Role of Reductase Domain Cluster 1 Acidic Residues in Neuronal Nitric-oxide Synthase
1999; Elsevier BV; Volume: 274; Issue: 32 Linguagem: Inglês
10.1074/jbc.274.32.22313
ISSN1083-351X
AutoresSubrata Adak, Sanjay Ghosh, Husam M. Abu‐Soud, Dennis J. Stuehr,
Tópico(s)Receptor Mechanisms and Signaling
ResumoThe nNOS reductase domain is homologous to cytochrome P450 reductase, which contains two conserved clusters of acidic residues in its FMN module that play varied roles in its electron transfer reactions. To study the role of nNOS reductase domain cluster 1 acidic residues, we mutated two conserved acidic (Asp918 and Glu919) and one conserved aromatic residue (Phe892), and investigated the effect of each mutation on flavin binding, conformational change, electron transfer reactions, calmodulin regulation, and catalytic activities. Each mutation destabilized FMN binding without significantly affecting other aspects including substrate, cofactor or calmodulin binding, or catalytic activities upon FMN reconstitution, indicating the mutational effect was restricted to the FMN module. Characterization of the FMN-depleted mutants showed that bound FMN was essential for reduction of the nNOS heme or cytochrome c, but not for ferricyanide or dichlorophenolindolphenol, and established that the electron transfer path in nNOS is NADPH to FAD to FMN to heme. Steady-state and stopped-flow kinetic analysis revealed a novel role for bound FMN in suppressing FAD reduction by NADPH. The suppression could be relieved either by FMN removal or calmodulin binding. Calmodulin binding induced a conformational change that was restricted to the FMN module. This increased the rate of FMN reduction and triggered electron transfer to the heme. We propose that the FMN module of nNOS is the key positive or negative regulator of electron transfer at all points in nNOS. This distinguishes nNOS from other related flavoproteins, and helps explain the mechanism of calmodulin regulation. The nNOS reductase domain is homologous to cytochrome P450 reductase, which contains two conserved clusters of acidic residues in its FMN module that play varied roles in its electron transfer reactions. To study the role of nNOS reductase domain cluster 1 acidic residues, we mutated two conserved acidic (Asp918 and Glu919) and one conserved aromatic residue (Phe892), and investigated the effect of each mutation on flavin binding, conformational change, electron transfer reactions, calmodulin regulation, and catalytic activities. Each mutation destabilized FMN binding without significantly affecting other aspects including substrate, cofactor or calmodulin binding, or catalytic activities upon FMN reconstitution, indicating the mutational effect was restricted to the FMN module. Characterization of the FMN-depleted mutants showed that bound FMN was essential for reduction of the nNOS heme or cytochrome c, but not for ferricyanide or dichlorophenolindolphenol, and established that the electron transfer path in nNOS is NADPH to FAD to FMN to heme. Steady-state and stopped-flow kinetic analysis revealed a novel role for bound FMN in suppressing FAD reduction by NADPH. The suppression could be relieved either by FMN removal or calmodulin binding. Calmodulin binding induced a conformational change that was restricted to the FMN module. This increased the rate of FMN reduction and triggered electron transfer to the heme. We propose that the FMN module of nNOS is the key positive or negative regulator of electron transfer at all points in nNOS. This distinguishes nNOS from other related flavoproteins, and helps explain the mechanism of calmodulin regulation. Synthesis of nitric oxide (NO) 1The abbreviations used are: NO, nitric oxide; DCIP, dichlorophenolindolphenol; DTT, dithiothreitol; HEPPS, 4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid; FAD, flavin adenine dinucleotide; FMN, flavin mononucleotide; FNR, ferridoxin NADP+ reductase; H4B, (6R)-5,6,7,8-tetrahydro-l-biopterin; NADPH, reduced β-nicotinamide adenine dinucleotide; NOHA, N ω-hydroxy-l-arginine; nNOS, neuronal NO synthase by the neuronal NO synthase (nNOS) can activate as well as modulate many functions in mammalian physiology (1Craven S.E. Bredt D.S. Cell. 1998; 93: 495-498Abstract Full Text Full Text PDF PubMed Scopus (429) Google Scholar, 2Garthwaite J. Boulton C.L. Annu. Rev. Physiol. 1995; 57: 683-706Crossref PubMed Scopus (1537) Google Scholar, 3Kerwin Jr., J.F. Lancaster Jr., J.R. Feldman P.L. J. Med. Chem. 1995; 38: 4343-4362Crossref PubMed Scopus (537) Google Scholar). The nNOS is inactive in its native form and requires Ca2+-promoted calmodulin (CaM) binding for activation (4Bredt D.S. Hwang P.M. Glatt C.E. Lowenstein C. Reed R.R. Snyder S.H. Nature. 1991; 351: 714-718Crossref PubMed Scopus (2171) Google Scholar). This enables nNOS to participate in signal transduction cascades by generating NO in response to increases in intracellular Ca2+ (2Garthwaite J. Boulton C.L. Annu. Rev. Physiol. 1995; 57: 683-706Crossref PubMed Scopus (1537) Google Scholar). nNOS is a bidomain enzyme containing an N-terminal oxygenase domain with binding sites for heme, tetrahydrobiopterin (H4B), and l-arginine (Arg), and a C-terminal reductase domain with binding sites for FMN, FAD, and NADPH (5Richards M.K. Clague M.J. Marletta M.A. Biochemistry. 1996; 35: 7772-7780Crossref PubMed Scopus (35) Google Scholar, 6Sheta E.A. McMillan K. Masters B.S.S. J. Biol. Chem. 1994; 269: 15147-15153Abstract Full Text PDF PubMed Google Scholar, 7Klatt P. Schmidt K. Brunner F. Mayer B. J. Biol. Chem. 1994; 269: 1674-1680Abstract Full Text PDF PubMed Google Scholar, 8McMillan K. Masters B.S.S. Biochemistry. 1995; 34: 3686-3693Crossref PubMed Scopus (169) Google Scholar, 9Gachhui R. Presta A. Bentley D.F. Abu-Soud H.M. McArthur R. Brudvig G. Ghosh D.K. Stuehr D.J. J. Biol. Chem. 1996; 271: 20594-20602Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). A ∼20 amino acid consensus CaM-binding site is located between the nNOS reductase and oxygenase domains (4Bredt D.S. Hwang P.M. Glatt C.E. Lowenstein C. Reed R.R. Snyder S.H. Nature. 1991; 351: 714-718Crossref PubMed Scopus (2171) Google Scholar, 10Vorher T. Knopfel L. Hofmann F. Mollner S. Pfeuffer T. Carafoli E. Biochemistry. 1993; 32: 6081-6088Crossref PubMed Scopus (141) Google Scholar). During NO synthesis the reductase domain transfers electrons from NADPH to the heme. This enables heme-dependent oxygen activation and stepwise conversion of Arg to NO and citrulline, withN-hydroxy-l-arginine (NOHA) being formed as an intermediate (3Kerwin Jr., J.F. Lancaster Jr., J.R. Feldman P.L. J. Med. Chem. 1995; 38: 4343-4362Crossref PubMed Scopus (537) Google Scholar, 11Mayer B. Werner E.R. Naunyn-Schmiedeberg's Arch. Pharmacol. 1995; 351: 453-463Crossref PubMed Scopus (125) Google Scholar, 12Marletta M.A. Cell. 1994; 78: 927-930Abstract Full Text PDF PubMed Scopus (815) Google Scholar). CaM performs a critical role in the process by triggering electron transfer from the reductase domain flavins to the oxygenase domain heme (13Abu-Soud H.M. Stuehr D.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10769-10772Crossref PubMed Scopus (397) Google Scholar, 14Abu-soud H.M. Yoho L.L. Stuehr D.J. J. Biol. Chem. 1994; 269: 32047-32050Abstract Full Text PDF PubMed Google Scholar). Recent evidence suggests this transfer occurs between reductase and oxygenase domains that are located on different subunits of the NOS homodimer (15Siddhanta U. Presta A. Fan B. Wolan D. Rousseau D.L. Stuehr D.J. J. Biol. Chem. 1998; 273: 18950-18958Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar). However, it is still unclear what protein residues facilitate electron transfer, and how CaM controls the domain interaction. The NOS reductase domain actually belongs to a subset of related reductases that contain a N-terminal FMN-containing flavodoxin module that is linked to a C-terminal NADPH- and FAD-binding ferridoxin-like module (FNR) (16Porter T.D. Trends Biochem. Sci. 1991; 16: 154-158Abstract Full Text PDF PubMed Scopus (116) Google Scholar, 17Wang M. Roberts D.L. Paschke R. Shea T.M. Masters B.S.S. Kim J.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8411-8416Crossref PubMed Scopus (668) Google Scholar, 18Sevrioukova I.F. Peterson J.A. Biochimie (Paris). 1995; 77: 562-572Crossref PubMed Scopus (48) Google Scholar). Other similar dual-flavin reductases include NADPH cytochrome P450 reductase, sulfite reductase flavoprotein, and the cytochrome P450BM3 reductase domain. Because of the structural homology, work done with these proteins serves to guide investigation of nNOS. In general, the FNR and FMN modules of these proteins appear to fold separately and function when expressed independently or after being separated by proteolysis (16Porter T.D. Trends Biochem. Sci. 1991; 16: 154-158Abstract Full Text PDF PubMed Scopus (116) Google Scholar, 17Wang M. Roberts D.L. Paschke R. Shea T.M. Masters B.S.S. Kim J.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8411-8416Crossref PubMed Scopus (668) Google Scholar, 18Sevrioukova I.F. Peterson J.A. Biochimie (Paris). 1995; 77: 562-572Crossref PubMed Scopus (48) Google Scholar). A crystal structure of cytochrome P450 reductase has recently revealed the interactions that occur between the FNR and FMN modules of that enzyme (17Wang M. Roberts D.L. Paschke R. Shea T.M. Masters B.S.S. Kim J.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8411-8416Crossref PubMed Scopus (668) Google Scholar). All of these proteins (or their isolated reductase domains) share biochemical similarities in transferring NADPH-derived electrons to either hemeprotein acceptors or attached hemeprotein domains (11Mayer B. Werner E.R. Naunyn-Schmiedeberg's Arch. Pharmacol. 1995; 351: 453-463Crossref PubMed Scopus (125) Google Scholar,18Sevrioukova I.F. Peterson J.A. Biochimie (Paris). 1995; 77: 562-572Crossref PubMed Scopus (48) Google Scholar, 19Schmidt H.H.H.W. Smith R.M. Nakane M. Murad F. Biochemistry. 1992; 31: 3243-3248Crossref PubMed Scopus (146) Google Scholar, 20Vermilion J.L. Ballou D.P. Massey V. Coon M.J. J. Biol. Chem. 1981; 256: 266-277Abstract Full Text PDF PubMed Google Scholar, 21Ostrowski J. Barber M.J. Rueger D.C. Miller B.E. Siegel L.M. Kredich N.M. J. Biol. Chem. 1989; 264: 15796-15808Abstract Full Text PDF PubMed Google Scholar). Electron transfer typically proceeds from NADPH to FAD to FMN to hemeprotein, although this path has not been definitively demonstrated for nNOS. In cytochrome P450BM3, recent work suggests that its FMN module is capable of interacting with both the FNR and attached hemeprotein domain by means of a flexible linker, and this enables the FMN module to shuttle electrons between the FNR and heme during catalysis (22Sevrioukova I.F. Li H. Zhang H. Peterson J.A. Poulos T.L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1863-1868Crossref PubMed Scopus (461) Google Scholar). All of these flavoproteins also transfer NADPH-derived electrons to artificial acceptors including cytochrome c, ferricyanide, and dichlorophenolindolphenol (DCIP) (11Mayer B. Werner E.R. Naunyn-Schmiedeberg's Arch. Pharmacol. 1995; 351: 453-463Crossref PubMed Scopus (125) Google Scholar, 18Sevrioukova I.F. Peterson J.A. Biochimie (Paris). 1995; 77: 562-572Crossref PubMed Scopus (48) Google Scholar, 19Schmidt H.H.H.W. Smith R.M. Nakane M. Murad F. Biochemistry. 1992; 31: 3243-3248Crossref PubMed Scopus (146) Google Scholar, 20Vermilion J.L. Ballou D.P. Massey V. Coon M.J. J. Biol. Chem. 1981; 256: 266-277Abstract Full Text PDF PubMed Google Scholar, 21Ostrowski J. Barber M.J. Rueger D.C. Miller B.E. Siegel L.M. Kredich N.M. J. Biol. Chem. 1989; 264: 15796-15808Abstract Full Text PDF PubMed Google Scholar). Despite the similarities, nNOS is distinguished from these flavoproteins by its ability to increase electron transfer rates to acceptors upon CaM binding (11Mayer B. Werner E.R. Naunyn-Schmiedeberg's Arch. Pharmacol. 1995; 351: 453-463Crossref PubMed Scopus (125) Google Scholar, 14Abu-soud H.M. Yoho L.L. Stuehr D.J. J. Biol. Chem. 1994; 269: 32047-32050Abstract Full Text PDF PubMed Google Scholar, 18Sevrioukova I.F. Peterson J.A. Biochimie (Paris). 1995; 77: 562-572Crossref PubMed Scopus (48) Google Scholar). CaM binding is associated with an increase in tryptophan and flavin fluorescence (19Schmidt H.H.H.W. Smith R.M. Nakane M. Murad F. Biochemistry. 1992; 31: 3243-3248Crossref PubMed Scopus (146) Google Scholar, 23Narayanasami R. Nishimura J.S. McMillan K. Roman L.J. Shea T.M. Robida A.M. Horowitz P.M. Masters B.S.S. Nitric Oxide. 1997; 1: 39-49Crossref PubMed Scopus (32) Google Scholar), suggesting that CaM acts by inducing a conformational change within the reductase domain. Stopped-flow analysis (9Gachhui R. Presta A. Bentley D.F. Abu-Soud H.M. McArthur R. Brudvig G. Ghosh D.K. Stuehr D.J. J. Biol. Chem. 1996; 271: 20594-20602Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 14Abu-soud H.M. Yoho L.L. Stuehr D.J. J. Biol. Chem. 1994; 269: 32047-32050Abstract Full Text PDF PubMed Google Scholar) and work with partially active CaM mutants (24Gachhui R. Abu-Soud H.M. Ghosh D.K. Presta A. Blazing M.A. Mayer B. George S.E. Stuehr D.J. J. Biol. Chem. 1998; 273: 5451-5454Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 25Stevens-Truss R. Beckingham K. Marletta M.A. Biochemistry. 1997; 36: 12337-12345Crossref PubMed Scopus (37) Google Scholar) show that CaM stimulates electron transfer to the acceptors primarily by increasing the rate of NADPH-dependent flavin reduction. Importantly, CaM's ability to speed flavin reduction can occur independent of its triggering nNOS heme reduction (24Gachhui R. Abu-Soud H.M. Ghosh D.K. Presta A. Blazing M.A. Mayer B. George S.E. Stuehr D.J. J. Biol. Chem. 1998; 273: 5451-5454Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 25Stevens-Truss R. Beckingham K. Marletta M.A. Biochemistry. 1997; 36: 12337-12345Crossref PubMed Scopus (37) Google Scholar, 26Cho M.J. Vaghy P.L. Kondo R. Lee S.H. Davis J.P. Rehl R. Heo W.D. Johnson J.D. Biochemistry. 1998; 37: 15593-15597Crossref PubMed Scopus (51) Google Scholar), suggesting that the effects involve different structural elements of CaM. Thus, while nNOS and related flavoproteins display many structural and biochemical similarities, the CaM activation component makes nNOS unique and suggests significant structure-function differences do exist. Studies investigating the interaction between cytochrome P450 reductase and its cytochrome P450 or cytochrome c acceptor hemeproteins have implicated two clusters of acidic residues within the FMN module 207Asp-Asp-Asp209 (cluster 1) and213Glu-Glu-Asp215 (cluster 2) in controlling interactions important for electron transfer (27Shen A.L. Kasper C.B. J. Biol. Chem. 1995; 270: 27475-27480Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). Both clusters reside in the FMN module of the reductase and are highly conserved among related flavoproteins including the NOSs (Fig.1). Mutagenic (27Shen A.L. Kasper C.B. J. Biol. Chem. 1995; 270: 27475-27480Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) and chemical cross-linking (28Nisimoto Y. J. Biol. Chem. 1986; 261: 14232-14239Abstract Full Text PDF PubMed Google Scholar) studies with cytochrome P450 reductase suggested Asp208 of cluster 1 is important for electron transfer to its P450 acceptor hemeprotein. For example, N-demethylase activity of the Asn208 mutant was inhibited by 63% without changing the reductase K m toward cytochrome P450 or NADPH (27Shen A.L. Kasper C.B. J. Biol. Chem. 1995; 270: 27475-27480Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). The mutation did not affect cytochrome c or ferricyanide reductase activities, indicating interaction between the reductase and these molecules is distinct from its interaction with cytochrome P450. Similar observations were reported inAnabaena flavodoxin (29Jenkins C.M. Genzor C.G. Fillat M.F. Waterman M.R. Gomez-Moreno C. J. Biol. Chem. 1997; 272: 22509-22513Crossref PubMed Scopus (27) Google Scholar), where mutagenic analysis of cluster I acidic residues Asp144 and Glu145showed they were involved in flavodoxin-supported P450c17progesterone 17a-hydroxylase activity but not involved in cytochromec reduction. Crystal structures of cytochrome P450 reductase (17Wang M. Roberts D.L. Paschke R. Shea T.M. Masters B.S.S. Kim J.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8411-8416Crossref PubMed Scopus (668) Google Scholar) and Anabaena flavodoxin (30Burkhart B.M. Ramakrishnan B. Yan H. Reedstrom R.J. Markley J.L. Straus N.A. Sundara lingam M. Acta Crystallogr. Sect. D. 1995; 51: 318-330Crossref PubMed Scopus (26) Google Scholar) show that cluster 1 residues are located near the surface, presumably positioned to interact with a positive surface patch on their hemeprotein acceptor. Because protein sequence and functional data suggest that the nNOS reductase domain and cytochrome P450 reductase have a similar secondary and tertiary structure, we hypothesized that cluster 1 residues may also be important in controlling reductase-oxygenase domain interaction and electron transfer in nNOS. We utilized site-directed mutagenesis to assess the importance of conserved amino acids Phe892, Asp918, and Glu919 with respect to FMN binding, electron transfer reactions, and catalytic activities of nNOS. Surprisingly, our data show that these three residues impact nNOS function primarily by stabilizing FMN binding to the reductase. Their mutation resulted in FMN-depleted forms of nNOS, which we used to investigate reductase domain function and how the FMN module participates in nNOS response to CaM. Superoxide dismutase was obtained from Calbiochem and was of the ferrous manganese type. All other regents and materials were obtained from Sigma or from sources previously reported (9Gachhui R. Presta A. Bentley D.F. Abu-Soud H.M. McArthur R. Brudvig G. Ghosh D.K. Stuehr D.J. J. Biol. Chem. 1996; 271: 20594-20602Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar,15Siddhanta U. Presta A. Fan B. Wolan D. Rousseau D.L. Stuehr D.J. J. Biol. Chem. 1998; 273: 18950-18958Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar, 31Huang L. Abu-Soud H.M. Hille R. Stuehr D.J. Biochemistry. 1999; 38: 1912-1920Crossref PubMed Scopus (47) Google Scholar). Wild type and mutant nNOS with a His6 tag attached to the N-terminal of the protein were overexpressed in Escherichia coli strain BL21 (DE3) using a modified PCWori vector and purified as described (31Huang L. Abu-Soud H.M. Hille R. Stuehr D.J. Biochemistry. 1999; 38: 1912-1920Crossref PubMed Scopus (47) Google Scholar, 32Wu C. Zhang J. Abu-Soud H.M. Ghosh D.K. Stuehr D.J. Biochem. Biophys. Res. Commun. 1996; 22: 439-444Crossref Scopus (89) Google Scholar). Restriction digestions, cloning, bacterial growth, and transformation and isolation of DNA fragments were performed using standard procedures (33Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY1989Google Scholar). Site-directed mutagenesis was done using the Altered Sites I in vitro Mutagenesis Kit from Promega. Wild-type nNOS cDNA was cut from PCWori with NdeI and XbaI and cloned into the XbaI site of the pAlter-I mutagenesis vector. Incorporated mutations were confirmed by DNA sequencing at the Cleveland Clinic core facility. DNAs that contained the desired mutations were cloned into the NdeI and XbaI sites of the PCWori vector and transformed into E. coliBL21(DE3). Oligonucleotides used to construct site-directed mutants in the nNOS were synthesized by Life technologies. Silent mutations that incorporate unique restriction sites were also added to aid in screening. Mutations and corresponding oligonucleotides are listed below, with silent mutations underlined and mutagenic codons in bold. The silent restriction site incorporated in the first three oligonucleotides was AflII and in the fourth wasXhoI. D918A, pGGAGAGGATTCTTAAGATGAGGGAGGGGGCTGAGCTTTGCGGAC; E919A: pGGAGAGGATTCTTAAGATGAGGGAGGGGGATGCGCTTTGCGGGAC; D918A, E919A: pGGAGAGGATTCTTAAGATGAGGGAGGGGGCTGCGCTTTGCGGAC; F892A: pGTACCCCCACGCCTGTGCCTTTGGGCATGCGGTGGACACCCTCCTCGAGGAACTGGGA. Transformed bacteria were grown at 37 °C in 3 liters of terrific broth supplemented with 125 mg/liter ampicillin and 20 mg/liter chloramphenicol. Protein expression was induced when the cultures reached an OD600 of 0.8 to 1 by adding 1 mm isopropyl-β-d-thiogalactoside, and the cultures were supplemented with 0.4 mm δ-aminolevulinic acid. After further growth at room temperature for 24 h, the cells were harvested and resuspended in buffer A (40 mm HEPPS, pH 7.6, with 10% glycerol, 1 mm Arg, 150 mm NaCl, 10 μm H4B, 3 mm ascorbic acid) containing 1 mm EDTA, 0.5 mg/ml each of leupeptin and pepstatin, 1 mg/ml lysozyme, and phenylmethylsulfonyl fluoride. Cells were lysed by freeze-thawing three times in liquid nitrogen followed by sonication for three 25-s pulses with a 1-min rest on ice between pulses, using a medium probe Sonicator Cell Disrupter (Model W-220F, Heat systems, Ultrasonics. Inc.). The cell lysate was centrifuged at 4 °C for 30 min and the cell-free supernatant was precipitated by adding 50% (w/v) ammonium sulfate. The precipitant was centrifuged at 4 °C for 30 min at 16,000 rpm in a JA-17 rotor and kept at −70 °C. The ammonium sulfate precipitate was resuspended in a buffer A containing 1 mm phenylmethylsulfonyl fluoride. The resuspended solution was loaded onto a Ni2+nitrilotriacetic acid-Sepharose CL-4B column that had been charged with 50 mm NiSO4 and equilibrated with buffer A containing 1 mm phenylmethylsulfonyl fluoride. The column was washed with 5 times of column buffer and 5 times of column buffer containing 40 mm imidazole. The nNOS protein was eluted with 160 mm imidazole in buffer A and active fractions were pooled and stored at 4 °C overnight in the presence of 1 mm DTT. The fractions were next loaded onto a 2′,5′-ADP-Sepharose column equilibrated with 40 mm HEPPS buffer, pH 7.6, containing 10% glycerol, 0.5 mm Arg, 3 mm DTT, and 2 μm H4B. After adsorption the column was washed with column buffer containing 450 mm NaCl, and the protein was eluted with column buffer containing 10 mm NADPH. Selected fractions were concentrated using a Centriprep-50, dialyzed against 40 mmHEPPS, pH 7.6, containing 10% glycerol, 2.5 mm DTT, and 2 μm H4B, and stored in aliquots at −70 °C. Spectral data was recorded on a Hitachi U3110 Spectrophotometer in the presence of H4B and Arg. Scans of the dithionite-reduced CO-bound proteins were taken in 40 mm HEPPS, pH 7.6, containing 10% glycerol, 1 mm DTT, 1 mm Arg, and 20 μmH4B. The ferrous-CO adduct absorbing at 444 nm was used to quantitate the heme protein content using an extinction coefficient of 74 mm−1 cm−1(A 444-A 500) (34Stuehr D.J. Ikeda-Saito M. J. Biol. Chem. 1992; 267: 20547-20550Abstract Full Text PDF PubMed Google Scholar). Bound FAD and FMN were released from nNOS or mutants by heat denaturation of the enzyme (95 °C for 5 min in the dark). It is essential to use well sealed vials for this procedure in order to avoid loss of sample volume. Subsequently samples were cooled to 4 °C and filtered to remove denatured protein. Samples were injected into a Microsorb Cyano Analytical HPLC Column (5 mm × 4.6 mm × 15 cm) and subjected to isocratic elution with 5 mm ammonium acetate, pH 6.0, containing 20% (v/v) methanol at a flow rate of 1 ml/min. FAD and FMN had retention times of 4.1 and 7.6 min and the peaks were completely resolved. Flavins were detected by fluorescence emission and quantitated based on authentic freshly prepared FAD and FMN standards. The initial rate of NO synthesis by nNOS and mutants was quantitated at 37 °C using the oxyhemoglobin assay for NO (34Stuehr D.J. Ikeda-Saito M. J. Biol. Chem. 1992; 267: 20547-20550Abstract Full Text PDF PubMed Google Scholar). The nNOS (∼25 nm) was added to a cuvette containing 40 mm HEPPS, pH 7.6, containing 15 μg/ml CaM, 0.62 mm CaCl2, 0.3 mm DTT, 5 mm Arg, 4 μm each of FAD and H4B, 100 units/ml catalase, and 10 μm oxyhemoglobin to give a final volume of 0.7 ml. The reaction was started by adding NADPH to give 0.2 mm. The NO-mediated conversion of oxyhemoglobin to methemoglobin was monitored over time as an absorbance increase at 401 nm and quantitated using the extinction coefficient of 38 mm−1 cm−1 . The initial rate of NADPH oxidation at 25 °C was quantitated spectrophotometrically at 340 nm using an extinction coefficient of 6.22 mm−1cm−1. The composition of the assay mixture was similar to that of the NO synthesis measurement except that oxyhemoglobin was absent unless specified otherwise. Wavelengths and extinction coefficient used to quantitate the NADPH-dependent reduction of cytochrome c, DCIP, and ferricyanide were 550 nm (21 mm−1cm−1), 600 nm (20.6 mm−1cm−1), and 420 nm (1.2 mm−1cm−1), respectively. The composition of the assay mixture was 40 mm HEPPS, pH 7.6, 4 μm FAD, 0.1 mg/ml bovine serum albumin, 10 μg/ml CaM, 0.6 mm EDTA, 10 units/ml catalase, 10 units/ml superoxide dismutase, and cytochromec, DCIP, or ferricyanide at 0.1, 0.1, or 1 mm, respectively. In some cases, 0.83 mm Ca2+ was added to promote CaM binding to nNOS. After the addition of nNOS, the reaction was initiated by adding 0.1 mm NADPH.K m values for cytochrome c, CaM, and FMN were determined from experiments in which the concentration of these molecules was varied and by reciprocal analysis of the velocityversus concentration data. All samples were equilibrated at 25 °C under anaerobic conditions in buffer saturated with CO. The cuvette contained 3 μm wild-type nNOS or mutants in CO-saturated 40 mm HEPPS buffer, pH 7.6, containing 0.5 mm DTT, 4 μm H4B, 0.6 mm EDTA, 1 mm Arg, and 6 μm CaM. Concentrated anaerobic NADPH solution was added to the sample to give 0.1 mm. CaM binding and heme reduction were initiated by adding 1 mm CaCl2. Flavin fluorescence measurements were done using a Hitachi model F-2000 spectrofluorometer as described previously (9Gachhui R. Presta A. Bentley D.F. Abu-Soud H.M. McArthur R. Brudvig G. Ghosh D.K. Stuehr D.J. J. Biol. Chem. 1996; 271: 20594-20602Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) with modifications. A 1-ml quartz cuvette with a path length of 1 cm was used for the experiments. The nNOS proteins were diluted to 2 μm in 40 mm HEPPS, pH 7.6, containing 0.6 mm EDTA, 1 mm DTT, and 3 μm CaM. Proteins were irradiated with 450–460 nm light using an in-line 8% filter and their emission spectra were recorded between 450 and 700 nm. In some experiments flavin fluorescence emission at 530 nm was monitored versus time before and after consecutive addition of 1 mm Ca2+ and 3 mm EDTA. The kinetics of flavin reduction were analyzed under anaerobic conditions as described previously (14Abu-soud H.M. Yoho L.L. Stuehr D.J. J. Biol. Chem. 1994; 269: 32047-32050Abstract Full Text PDF PubMed Google Scholar), using a stopped-flow apparatus (Hi-tech Ltd., model SF-51) equipped for anaerobic work. Wild-type nNOS and mutants were briefly treated with ferricyanide and desalted prior to use in these experiments in order to oxidize the residual air-stable flavin semiquinone that is present in nNOS after purification (9Gachhui R. Presta A. Bentley D.F. Abu-Soud H.M. McArthur R. Brudvig G. Ghosh D.K. Stuehr D.J. J. Biol. Chem. 1996; 271: 20594-20602Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 34Stuehr D.J. Ikeda-Saito M. J. Biol. Chem. 1992; 267: 20547-20550Abstract Full Text PDF PubMed Google Scholar). Measurements were made under pseudo first-order conditions and initiated by rapid mixing a solution of 0.1 mm NADPH with a solution containing 3 μmCaM-free or -bound nNOS or mutants in 40 mm HEPPS buffer, pH 7.6, containing 0.5 mm EDTA, 6.0 μm CaM and in some cases, 1 mm Ca2+. The absorbance change was monitored at 485 nm. Signal to noise ratios were improved by averaging the 10 individual scans. The time course of absorbance change was best fit to a single or double exponential equation by use of a nonlinear least-squares method provided by the instrument manufacturer (14Abu-soud H.M. Yoho L.L. Stuehr D.J. J. Biol. Chem. 1994; 269: 32047-32050Abstract Full Text PDF PubMed Google Scholar). The two-step enzyme purification typically yielded about 8 mg of full-length heme-containing nNOS mutants per liter of culture, which is similar to our yield of wild-type nNOS expressed in the same system. Spectroscopic analysis showed that all mutants contained heme in a predominantly low spin state. The heme iron of each mutant was observed to shift to high spin upon addition of 20 μmH4B and 1 mm Arg. Dithionite reduction of each mutant in the presence of Arg, H4B, and CO produced the expected 444-nm absorbance peak for the ferrous-CO complex in all cases (data not shown). These data show that the reductase domain mutations did not alter expression of the full-length enzyme or affect the properties of the heme-containing oxygenase domain. Flavin analysis showed that the mutants contained normal quantities of FAD (∼1 per subunit) but contained below normal or practically undetectable levels of FMN (Table I). The D918A,E919A double mutant and single mutants F892A and D918A had almost no bound FMN, while E919A contained almost half the saturating level of FMN. Thus, the cluster I point mutations reduced or prevented stable binding of FMN by the nNOS reductase domain.Table IFlavin content per heme of wild-type and mutant nNOSEnzymeFADFMNWild-type0.97 ± 0.021.0 ± 0.02D918A0.87 ± 0.02NDaND, not detectable.E919A1.02 ± 0.060.49 ± 0.07D918A,E919A0.92 ± 0.05NDF892A1.03 ± 0.090.09 ± 0.06The values represent the mean and S.E. for three measurements each.a ND, not detectable. Open table in a new tab The values represent the mean and S.E. for three measurements each. TableII compares the catalytic activities (expressed as turnover number per heme) of wild-type and mutant nNOS enzymes with regard to NO synthesis and NADPH oxidation. NO synthesis from either Arg or NOHA was slower or absent in t
Referência(s)