Portal de Periódicos da CAPES

Na+/H+ Exchanger NHE3 Activity and Trafficking Are Lipid Raft-dependent

2006; Elsevier BV; Volume: 281; Issue: 26 Linguagem: Inglês

10.1074/jbc.m601740200

1083-351X

Rakhilya Murtazina, Olga Kovbasnjuk, Mark Donowitz, Xuhang Li,

Pancreatic function and diabetes

A previous study showed that ∼25–50% of rabbit ileal brush border (BB) Na+/H+ exchanger NHE3 is in lipid rafts (LR) (Li, X., Galli, T., Leu, S., Wade, J. B., Weinman E. J., Leung, G., Cheong, A., Louvard, D., and Donowitz, M. (2001) J. Physiol. (Lond.) 537, 537–552). Here, we examined the role of LR in NHE3 transport activity using a simpler system: opossum kidney (OK) cells (a renal proximal tubule epithelial cell line) containing NHE3. ∼50% of surface (biotinylated) NHE3 in OK cells distributed in LR by density gradient centrifugation. Disruption of LR with methyl-β-cyclodextrin (MβCD) decreased NHE3 activity and increased K′(H+)i, but Km(Na+) was not affected. The MβCD effect was completely reversed by repletion of cholesterol, but not by an inactive analog of cholesterol (cholestane-3β,5α,6β-triol). The MβCD effect was specific for NHE3 activity because it did not alter Na+-dependent l-Ala uptake. MβCD did not alter OK cell BB topology and did not change the surface amount of NHE3, but greatly reduced the rate of NHE3 endocytosis. The effects of inhibiting phosphatidylinositol 3-kinase and of MβCD on NHE3 activity were not additive, indicating a common inhibitory mechanism. In contrast, 8-bromo-cAMP and MβCD inhibition of NHE3 was additive, indicating different mechanisms for inhibition of NHE3 activity. Approximately 50% of BB NHE3 and only ∼11% of intracellular NHE3 in polarized OK cells were in LR. In summary, the BB pool of NHE3 in LR is functionally active because MβCD treatment decreased NHE3 basal activity. The LR pool is necessary for multiple kinetic aspects of normal NHE3 activity, including Vmax and K′(H+)i, and also for multiple aspects of NHE3 trafficking, including at least basal endocytosis and phosphatidylinositol 3-kinase-dependent basal exocytosis. Because the C-terminal domain of NHE3 is necessary for its regulation and because the changes in NHE3 kinetics with MβCD resemble those with second messenger regulation of NHE3, these results suggest that the NHE3 C terminus may be involved in the MβCD sensitivity of NHE3. A previous study showed that ∼25–50% of rabbit ileal brush border (BB) Na+/H+ exchanger NHE3 is in lipid rafts (LR) (Li, X., Galli, T., Leu, S., Wade, J. B., Weinman E. J., Leung, G., Cheong, A., Louvard, D., and Donowitz, M. (2001) J. Physiol. (Lond.) 537, 537–552). Here, we examined the role of LR in NHE3 transport activity using a simpler system: opossum kidney (OK) cells (a renal proximal tubule epithelial cell line) containing NHE3. ∼50% of surface (biotinylated) NHE3 in OK cells distributed in LR by density gradient centrifugation. Disruption of LR with methyl-β-cyclodextrin (MβCD) decreased NHE3 activity and increased K′(H+)i, but Km(Na+) was not affected. The MβCD effect was completely reversed by repletion of cholesterol, but not by an inactive analog of cholesterol (cholestane-3β,5α,6β-triol). The MβCD effect was specific for NHE3 activity because it did not alter Na+-dependent l-Ala uptake. MβCD did not alter OK cell BB topology and did not change the surface amount of NHE3, but greatly reduced the rate of NHE3 endocytosis. The effects of inhibiting phosphatidylinositol 3-kinase and of MβCD on NHE3 activity were not additive, indicating a common inhibitory mechanism. In contrast, 8-bromo-cAMP and MβCD inhibition of NHE3 was additive, indicating different mechanisms for inhibition of NHE3 activity. Approximately 50% of BB NHE3 and only ∼11% of intracellular NHE3 in polarized OK cells were in LR. In summary, the BB pool of NHE3 in LR is functionally active because MβCD treatment decreased NHE3 basal activity. The LR pool is necessary for multiple kinetic aspects of normal NHE3 activity, including Vmax and K′(H+)i, and also for multiple aspects of NHE3 trafficking, including at least basal endocytosis and phosphatidylinositol 3-kinase-dependent basal exocytosis. Because the C-terminal domain of NHE3 is necessary for its regulation and because the changes in NHE3 kinetics with MβCD resemble those with second messenger regulation of NHE3, these results suggest that the NHE3 C terminus may be involved in the MβCD sensitivity of NHE3. Na+/H+ exchanger NHE3 (SLC9A3) is expressed on apical membranes of small intestinal Na+ absorptive epithelial cells and the renal proximal tubule, where it contributes to a large percentage of total NaCl, HCO3−, and water (re)absorption (1Hoogerwerf W.A. Tsao S.C. Devuyst O. Levine S.A. Yun C.H. Yip J.W. Cohen M.E. Wilson P.D. Lazenby A.J. Tse C.M. Donowitz M. Am. J. Physiol. 1996; 270: G29-G41PubMed Google Scholar, 2Zachos N.C. Tse M. Donowitz M. Annu. Rev. Physiol. 2005; 67: 411-443Crossref PubMed Scopus (307) Google Scholar, 3Orlowski J. Grinstein S. Pfluegers Arch. Eur. J. Physiol. 2004; 447: 549-565Crossref PubMed Scopus (551) Google Scholar). Rapid regulation of NHE3 activity occurs as part of normal digestive and renal physiology and in the pathophysiology of diarrhea and some renal diseases of the proximal tubule. The acute regulation of the exchanger seems to be mainly through changes in its Vmax, but also involves changes in K′(H+)i (4Levine S.A. Montrose M.H. Tse C.M. Donowitz M. J. Biol. Chem. 1993; 268: 25527-25535Abstract Full Text PDF PubMed Google Scholar). Regulation of NHE3 involves at least two different mechanisms: regulation by changes in trafficking due to regulated changes in endocytosis and/or exocytosis and changes in turnover number (5D'Souza S. Garcia-Cabado A. Yu F. Teter K. Lukacs G. Skorecki K. Moore H.P. Orlowski J. Grinstein S. J. Biol. Chem. 1998; 273: 2035-2043Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 6Janecki A.J. Montrose M.H. Zimniak P. Zweibaum A. Tse C.M. Khurana S. Donowitz M. J. Biol. Chem. 1998; 273: 8790-8798Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 7Kurashima K. D'Souza S. Szaszi K. Ramjeeingh Orlowski R. Grinstein J.S. J. Biol. Chem. 1999; 274: 29843-29849Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar, 8Akhter S. Cavet M.E. Tse C.M. Donowitz M. Biochemistry. 2000; 39: 1990-2000Crossref PubMed Scopus (50) Google Scholar, 9Janecki A. Janecki M. Akhter S. Donowitz M. J. Biol. Chem. 2000; 275: 8133-8142Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 10Yang X. Amemiya M. Peng Y. Moe O.W. Preisig P.A. Alpern R.J. Am. J. Physiol. 2000; 279: C410-C419Crossref PubMed Google Scholar, 11Hu M.C. Fan L. Crowder L.A. Karim-Jimenez Z. Murer H. Moe O.W. J. Biol. Chem. 2001; 276: 26906-26915Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Both these mechanisms often involve changes in NHE3 phosphorylation. In studies performed to investigate the mechanisms of NHE3 regulation in rabbit ileal Na+ absorptive cells, brush border (BB) 4The abbreviations used are: BB, brush border(s); LR, lipid raft(s); OK, opossum kidney; BCECF-AM, 2′, 7′-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester; HA, hemagglutinin; MGP, methyl α-d-glucopyranoside; MβCD, methyl-β-cyclodextrin; oPD, o-phenylenediamine dihydrochloride; Br, bromo; VSV-G, vesicular stomatitis virus G; DMEM, Dulbecco's modified Eagle' medium; ELISA, enzyme-linked immunosorbent assay; TMA, tetramethylammonium; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; WGA, wheat germ agglutinin; PI3K, phosphatidylinositol 3-kinase. NHE3 was shown to be partially in lipid rafts (LR) (12Li X. Galli T. Leu S. Wade J.B. Weinman E. J. Leung Cheong G. Louvard A. Donowitz D.M. J. Physiol. (Lond.). 2001; 537: 537-552Crossref Scopus (118) Google Scholar). Concerning NHE3 regulation, the LR pool of BB NHE3 is involved in some of its basal endocytosis and exocytosis and in the acute epidermal growth factor increase of the BB amount of NHE3. However, the contribution of LR to NHE3 function has not been examined in detail. LR are discrete membrane domains that are enriched in glycosphingolipids and cholesterol and that are resistant to solubilization in cold Triton X-100. They are thought to act in the compartmentalization of membrane proteins, separating different biochemical functions and allowing concentration and localization of molecules involved in signal transduction functions (13Simons K. Ikonen E. Nature. 1997; 387: 569-572Crossref PubMed Scopus (8150) Google Scholar, 14Keller P. Simons K. J. Cell Biol. 1998; 140: 1357-1367Crossref PubMed Scopus (472) Google Scholar, 15Lafont F. Lecat S. Verkade P. Simons K. J. Cell Biol. 1998; 142: 1413-1427Crossref PubMed Scopus (156) Google Scholar). Besides the formation of restricted signaling platforms, rafts are implicated in apical protein targeting (13Simons K. Ikonen E. Nature. 1997; 387: 569-572Crossref PubMed Scopus (8150) Google Scholar, 14Keller P. Simons K. J. Cell Biol. 1998; 140: 1357-1367Crossref PubMed Scopus (472) Google Scholar, 16Lafont F. Verkade P. Galli T. Wimmer C. Louvard D. Simons K. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3734-3738Crossref PubMed Scopus (208) Google Scholar) and in some aspects of endocytosis in epithelial cells and as a docking site for some pathogens and toxins (17Scheiffele P. Verkade P. Fra A.M. Virta H. Simons K. Ikonen E. J. Cell Biol. 1998; 140: 795-806Crossref PubMed Scopus (264) Google Scholar, 18Smart E.J. Graf G.A. Lisanti M.P. Mol. Cell. Biol. 1999; 19: 7289-7304Crossref PubMed Scopus (926) Google Scholar, 19Fivaz M. Abrami L. van der Goot F.G. Trends Cell Biol. 1999; 9: 212-213Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). The concept that transport proteins distribute in LR and that their activities are LR-dependent is not unique to NHE3, although it has not yet been examined for many transport proteins. Depletion of cholesterol dramatically alters the function of some (Kv2.1 and Kv1.5) but not other (Kv4.2) voltage-gated potassium channels (20Martens J.R. Navarro-Polanco R. Coppock E.A. Nishiyama A. Parshley L. Grobaski T.D. Tamkun M.M. J. Biol. Chem. 2000; 275: 7443-7446Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, 21Martens J.R. Sakamoto N. Sullivan S.A. Grobaski T.D. Tamkun M.M. J. Biol. Chem. 2001; 276: 8409-8414Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar), decreases SGLT1 (sodium/glucose cotransporter 1) activity (22Runembert I. Queffeulou G. Federici P. Vrtovsnik F. Colucci-Guyon E. Babinet C. Briand P. Trugnan G. Friedlander G. Terzi F. J. Cell Sci. 2002; 115: 713-724Crossref PubMed Google Scholar), and significantly reduces uptake of glutamate by the glial glutamate transporter EAAT2 (23Butchbach M.E. Tian G. Guo H. Lin C.L. J. Biol. Chem. 2004; 279: 34388-34396Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar) and the NaCl-dependent serotonin transporter SERT (24Magnani F. Tate C.G. Wynne S. Williams C. Haase J. J. Biol. Chem. 2004; 279: 38770-38778Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Also, the mouse colonic basolateral membrane Ca2+-activated potassium channel is activated by cholesterol depletion (25Lam R.S. Shaw A.R. Duszyk M. Biochim. Biophys. Acta. 2004; 1667: 241-248Crossref PubMed Scopus (62) Google Scholar). Other transporters shown to be partially in LR include NHE1 (26Bullis B.L. Li X. Rieder C.V. Singh D.N. Berthiaume L.G. Fliegel L. Eur. J. Biochem. 2002; 269: 4887-4895Crossref PubMed Scopus (42) Google Scholar), the type IIa Na+/Pi cotransporter (27Inoue M. Digman M.A. Cheng M. Breusegem S. Y. Halaihel Sorribas N. Mantulin V. Gratton W. Barry E. Levi N. P.M. J. Biol. Chem. 2004; 279: 49160-49171Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar), some connexins (28Locke D. Liu J. Harris A.L. Biochemistry. 2005; 44: 13027-13042Crossref PubMed Scopus (74) Google Scholar), and the epithelial Na+ channel ENaC (29Hill W.G. Bing A. Johnson J.P. J. Biol. Chem. 2002; 277: 33541-33544Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). In contrast, other transport proteins do not appear to be present or affected by LR. These include the cystic fibrosis transmembrane conductance regulator CFTR in normal tissue, except when exposed to Pseudomonas aeruginosa toxin (30Kowalski M.P. Pier G.B. J. Immunol. 2004; 172: 418-425Crossref PubMed Scopus (141) Google Scholar), and intestinal Na+-K+-ATPase (31Hansen G.H. Niels-Christiansen L.-L. Thorsen E. Immerdal L. Danielsen E.M. J. Biol. Chem. 2000; 275: 5136-5142Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). In this study, the opossum kidney (OK) renal proximal tubule epithelial cell line was used to provide a simple model to examine the contribution of LR to NHE3 activity. An advantage of this cell line is that it is a polarized epithelial Na+ absorptive cell line that contains NHE3 as the sole plasma membrane Na+/H+ exchanger. It also lacks other regulatory elements (nerves, endocrine cells, inflammatory cells) that are present in intact intestine and that might also act by LR-dependent processes. Materials—Materials were obtained as indicated: restriction endonucleases, New England Biolabs, Inc.; Pfu polymerase, Stratagene; 2′,7′-bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM), Molecular Probes; anti-mouse secondary antibodies fluorescently labeled with Alexa Fluor® 488, Invitrogen; horseradish peroxidase-conjugated donkey anti-mouse IgG, Jackson ImmunoResearch Laboratories, Inc.; monoclonal mouse antibodies to the hemagglutinin (HA) epitope, Covance Inc.; nigericin, methyl α-d-glucopyranoside (MGP), l-alanine, methyl-β-cyclodextrin (MβCD), cholesterol and its inactive analog cholestane-3β,5α,6β-triol, o-phenylenediamine dihydrochloride (oPD), 8-bromo (Br)-cAMP, LY-294002, Sigma; and [14C]methyl α-d-glucopyranoside and l-[3H]alanine (PerkinElmer Life Sciences). Cell Lines—Studies were carried out in OK/E3V (generously provided by Dr. J. Noël, University of Montreal, Montreal, Canada) and OK/3HA-E3V cell lines. OK/E3V cells are an OK proximal tubule cell line generated by stable transfection of OK-Tina cells, which are OK cells previously selected by acid suicide to lack endogenous NHE3 activity, with a cDNA for rat NHE3 tagged at the C terminus with the vesicular stomatitis virus G (VSV-G) protein epitope (32Noël J. Roux D. Pouyssegur J. J. Cell Sci. 1996; 109: 929-939Crossref PubMed Google Scholar). The OK/3HA-E3V cell line stably expresses rabbit NHE3 tagged with three copies of the influenza virus HA epitope at the N terminus and with the VSV-G epitope at the C terminus. Cells were cultured in Dulbecco's modified Eagle' medium (DMEM)/nutrient mixture F-12 (Invitrogen) containing 10% (v/v) fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin in a humidified atmosphere of 95% air and 5% CO2 at 37 °C. Confluent monolayers on plastic dishes, glass coverslips, or filters were serum-depleted for 24–48 h before study. Cells from every new passage were exposed to an acute acid loading selection to maintain a high level of NHE3 protein expression as described previously (4Levine S.A. Montrose M.H. Tse C.M. Donowitz M. J. Biol. Chem. 1993; 268: 25527-25535Abstract Full Text PDF PubMed Google Scholar) with some modification. In brief, cells were exposed to 50 mm NH4Cl/saline solution for 1 h, followed by overnight incubation in isotonic 2 mm Na+ solution. Plasmid Construction and Cell Transfections—For immunological detection (enzyme-linked immunosorbent assay (ELISA)) of NHE3 protein, three copies of the HA epitope (YPYDVPDYA) were inserted into the first extracellular loop of rabbit NHE3 between Glu37 and Ile38 by PCR. The pECE plasmid with cDNA encoding rabbit NHE3 with the VSV-G epitope at the C terminus as described (8Akhter S. Cavet M.E. Tse C.M. Donowitz M. Biochemistry. 2000; 39: 1990-2000Crossref PubMed Scopus (50) Google Scholar) and containing unique HindIII and XhoI restriction endonuclease sites inserted into the coding region of NHE3 and XbaI after the VSV-G epitope was used as template in the PCRs. Four primers were designed to introduce the triple HA epitope: sense primer 1 (CCCCAAGCTTATGTCAGGGCGCGGGGGCTGCGGCCC, containing the HindIII endonuclease restriction site (underlined)) and antisense primer 1 (CGCGGATCCagcgtagtcggggacgtcgtaggggtaACCagcgtagtcggggacgtcgtaggggtaACCCTCATCGTGATGCTCCTGCTC, containing the first and second HA epitopes (lowercase) and the BamHI restriction endonuclease site (underlined); and sense primer 2 CGCGGATCCtacccctacgacgtccccgactacgctGGACGCGTGATCCAGGGCTTCCAGATAGTC, containing the third HA epitope (lowercase) and BamHI and MluI restriction endonuclease sites (underlined)) and antisense primer 2 (CTAGTCTAGATTGGTACCTT, containing the XbaI restriction site (underlined)). The primers were extended with Pfu polymerase, resulting in the generation of two mutated cDNAs containing the desired insertion. The two DNA fragments obtained by PCR were ligated to each other and then subcloned into the HindIII-XbaI cloning site of pcDNA3.1(+) (Invitrogen). All constructs studied were sequenced. Mutated NHE3 cDNA was called 3HA-E3V. The pcDNA3.1/3HA-E3V and empty vector (pcDNA3.1(+)) plasmids were stably transfected into OK-Tina cells using Lipofectamine 2000 (Invitrogen) as recommended by the manufacturer. Several stably transfected clones were picked, expanded, and used for ELISA as well as for transport assays. The cDNA encoding SGLT1 subcloned into the pEGFP-N1 vector was a gift from Dr. Suketa (University of Shizuoka, Shizuoka, Japan). For transient expression of SGLT1, OK/E3V cells were seeded at 75–80% confluence onto 24-well plates 24 h prior to transfection and then transfected with 1 μg of the corresponding plasmid DNAs using Lipofectamine 2000 as described above. After 6 h of incubation with the DNA-lipid complexes, the cells were exposed to serum-containing DMEM/nutrient mixture F-12. 3 days after transfection, cells were used for Na+-dependent glucose uptake assays. Measurement of Na+/H+ Exchange Activity—Na+/H+ exchange activity was determined as the initial rate of Na+-induced recovery of cytosolic pH (pHi) after an acute acid load caused by prepulsing with NH4Cl, and pHi was measured fluorometrically using BCECF-AM as described previously (33Levine S.A. Nath S.K. Yun C.H. Yip J.W. Montrose M. Donowitz M. Tse C.M. J. Biol. Chem. 1995; 270: 13716-13725Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Fluorescence measurements (excitation at 490 and 440 nm with emission at 530 nm) were made using SLM-Aminco SPF-500C and Photon Technology International spectrofluorometers. Briefly, OK/E3V or OK/3HA-E3V cells were grown on glass coverslips to 100% confluency. The monolayers were incubated in serum-free DMEM/nutrient mixture F-12 for 24–48 h prior to use. Cells were loaded with 10 μm BCECF-AM in Na+/NH4Cl medium (88 mm NaCl, 5 mm KCl, 2 mm CaCl2, 1 mm MgSO4, 1 mm NaH2PO4, 25 mm glucose, 20 mm HEPES, and 50 NH4Cl, pH 7.4) for 30 min at 37 °C. During the dye loading and NH4Cl prepulse, cells were treated with test agents or vehicle. The cells were initially perfused with TMA+ medium (130 mm tetramethylammonium (TMA) chloride, 5 mm KCl, 2 mm CaCl2, 1 mm MgSO4, 1 mm NaH2PO4, 25 mm glucose, and 20 mm HEPES, pH 7.4), resulting in stable acidification of the cells. Then, Na+ medium (138 mm NaCl, 5 mm KCl, 2 mm CaCl2, 1 mm MgSO4, 1 mm NaH2PO4, 25 mm glucose, and 20 mm HEPES, pH 7.4) was added, which induced alkalinization of the cells. To determine the kinetics for external Na+ ions, the Na+ concentration in Na+ medium was varied (5, 10, 15, 75, and 138 mm) while maintaining the osmolarity with TMA chloride. For these experiments, cells were acidified to the same level with 50 mm NH4Cl. To calibrate the relationship between the excitation ratio (F500/450) and pHi, the K+/nigericin method was used. As described previously (33Levine S.A. Nath S.K. Yun C.H. Yip J.W. Montrose M. Donowitz M. Tse C.M. J. Biol. Chem. 1995; 270: 13716-13725Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), Na+/H+ exchange rates (H+ efflux) were calculated as the product of Na+-dependent change in pHi and the buffering capacity at each pHi and were analyzed using the nonlinear regression data analysis program Origin, which allows fitting of data to a general allosteric model described by the Hill equation (v = Vmax·[S]napp/K′ + [S]napp, where v is velocity, [S] is the substrate concentration, napp is the apparent Hill coefficient, and K is the affinity constant), with estimates for Vmax and K′(H+)i and their respective errors (S.E.), as well as fitting to a hyperbolic curve such as would be expected with Michaelis-Menten kinetics. Data from each coverslip were calculated and analyzed as described above. For each independent experiment, results from all coverslips for each condition were analyzed together. Uptake Studies—Uptake of MGP or l-alanine was assayed in the presence and absence of Na+ as described previously (34Malström K. Stange G. Murer H. Biochim. Biophys. Acta. 1987; 902: 269-277Crossref PubMed Scopus (92) Google Scholar, 35Van den Bosch L. de Smedt H. Borghgraf R. Biochim. Biophys. Acta. 1989; 979: 91-98Crossref PubMed Scopus (38) Google Scholar). For uptake experiments, OK/E3V cells were plated onto 24-well plates. Confluent cell monolayers were incubated in serum-free medium for 48 h before the uptake experiments. Transiently transfected OK/E3V cells (for MGP uptake) were used ∼72 h after transfection and incubated in serum-free DMEM/nutrient mixture F-12 for 6 h before study. Cell monolayers were treated with 10 mm MβCD or with H2O as a vehicle for 30 min at 37 °C and then washed twice with TMA+ medium (no glucose). MGP or l-alanine uptake was carried out at room temperature and initiated by addition of 0.1 mm MGP/[14C]MGP (0.4 μCi/ml) or 0.2 mml-alanine/l-[3H]alanine (2 μCi/ml). Uptake of substrates was arrested after an appropriate incubation time by aspirating off the radioactive medium and washing three times with ice-cold TMA+ medium without substrate. The radioactivity of isotopes extracted from cell monolayers with 0.5 ml of 1 n NaOH (neutralized with HCl) was assayed by liquid scintillation spectrometry. The amount of accumulated substrate is expressed as cpm/min/well. Measurement of Surface NHE3—The percentage of total cell NHE3 on the apical surface of OK cells was determined separately by cell-surface biotinylation and modified ELISA (7Kurashima K. D'Souza S. Szaszi K. Ramjeeingh Orlowski R. Grinstein J.S. J. Biol. Chem. 1999; 274: 29843-29849Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). For biotinylation, OK/E3V cells were grown to confluent monolayers on plastic dishes, and then the growth was arrested by incubation with serum-free medium for 48 h. Confluent monolayers were treated either with test agent or vehicle at 37 °C under the same conditions used for the detection of NHE3 transport activity and surface-labeled with biotin at 4 °C as described previously (8Akhter S. Cavet M.E. Tse C.M. Donowitz M. Biochemistry. 2000; 39: 1990-2000Crossref PubMed Scopus (50) Google Scholar). All subsequent manipulations were performed at 4 °C. Cells were washed twice with phosphate-buffered saline (PBS; 150 mm NaCl and 20 mm Na2HPO4, pH 7.4); incubated with arginine- and lysine-reactive succinimidyl 2-(biotinamido)ethyl-1,3-dithiopropionate (0.5 mg/ml; Pierce) in 154 mm NaCl, 10 mm boric acid, 7.2 mm KCl, and 1.8 mm CaCl2,pH 9.0; and washed extensively with quenching buffer containing 20 mm Tris and 120 mm NaCl, pH 7.4, to scavenge the unbound biotin. Cells were solubilized with 1 ml of N+ buffer (60 mm HEPES, pH 7.4, 150 mm NaCl, 3 mm KCl, 5 mm Na3EDTA, 3 mm EGTA, and 1% Triton X-100) and protease inhibitor mixture (catalog number P8340, Sigma), and lysates were centrifuged at 2300 × g for 20 min to remove insoluble cell debris and unbroken cells. Supernatants were diluted with N+ buffer to an equal protein concentration, applied to avidin-agarose beads (Pierce) at 4 °C, and incubated for 16 h. The remaining supernatant was retained as the intracellular fraction. Finally, the avidin-agarose beads were washed five times with N+ buffer, and the biotinylated proteins were recovered from the beads in Laemmli buffer. Several fractions of total, intracellular, and surface pools were separated by SDS-PAGE (9%) and transferred onto nitrocellulose membranes (Schleicher & Schüll). The membranes were first incubated with anti-VSV-G monoclonal antibody (P5D4 hybridoma supernatant) as the primary antibody and horseradish peroxidase-conjugated anti-mouse IgG as the secondary antibody. Immunoreactive bands were detected by enhanced chemiluminescence (ECL kit, PerkinElmer Life Sciences). The films were scanned, and the signals were quantified using ImageQuant Version 4.2a software. For ELISA, OK/3HA-E3V cells were used. Cells were plated onto 24-well plates and grown to confluency. 24–48 h before the experiments, cells were incubated in serum-free growth medium. Monolayers were exposed to 10 mm MβCD or vehicle for 30 min at 37 °C. Cells were incubated with anti-HA antibodies (1:1000 dilution) for 1.5 h at 4 °C to prevent endocytosis. The cells were washed up to six times with 1:9 (v/v) cold growth medium/PBS to remove unbound antibodies and then fixed in 3% formaldehyde in PBS for 10 min at room temperature. The cell monolayers were washed three times with PBS, incubated in 100 mm glycine in PBS for 15 min at room temperature, and then blocked with PBS containing 5% fetal bovine serum and 1% bovine serum albumin at room temperature for 30 min. Following blocking, the cells were incubated with horseradish peroxidase-conjugated anti-mouse antibodies (1:500 dilution) for 1 h at room temperature and washed six times with growth medium/PBS. For detection of peroxidase activity, 1 ml of oPD was added to each well and incubated for 15 min at room temperature, and the reaction was stopped by 0.75 m HCl. The supernatants were collected, and the absorbance was measured at 492 nm. The absorbance varied linearly with the amount of peroxidase bound. Serial dilution titration analyses were performed to determine the optimal concentration of reagents used in the ELISA as described (36Hornbeck P. Winston S.E. Fuller S.A. Current Protocols in Molecular Biology,. 2003; (John Wiley & Sons, Inc., New York)Google Scholar). The optimal concentrations of primary and secondary antibodies as well as developing reagent (oPD) and cells were serially diluted and analyzed by crisscross matrix analysis. The analyses showed optimal dilutions of 1:1000 and 1:500 for anti-HA primary antibodies and horseradish peroxidase-conjugated anti-mouse secondary antibodies, respectively, as well as 1 ml for oPD. NHE3 Endocytosis—The reduced GSH-resistant endocytosis assay described previously by us (37Lee-Kwon W. Kawano K. Choi J.W. Kim J.H. Donowitz M. J. Biol. Chem. 2003; 278: 16494-16501Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar) was used with slight modifications. OK/E3V cells were labeled with 1.5 mg/ml sulfosuccinimidyl 2-(biotinamido)ethyl-1,3-dithiopropionate for 1 h at 4 °Cand quenched at 4 °C. The cells were then warmed to 37 °C and treated with 10 mm MβCD or vehicle for 1 h at 37°C. Cells were rinsed with 3× ice-cold phosphate-buffered saline at 4 °C, and then surface biotin was cleaved by washing with 50 mm Tris-HCl and 150 mm GSH, pH 8.8. The freshly endocytosed, biotin-labeled proteins were protected from cleavage with GSH. Cells were solubilized in N+ buffer; biotinylated proteins were retrieved and assayed for endocytosed NHE3 as described above. Fluorescently labeled, IRDye™ 800-conjugated goat anti-mouse secondary antibodies (Rockland Immunochemicals, Inc.) were used for immunoblotting. The fluorescence intensity of NHE3 protein bands was visualized using the Odyssey system (LI-COR Biosciences) and quantitated with Meta-Morph Version 5.0r1 software (Universal Imaging Corp., Downingtown, PA). Sucrose Gradient Density Flotation—To localize NHE3 in OK/E3V cells to LR, total lysate was fractionated by discontinuous sucrose step gradients as described previously (12Li X. Galli T. Leu S. Wade J.B. Weinman E. J. Leung Cheong G. Louvard A. Donowitz D.M. J. Physiol. (Lond.). 2001; 537: 537-552Crossref Scopus (118) Google Scholar, 38Akhter S. Kovbasnjuk O. Li X. Cavet M. Noël J. Arpin M. Hubbard A.L. Donowitz M. Am. J. Physiol. 2002; 283: C927-C940Crossref PubMed Scopus (59) Google Scholar). OK/E3V cells were grown to 100% confluency, serum-starved for 24–48 h, and then treated with 10 mm MβCD or vehicle for 30 min at 37 °C. The monolayers were biotinylated (see “Measurement of Surface NHE3”) and lysed in N+ buffer supplemented with 5 mm dithiothreitol, 1 mm Na3VO4, 50 mm NaF, and protease inhibitor mixture. Total lysates were loaded on 11 discontinuous sucrose step gradients (30, 27.5, 25, 22.5, 20, 17.5, 15, 12.5, 10, 7.5, and 5%). Each step gradient was prepared with sucrose and N+ buffer with 0.1% Triton X-100. Centrifugation was done in a Beckman SW 41Ti rotor at 150,000 × g overnight at 4 °C. Surface NHE3 in each fraction was precipitated by avidin-agarose beads. One-quarter of each fraction (total and surface NHE3) was analyzed by SDS-PAGE, Western blotting, and densitometric analysis using ImageQuant Version 4.2a software. Labeling the Apical Cell Surface with Fluorescent Lectin and Fluorescence Microscopy—To examine the changes in apical membrane structure caused by MβCD treatment, surface labeling with a fluorescent lectin was used (39Kovbasnjuk O.N. Spring K.R. J. Membr. Biol. 2000; 176: 19-29Crossref PubMed Scopus (33) Google Scholar). Lectins bind to specific sugar residues of the glycocalyx; and at 4 °C, the fluorescent markers remain on the apical surface of the monolayers for several hours. OK/E3V cells were grown and treated under the same conditions that were used for Na+/H+ exchange activity assay. The apical surfaces of control and treated cells were labeled with fluorescein isothiocyanate (FITC)-conjugate