic leukemia) gene and retinoic acid receptor (RARα) gene and the expression of PML-RARα fusion protein. The PML-RARα fusion protein functions as a constitutive transcriptional silencer in the retinoic acid signaling pathway, thereby inducing a differentiation block (4Salomoni P. Pandolfi P.P. Cell. 2002; 108: 165-170Abstract Full Text Full Text PDF PubMed Scopus (465) Google Scholar). All-trans-retinoic acid (ATRA), another drug for APL, directly targets the PML-RARα fusion protein and can induce clinical complete remission in APL patients by degradation of the PML-RARα fusion protein and a differentiation process; however, these patients often relapse and are resistant to further treatment with ATRA (5Soignet S.L. Frankel S.R. Douer D. Tallman M.S. Kantarjian H. Calleja E. Stone R.M. Kalaycio M. Scheinberg D.A. Steinherz P. Sievers E.L. Coutre S. Dahlberg S. Ellison R. Warrell Jr., R.P. J. Clin. Oncol. 2001; 19: 3852-3860Crossref PubMed Scopus (710) Google Scholar). ATO also degrades the PML-RARα fusion protein and induces differentiation with lower concentration, but unlike ATRA, ATO induces a potent apoptosis of the APL cells with higher concentration via a variety of mechanisms, which appear to be independent of the presence of the PML-RARα fusion protein (6Chen G.Q. Shi X.G. Tang W. Xiong S.M. Zhu J. Cai X. Han Z.G. Ni J.H. Shi G.Y. Jia P.M. Liu M.M. He K.L. Niu C. Ma J. Zhang P. Zhang T.D. Paul P. Naoe T. Kitamura K. Miller W. Waxman S. Wang Z.Y. de The H. Chen S.J. Chen Z. Blood. 1997; 89: 3345-3353Crossref PubMed Google Scholar, 7Miller Jr., W.H. Oncologist. 2002; 7: 14-19Crossref PubMed Scopus (85) Google Scholar). It has been well demonstrated that ATO induces high complete remission rates in relapsed APL patients resistant to ATRA as well as in primary APL patients (around 85–90%) (8Zhang T.D. Chen G.Q. Wang Z.G. Wang Z.Y. Chen S.J. Chen Z. Oncogene. 2001; 20: 7146-7153Crossref PubMed Scopus (199) Google Scholar). ATO-induced apoptosis is thought to play a major role in the therapeutic effects of ATO (7Miller Jr., W.H. Oncologist. 2002; 7: 14-19Crossref PubMed Scopus (85) Google Scholar). ATO is of potential therapeutic value for the treatment of other hematologic malignancies and solid tumors in addition to APL (9Dilda P.J. Hogg P.J. Cancer Treat. Rev. 2007; 33: 542-564Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar). Arsenic predominantly exists in two oxidation states, As(III) (e.g. As2O3; ATO) and As(V) (e.g. As2O5; arsenic pentoxide; APO). Although high concentrations of As(V) have been shown to substitute for phosphate in enzyme-catalyzed reactions, arsenic toxicity is postulated to be primarily due to the binding of As(III) to target molecules, including sulfhydryl-containing enzymes (10Leonard A. Lauwerys R.R. Mutat. Res. 1980; 75: 49-62Crossref PubMed Scopus (203) Google Scholar, 11Chouchane S. Snow E.T. Chem. Res. Toxicol. 2001; 14: 517-522Crossref PubMed Scopus (103) Google Scholar, 12Tseng C.H. Toxicol. Appl. Pharmacol. 2004; 197: 67-83Crossref PubMed Scopus (241) Google Scholar). Among these enzymes, protein phosphatases can be targets of As(III). For example, phenylarsine oxide and arsenite were shown to inhibit CD45 tyrosine phosphatase and dual specificity c-Jun N-terminal kinase phosphatase, respectively (13Garcia-Morales P. Minami Y. Luong E. Klausner R.D. Samelson L.E. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9255-9259Crossref PubMed Scopus (234) Google Scholar, 14Cavigelli M. Li W.W. Lin A. Su B. Yoshioka K. Karin M. EMBO J. 1996; 15: 6269-6279Crossref PubMed Scopus (391) Google Scholar). ATO-induced apoptosis is associated with the generation of reactive oxygen species (ROS) with subsequent accumulation of H2O2 in several experimental models (15Chen Y.C. Lin-Shiau S.Y. Lin J.K. J. Cell. Physiol. 1998; 177: 324-333Crossref PubMed Scopus (425) Google Scholar, 16Jing Y. Dai J. Chalmers-Redman R.M. Tatton W.G. Waxman S. Blood. 1999; 94: 2102-2111Crossref PubMed Google Scholar). ATO-induced apoptosis is inhibited when cells are treated with various antioxidants, free radical scavengers, or inhibitors of ROS-producing enzymes (15Chen Y.C. Lin-Shiau S.Y. Lin J.K. J. Cell. Physiol. 1998; 177: 324-333Crossref PubMed Scopus (425) Google Scholar). Recently, TrxR (thioredoxin reductase), one of the critical regulators of the cellular redox environment, was identified as a molecular target of ATO (17Lu J. Chew E.H. Holmgren A. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 12288-12293Crossref PubMed Scopus (411) Google Scholar). However, other targets of ATO are not known, and molecular mechanisms of ATO-induced apoptosis remain elusive. It has been well appreciated that genotoxic stresses activate cell cycle checkpoint machinery to maintain genomic integrity (18Motoyama N. Naka K. Curr. Opin. Genet. Dev. 2004; 14: 11-16Crossref PubMed Scopus (209) Google Scholar, 19Eyfjord J.E. Bodvarsdottir S.K. Mutat. Res. 2005; 592: 18-28Crossref PubMed Scopus (85) Google Scholar). Following DNA damage, ataxia telangiectasia-mutated (ATM) and/or ATM and Rad3-related (ATR) kinases are activated rapidly, and these kinases then phosphorylate and activate checkpoint kinases, Chk1 and Chk2, thereby amplifying the DNA damage signal to execute cell cycle checkpoint regulation (20Bartek J. Lukas J. Cancer Cell. 2003; 3: 421-429Abstract Full Text Full Text PDF PubMed Scopus (1221) Google Scholar, 21Ahn J. Urist M. Prives C. DNA Repair. 2004; 3: 1039-1047Crossref PubMed Scopus (213) Google Scholar, 22Chen Y. Sanchez Y. DNA Repair. 2004; 3: 1025-1032Crossref PubMed Scopus (158) Google Scholar, 23McGowan C.H. Russell P. Curr. Opin. Cell Biol. 2004; 16: 629-633Crossref PubMed Scopus (161) Google Scholar, 24Traven A. Heierhorst J. BioEssays. 2005; 27: 397-407Crossref PubMed Scopus (156) Google Scholar). It has been reported that ATO induces DNA damage and p53 accumulation through an ATM-dependent pathway and that ATO-induced apoptosis is required for a pathway composed of ATR, PML, Chk2, and p53 (25Yih L.H. Lee T.C. Cancer Res. 2000; 60: 6346-6352PubMed Google Scholar, 26Joe Y. Jeong J.H. Yang S. Kang H. Motoyama N. Pandolfi P.P. Chung J.H. Kim M.K. J. Biol. Chem. 2006; 281: 28764-28771Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Mitogen-activated protein kinases (MAPK) are a family of enzymes that transduce signals from the cell membrane to the cell interior in response to a wide range of stimuli and modulate several important biological functions, including gene expression, mitosis, proliferation, motility, and apoptosis (27Schaeffer H.J. Weber M.J. Mol. Cell. Biol. 1999; 19: 2435-2444Crossref PubMed Scopus (1401) Google Scholar, 28Platanias L.C. Blood. 2003; 101: 4667-4679Crossref PubMed Scopus (365) Google Scholar). It has been shown that p38 MAPK stimulates p53 in response to various stress agents, including UV irradiation and anticancer drugs, and regulates both activation of p53-mediated transcription and p53-dependent apoptosis (29Bulavin D.V. Saito S. Hollander M.C. Sakaguchi K. Anderson C.W. Appella E. Fornace Jr., A.J. EMBO J. 1999; 18: 6845-6854Crossref PubMed Scopus (594) Google Scholar, 30Sanchez-Prieto R. Rojas J.M. Taya Y. Gutkind J.S. Cancer Res. 2000; 60: 2464-2472PubMed Google Scholar). ATO is known to activate p38 MAPK in various neoplastic cell lines, suggesting a role for this pathway in the regulation of ATO-induced responses in malignant cells (31Shim M.J. Kim H.J. Yang S.J. Lee I.S. Choi H.I. Kim T. J. Biochem. Mol. Biol. 2002; 35: 377-383PubMed Google Scholar, 32Iwama K. Nakajo S. Aiuchi T. Nakaya K. Int. J. Cancer. 2001; 92: 518-526Crossref PubMed Scopus (116) Google Scholar, 33Verma A. Mohindru M. Deb D.K. Sassano A. Kambhampati S. Ravandi F. Minucci S. Kalvakolanu D.V. Platanias L.C. J. Biol. Chem. 2002; 277: 44988-44995Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 34Giafis N. Katsoulidis E. Sassano A. Tallman M.S. Higgins L.S. Nebreda A.R. Davis R.J. Platanias L.C. Cancer Res. 2006; 66: 6763-6771Crossref PubMed Scopus (77) Google Scholar, 35Cheng Y. Chang L.W. Tsou T.C. Arch. Toxicol. 2006; 80: 310-318Crossref PubMed Scopus (35) Google Scholar). In mammals, the PP2C (protein phosphatase 2C) family of protein phosphatases consists of at least seven distinct isoforms and has been implicated in stress response signaling (36Cohen P. Annu. Rev. Biochem. 1989; 58: 453-508Crossref PubMed Scopus (2151) Google Scholar, 37Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Crossref PubMed Scopus (239) Google Scholar, 38Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMBO J. 2000; 19: 6517-6526Crossref PubMed Scopus (357) Google Scholar). Among the members of the PP2C family protein phosphatases, Wip1 (PPM1D) possesses unique biological characteristics. Wip1 is induced by DNA damage in a p53-dependent manner and inhibits UV irradiation-induced activation of p38 MAPK by dephosphorylating Thr180 in p38, thereby inhibiting the function of p53 (38Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMBO J. 2000; 19: 6517-6526Crossref PubMed Scopus (357) Google Scholar, 39Fiscella M. Zhang H. Fan S. Sakaguchi K. Shen S. Mercer W.E. Vande Woude G.F. O'Connor P.M. Appella E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6048-6053Crossref PubMed Scopus (458) Google Scholar). It has also been reported that Wip1 dephosphorylates the two ATM/ATR (ATM and Rad-3-related) targets, Chk1 and p53 (40Lu X. Nannenga B. Donehower L.A. Genes Dev. 2005; 19: 1162-1174Crossref PubMed Scopus (315) Google Scholar, 41Shreeram S. Demidov O.N. Hee W.K. Yamaguchi H. Onishi N. Kek C. Timofeev O.N. Dudgeon C. Fornace A.J. Anderson C.W. Minami Y. Appella E. Bulavin D.V. Mol. Cell. 2006; 23: 757-764Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar), thereby suppressing intra-S and G2/M checkpoint regulations. Recently, we have shown that Wip1 inactivates Chk2 kinase by dephosphorylating threonine 68 (Thr68) in activated Chk2, and suppresses Chk2-mediated apoptosis (42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar). Furthermore, it has been shown that the Wip1 (PPM1D) gene is amplified or overexpressed in various human cancers, including breast cancers (43Bulavin D.V. Demidov O.N. Saito S. Kauraniemi P. Phillips C. Amundson S.A. Ambrosino C. Sauter G. Nebreda A.R. Anderson C.W. Kallioniemi A. Fornace Jr., A.J. Appella E. Nat. Genet. 2002; 31: 210-215Crossref PubMed Scopus (360) Google Scholar, 44Li J. Yang Y. Peng Y. Austin R.J. van Eyndhoven W.G. Nguyen K.C. Gabriele T. McCurrach M.E. Marks J.R. Hoey T. Lowe S.W. Powers S. Nat. Genet. 2002; 31: 133-134Crossref PubMed Scopus (215) Google Scholar, 45Saito-Ohara F. Imoto I. Inoue J. Hosoi H. Nakagawara A. Sugimoto T. Inazawa J. Cancer Res. 2003; 63: 1876-1883PubMed Google Scholar, 46Hirasawa A. Saito-Ohara F. Inoue J. Aoki D. Susumu N. Yokoyama T. Nozawa S. Inazawa J. Imoto I. Clin. Cancer Res. 2003; 9: 1995-2004PubMed Google Scholar), and that overexpression of Wip1 (PPM1D) cooperates with the oncogenes Ras, Myc, and Neu1 to transform wild-type mouse embryonic fibroblasts (43Bulavin D.V. Demidov O.N. Saito S. Kauraniemi P. Phillips C. Amundson S.A. Ambrosino C. Sauter G. Nebreda A.R. Anderson C.W. Kallioniemi A. Fornace Jr., A.J. Appella E. Nat. Genet. 2002; 31: 210-215Crossref PubMed Scopus (360) Google Scholar), suggesting that Wip1 is an oncogenic protein. In addition, a recent study using Wip1-deficient mice has revealed that blocking its function results in enhanced apoptosis in Ras- and Erbb2-induced breast tumors and impairs tumor formation (47Harrison M. Li J. Degenhardt Y. Hoey T. Powers S. Trends Mol. Med. 2004; 10: 359-361Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 48Bulavin D.V. Phillips C. Nannenga B. Timofeev O. Donehower L.A. Anderson C.W. Appella E. Fornace Jr., A.J. Nat. Genet. 2004; 36: 343-350Crossref PubMed Scopus (357) Google Scholar, 49Choi J. Nannenga B. Demidov O.N. Bulavin D.V. Cooney A. Brayton C. Zhang Y. Mbawuike I.N. Bradley A. Appella E. Donehower L.A. Mol. Cell. Biol. 2002; 22: 1094-1105Crossref PubMed Scopus (150) Google Scholar). However, the roles of the Wip1 phosphatase in ATO-induced cellular responses remain obscure. In this study, we examined the effect(s) of ATO on APL cells, in particular the roles of Chk2, p38 MAPK, and Wip1 in ATO-induced apoptosis. We show that both Chk2 and p38 MAPK are phosphorylated following ATO stimulation, but not APO or ATRA stimulation, of APL cells in a dose-dependent manner. Inhibition of either Chk2 or p38 MAPK resulted in suppression of ATO-induced apoptosis, whereas inhibition of Wip1 resulted in enhancement of ATO-induced apoptosis, indicating that these proteins are involved critically in ATO-induced apoptosis. Furthermore, we found that ATO inhibits phosphatase activities of Wip1, but not kinase activities of Chk2 and p38 MAPK, in vitro, and that Wip1-mediated suppression of phosphorylation of Chk2 and p38 MAPK is inhibited by ATO treatment in vivo. These results support our notion that ATO induces apoptosis by activating Chk2/p53 and p38/p53 pathways, which is enhanced by direct inhibition of Wip1 by ATO. Cells, Antibodies, and Chemical Reagents—NB4 and HL-60 cells were maintained in RPMI1640 (Nissui) supplemented with 10% (v/v) fetal calf serum (FCS). HEK293T (293T), MCF7, and HeLa cells were maintained in Dulbecco's modified Eagle's medium (Nissui) supplemented with 10% (v/v) FCS. Transient cDNA transfection was performed using the calcium phosphate method (50Oishi I. Sugiyama S. Otani H. Yamamura H. Nishida Y. Minami Y. Mech. Dev. 1998; 71: 49-63Crossref PubMed Scopus (47) Google Scholar) or Lipofectamine reagent (Invitrogen) according to the manufacturer's instructions. Rabbit polyclonal anti-Chk2 and anti-Wip1 antibodies were prepared as described previously (42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar). Antibodies against FLAG (M2; Sigma), HA (16B12; BAbCO), β-actin (AC-15; Sigma), phospho-Chk2 (Thr68) (Cell Signaling), p38 (Cell Signaling), phospho-p38 (Thr180/Tyr182) (Cell Signaling), p53 (DO1; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), phospho-p53 (Ser20 and Ser46) (Cell Signaling), PML (Santa Cruz Biotechnology), and Wip1 (WC10; Trevigen) were purchased commercially. Alexa Fluor 546 (goat anti-mouse IgG, red) and Alexa Fluor 488 (goat anti-rabbit IgG, green) were from Invitrogen. ATO and APO were purchased from Wako. SB203580, ATRA, 4-hydroxytamoxifen (4OHT), and N-acetyl-l-cysteine (NAC) were from Sigma. Plasmid Constructions—Mammalian expression plasmids pEBG-Chk2 wild type (WT) (encoding glutathione S-transferase (GST)-HA-Chk2 (WT)), pcDNA-FLAG-Wip1 (WT), and pcDNA-FLAG-Wip1 (D/A) were constructed as described previously (42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar). cDNA for Wip1-(1–516)-estrogen receptor (ER) fusion protein was isolated from pECE-HA-Wip1-(1–516)-ER (51Yoda A. Xu X.Z. Onishi N. Toyoshima K. Fujimoto H. Kato N. Oishi I. Kondo T. Minami Y. J. Biol. Chem. 2006; 281: 24847-24862Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) and subcloned into pcDNA vector to generate pcDNA-Wip1-(1–516)-ER. pEBG-p38 (encoding GST-p38 MAPK) was constructed as described (38Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMBO J. 2000; 19: 6517-6526Crossref PubMed Scopus (357) Google Scholar). Prokaryotic expression vectors were constructed in pGEX (GE Healthcare) or pMAL-C2 (New England Biolabs) as described previously (38Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMBO J. 2000; 19: 6517-6526Crossref PubMed Scopus (357) Google Scholar, 42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar, 51Yoda A. Xu X.Z. Onishi N. Toyoshima K. Fujimoto H. Kato N. Oishi I. Kondo T. Minami Y. J. Biol. Chem. 2006; 281: 24847-24862Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). siRNA—The siRNA duplexes were 21 base pairs, including a 2-base nucleotide overhang synthesized by RNAI Co., Ltd. or Dharmacon Research. The sequence of the Chk2 siRNA (number 1 and 2) and Wip1 siRNA (number 1 and 2) oligonucleotides were GAACCUGAGGACCAAGAACCU (Chk2 siRNA 1), CGCCGUCCUUUGAAUAACAAU (Chk2 siRNA 2), UUGGCCUUGUGCCUACUAAUU (Wip1 siRNA 1), and GGCUUUCUCGCUUGUCACCdTdT (Wip1 siRNA 2). The control siRNA oligonucleotide used was GUACCGCACGUCAUUCGUAUC. Cells were transfected with siRNA duplexes by electroporation. Forty-eight hours after transfection, cells were treated with ATO and harvested 24 h after ATO treatment. Preparation of Cell Lysates and Coimmunoprecipitation/Immunoblot Analyses—The cells were solubilized with lysis buffer (50 mm Tris-HCl (pH 7.4), 0.5% (v/v) Nonidet P-40 (Nonidet P-40), 150 mm NaCl, 5 mm EDTA, 50 mm NaF, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 10 μg/ml aprotinin), and whole cell lysates (WCLs) were prepared by centrifugation at 12,000 × g for 15 min at 4 °C. WCLs were precleared with protein A-Sepharose (GE Healthcare) for 1 h at 4 °C. The precleared supernatants were then coimmunoprecipitated with glutathione-Sepharose beads (GE Healthcare) or with antibodies conjugated to protein A-Sepharose beads for 2 h at 4 °C. The immunoprecipitates were washed five times with lysis buffer and eluted with Laemmli sample buffer. Proteins either from the coimmunoprecipitation analyses or WCLs were separated by SDS-PAGE (10% PAG) and transferred onto PVDF membrane filters (Immobilon; Millipore). The membranes were immunoblotted with the respective antibodies, and bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against mouse or rabbit IgGs (Bio-Rad) using chemiluminescence reagents (Western Lightning; PerkinElmer Life Sciences). Immunofluorescence Analyses—NB4 cells were washed twice in RPMI1640 without serum, resuspended in 100 μl of RPMI1640, and attached on coverslips. 293T and HeLa cells were cultured on coverslips coated with rat tail collagen. Fixation, permeabilization, blocking, and staining were performed essentially according to the manufacturer's instructions. For phospho-Chk2 (Thr68) and Wip1 staining, cells on coverslips were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 15 min at room temperature, washed once with TBS (50 mm Tris-HCl (pH 7.4), 150 mm NaCl), and permeabilized with TBS containing 0.2% (v/v) Triton X-100 for 5 min at room temperature. Cells were then washed three times with TBS and washed once with TBS containing freshly prepared 1 mg/ml sodium borohydride to quench reactions. After blocking with PBS containing 10% (v/v) FCS, 10 mg/ml bovine serum albumin, and 0.2 mg/ml NaN3 for 1 h at room temperature, cells were washed with PBS and incubated with the respective primary antibodies, rabbit polyclonal anti-phospho-Chk2 (Thr68) (1:100) and/or mouse monoclonal anti-Wip1 antibodies (WC10; 1:100), in PBS containing 10 mg/ml bovine serum albumin overnight at 4 °C. Cells were washed twice with PBS and then incubated with the respective secondary antibodies, Alexa Fluor 546 (goat anti-mouse IgG; 1:500) and/or Alexa Fluor 488 (goat anti-rabbit IgG; 1:200), in PBS containing 10% (v/v) FCS and 0.5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) for 30 min at room temperature. After they were washed twice with PBS, cells were mounted with mounting solution (100 mm Tris-HCl (pH 8.0), 90% (v/v) glycerol, and 10 mm p-phenylenediamine) and analyzed with an inverted confocal laser microscope (Zeiss). For phospho-p38 (Thr180/Tyr182) and FLAG-Wip1 staining, cells on coverslips were fixed with 4% paraformaldehyde in PBS for 15 min at room temperature, washed three times with PBS, and permeabilized with PBS containing 0.3% (v/v) Triton X-100 and 5% (v/v) FCS for 60 min at room temperature. Cells were then incubated with the respective primary antibodies, rabbit polyclonal phospho-p38 (Thr180/Tyr182) (1:100) and/or mouse monoclonal anti-FLAG antibodies (M2; 1:500), in PBS containing 0.3% (v/v) Triton X-100 overnight at 4 °C. Cells were washed three times with PBS and then incubated with the respective secondary antibodies, Alexa Fluor 546 (goat anti-mouse IgG; 1:500) and/or Alexa Fluor 488 (goat anti-rabbit IgG; 1:200) in PBS containing 0.3% (v/v) Triton X-100 and 0.5 μg/ml DAPI for 60 min at room temperature. After they were washed three times with PBS, cells were mounted with Pristine Mount (Research Genetics) and analyzed with an inverted confocal laser microscope (Zeiss). Expression and Purification of GST and MBP Fusion Proteins—GST, GST-Wip1 (WT), GST-Cdc25C (aa 200–256), GST-ATF2 (aa 1–103), and MBP-Chk2 (WT) were expressed in Escherichia coli BL21, respectively, and were extracted with PBS containing 1% (v/v) Triton X-100, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 10 μg/ml aprotinin. GST and GST fusion proteins were isolated with glutathione-Sepharose beads. Maltose-binding protein (MBP) fusion proteins were isolated with amylose resin beads (New England Biolabs). GST or MBP fusion proteins were eluted from beads by incubating with 25 mm glutathione (reduced) or 10 mm maltose, respectively, and further purified by gel filtration chromatography using Nick columns (GE Healthcare). To prepare phosphorylated GST-HA-Chk2 (WT or dead kinase (DK)) or phosphorylated GST-p38, 293T cells transfected with the respective expression vectors, encoding GST-HA-Chk2 (WT or DK) or GST-p38, were exposed to γ-irradiation (10 grays) or UV irradiation (50 J/m2), respectively, and were cultured for 1 h prior to harvest. Phosphorylated GST-HA-Chk2 (WT or DK) or phosphorylated GST-p38 in 293T were extracted with lysis buffer (50 mm Tris-HCl (pH7.4), 0.5% (v/v) Nonidet P-40, 150 mm NaCl, 5 mm EDTA, 50 mm NaF, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml leupeptin, and 10 μg/ml aprotinin) and were purified as described above. In Vitro Kinase Assays—In vitro kinase assays were performed essentially as described previously (42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar). For in vitro kinase assays of Chk2, 1 μg of GST-HA-Chk2 (WT) or GST-HA-Chk2 (DK) was suspended in 30 μl of kinase buffer (10 mm Hepes (pH 7.5), 5 mm MgCl2, and 2 mm dithiothreitol) containing 1 μg of GST-Cdc25C and 15 μCi of [γ-32P]ATP (6000 Ci/mmol; GE Healthcare). For in vitro kinase assays of p38, 1 μg of GST-p38 was suspended in 30 μl of kinase buffer containing 1 μg of GST-ATF2 and 15 μCi of [γ-32P]ATP. Samples were incubated in the absence or presence of ATO (1 mm) for 30 min at 30 °C, and the reactions were terminated by the addition of Laemmli sample buffer, separated by SDS-PAGE (12% PAG), and subjected to autoradiography. In Vitro Phosphatase Assays—In vitro phosphatase assays were performed essentially as described previously (42Fujimoto H. Onishi N. Kato N. Takekawa M. Xu X.Z. Kosugi A. Kondo T. Imamura M. Oishi I. Yoda A. Minami Y. Cell Death Differ. 2006; 13: 1170-1180Crossref PubMed Scopus (162) Google Scholar). Purified phosphorylated GST-HA-Chk2 (1 μg) or phosphorylated GST-p38 (1 μg) was suspended in phosphatase buffer (50 mm Tris-HCl (pH 7.5), 30 mm MgCl2, 1 mg/ml bovine serum albumin, 0.05% 2-mercaptoethanol). In vitro phosphatase reactions were initiated by the addition of purified GST-Wip1 (WT) or GST as a control in the presence of the indicated concentrations of ATO or APO and allowed to incubate for 3 h at 30 °C. The reactions were terminated by the addition of Laemmli sample buffer and subjected to SDS-PAGE (10% PAG) followed by immunoblot analyses. Steady-state Kinetic Assays—32P-Labeled Chk2 proteins were prepared by self-phosphorylation of GST-HA-Chk2 in vitro. The reaction mixture contained 10 μg of GST-HA-Chk2 and was suspended in 400 μl of kinase buffer (10 mm Hepes (pH 7.5), 5 mm MgCl2, and 2 mm dithiothreitol) containing 40 μCi of [γ-32P]ATP (6000 Ci/mmol; GE Healthcare). The mixtures were incubated for 3 h at 30 °C, and 32P-labeled GST-HA-Chk2 proteins were isolated with glutathione-Sepharose beads. Phosphatase activities were measured by the release of 32PO4 from 32P-labeled proteins essentially as described previously (52Minami Y. Stafford F.J. Lippincott-Schwartz J. Yuan L.C. Klausner R.D. J. Biol. Chem. 1991; 266: 9222-9230Abstract Full Text PDF PubMed Google Scholar). After preincubation of purified GS
Referência(s)