High Mobility Group-I(Y) Protein Facilitates Nuclear Factor-κB Binding and Transactivation of the Inducible Nitric-oxide Synthase Promoter/Enhancer
1999; Elsevier BV; Volume: 274; Issue: 13 Linguagem: Inglês
10.1074/jbc.274.13.9045
ISSN1083-351X
AutoresMark A. Perrella, Andrea Pellacani, Philippe Wiesel, Michael T. Chin, Lauren C. Foster, Maureen Ibanez, Chung-Ming Hsieh, Raymond Reeves, Shaw‐Fang Yet, Mu-En Lee,
Tópico(s)Immune Response and Inflammation
ResumoNitric oxide (NO), a free radical gas whose production is catalyzed by the enzyme NO synthase, participates in the regulation of multiple organ systems. The inducible isoform of NO synthase (iNOS) is transcriptionally up-regulated by inflammatory stimuli; a critical mediator of this process is nuclear factor (NF)-κB. Our objective was to determine which regulatory elements other than NF-κB binding sites are important for activation of the iNOS promoter/enhancer. We also wanted to identify transcription factors that may be functioning in conjunction with NF-κB (subunits p50 and p65) to drive iNOS transcription. Deletion analysis of the iNOS promoter/enhancer revealed that an AT-rich sequence (−61 to −54) downstream of the NF-κB site (−85 to −76) in the 5′-flanking sequence was important for iNOS induction by interleukin-1β and endotoxin in vascular smooth muscle cells. This AT-rich sequence, corresponding to an octamer (Oct) binding site, bound the architectural transcription factor high mobility group (HMG)-I(Y) protein. Electrophoretic mobility shift assays showed that HMG-I(Y) and NF-κB subunit p50 bound to the iNOS promoter/enhancer to form a ternary complex. The formation of this complex required HMG-I(Y) binding at the Oct site. The location of an HMG-I(Y) binding site typically overlaps that of a recruited transcription factor. In the iNOS promoter/enhancer, however, HMG-I(Y) formed a complex with p50 while binding downstream of the NF-κB site. Furthermore, overexpression of HMG-I(Y) potentiated iNOS promoter/enhancer activity by p50 and p65 in transfection experiments, suggesting that HMG-I(Y) contributes to the transactivation of iNOS by NF-κB. Nitric oxide (NO), a free radical gas whose production is catalyzed by the enzyme NO synthase, participates in the regulation of multiple organ systems. The inducible isoform of NO synthase (iNOS) is transcriptionally up-regulated by inflammatory stimuli; a critical mediator of this process is nuclear factor (NF)-κB. Our objective was to determine which regulatory elements other than NF-κB binding sites are important for activation of the iNOS promoter/enhancer. We also wanted to identify transcription factors that may be functioning in conjunction with NF-κB (subunits p50 and p65) to drive iNOS transcription. Deletion analysis of the iNOS promoter/enhancer revealed that an AT-rich sequence (−61 to −54) downstream of the NF-κB site (−85 to −76) in the 5′-flanking sequence was important for iNOS induction by interleukin-1β and endotoxin in vascular smooth muscle cells. This AT-rich sequence, corresponding to an octamer (Oct) binding site, bound the architectural transcription factor high mobility group (HMG)-I(Y) protein. Electrophoretic mobility shift assays showed that HMG-I(Y) and NF-κB subunit p50 bound to the iNOS promoter/enhancer to form a ternary complex. The formation of this complex required HMG-I(Y) binding at the Oct site. The location of an HMG-I(Y) binding site typically overlaps that of a recruited transcription factor. In the iNOS promoter/enhancer, however, HMG-I(Y) formed a complex with p50 while binding downstream of the NF-κB site. Furthermore, overexpression of HMG-I(Y) potentiated iNOS promoter/enhancer activity by p50 and p65 in transfection experiments, suggesting that HMG-I(Y) contributes to the transactivation of iNOS by NF-κB. Nitric oxide (NO) is a free radical gas that participates in the physiologic or pathophysiologic regulation of multiple organ systems (1Moncada S. Palmer R.M. Higgs E.A. Pharmacol. Rev. 1991; 43: 109-142PubMed Google Scholar, 2Nathan C. FASEB J. 1992; 6: 3051-3064Crossref PubMed Scopus (4161) Google Scholar, 3Nathan C. J. Clin. Invest. 1998; 100: 2417-2423Crossref Scopus (845) Google Scholar). Production of NO from its substrate, l-arginine, is catalyzed by NO synthase (NOS) 1The abbreviations used are:NOS, nitric-oxide synthase; HMG, high mobility group; NF, nuclear factor; Oct, octamer; iNOS (or NOS2), inducible isoform of NO synthase; IL, interleukin; LPS, lipopolysaccharide; RASMC, rat aortic smooth muscle cells; CAT, chloramphenicol acetyltransferase; IFN, interferon; bp, base pair(s); FBS, fetal bovine serum; IRF, IFN regulatory factor; EMSA, electrophoretic mobility shift assay. (4Ignarro J.J. Annu. Rev. Pharmacol. Toxicol. 1990; 30: 535-560Crossref PubMed Scopus (1224) Google Scholar, 5Nathan C. Xie Q.-w. Cell. 1994; 78: 915-918Abstract Full Text PDF PubMed Scopus (2758) Google Scholar). Three isoforms of NOS (NOS 1–3) are present in mammalian cells, each encoded by a unique gene. The high output pathway of NO production is catalyzed byNOS2, a transcriptionally regulated gene that is induced after immunologic or inflammatory stimuli. We refer to this inducible NOS2 isoform as iNOS. Although iNOS was originally identified and characterized in macrophages (6Xie Q.-w. Cho H.J. Calaycay J. Mumford R.A. Swiderek K.M. Lee T.D. Ding A. Troso T. Nathan C. Science. 1992; 256: 225-228Crossref PubMed Scopus (1741) Google Scholar, 7Lowenstein C.J. Glatt C.S. Bredt D.S. Snyder S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6711-6715Crossref PubMed Scopus (622) Google Scholar, 8Lyons C.R. Orloff G.J. Cunningham J.M. J. Biol. Chem. 1992; 267: 6370-6374Abstract Full Text PDF PubMed Google Scholar), it is present in numerous cell types including vascular smooth muscle cells (9Nunokawa Y. Ishida N. Tanaka S. Biochem. Biophys. Res. Commun. 1993; 191: 89-94Crossref PubMed Scopus (328) Google Scholar, 10Koide M. Kawahara Y. Tsuda T. Yokoyama M. FEBS Lett. 1993; 318: 213-217Crossref PubMed Scopus (110) Google Scholar, 11Perrella M.A. Yoshizumi M. Fen Z. Tsai J.-C. Hsieh C.-M. Kourembanas S. Lee M.-E. J. Biol. Chem. 1994; 269: 14595-14600Abstract Full Text PDF PubMed Google Scholar). Much of the initial evaluation of the mouse iNOS gene focused on its transcriptional regulation in macrophages after lipopolysaccharide (LPS) and interferon (IFN)-γ stimulation (12Xie Q.-w. Whisnant R. Nathan C. J. Exp. Med. 1993; 177: 1779-1784Crossref PubMed Scopus (1030) Google Scholar, 13Lowenstein C.J. Alley E.W. Raval P. Snowman A.M. Snyder S.H. Russell S.W. Murphy W.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9730-9734Crossref PubMed Scopus (1008) Google Scholar). Dissection of the iNOS promoter/enhancer revealed that a downstream nuclear factor (NF)-κB site (−85 to −76, NF-κBd) is critical for activation of iNOS by LPS in macrophages. In the presence of LPS, c-Rel or Rel A (p65) binds with p50 to form heterodimers on the iNOS promoter/enhancer, in conjunction with additional unidentified proteins (14Xie Q.-w. Kashiwabara Y. Nathan C. J. Biol. Chem. 1994; 269: 4705-4708Abstract Full Text PDF PubMed Google Scholar). Further studies revealed that a more upstream region of the iNOS promoter/enhancer (−951 to −911) is responsible for the synergistic induction of iNOS by IFN-γ and LPS. IFN regulatory factor (IRF)-1 binding to an IRF binding site (IRF-E) (15Martin E. Nathan C. Xie Q.-w. J. Exp. Med. 1994; 180: 977-984Crossref PubMed Scopus (455) Google Scholar) and Stat1α binding to an IFN-γ-activated site (16Gao J. Morrison D.C. Parmely T.J. Russell S.W. Murphy W.J. J. Biol. Chem. 1997; 272: 1226-1230Crossref PubMed Scopus (271) Google Scholar) contribute to optimal induction of iNOS by IFN-γ and LPS. Interleukin (IL)-1β and tumor necrosis factor-α (important pro-inflammatory cytokines generated after LPS stimulation in vivo; Refs. 17Bone R.C. Ann. Intern. Med. 1991; 115: 457-469Crossref PubMed Scopus (1238) Google Scholar and 18Parrillo J.E. N. Engl. J. Med. 1993; 328: 1471-1477Crossref PubMed Scopus (1507) Google Scholar) are potent activators of iNOS transcription in vascular smooth muscle cells (10Koide M. Kawahara Y. Tsuda T. Yokoyama M. FEBS Lett. 1993; 318: 213-217Crossref PubMed Scopus (110) Google Scholar, 11Perrella M.A. Yoshizumi M. Fen Z. Tsai J.-C. Hsieh C.-M. Kourembanas S. Lee M.-E. J. Biol. Chem. 1994; 269: 14595-14600Abstract Full Text PDF PubMed Google Scholar, 19Beasley D. Eldridge M. Am. J. Physiol. 1994; 266: R1197-R1203PubMed Google Scholar). We have shown that the downstream NF-κBd site (−85 to −76) is important for proinflammatory cytokine induction of the iNOS promoter/enhancer in vascular smooth muscle cells (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). However, elements other than this NF-κBd site in the downstream portion of the iNOS 5′-flanking sequence (−234 to +31) also appear to be crucial for full activation of iNOS (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). We designed the present study to further elucidate the important regulatory elements in region −234 to +31 responsible for iNOS induction in vascular smooth muscle cells by the proinflammatory cytokine IL-1β. Goldring and colleagues (21Goldring C.E.P. Reveneau S. Algarte M. Jeannin J.-F. Nucleic Acids Res. 1996; 24: 1682-1687Crossref PubMed Scopus (87) Google Scholar) demonstrated by in vivofootprint analysis in macrophages that, in addition to the NF-κB sites, nuclear protein binding occurred after LPS stimulation at NF-IL6 (−150 to −142) and octamer (Oct) (−61 to −54) sites of the iNOS promoter/enhancer (21Goldring C.E.P. Reveneau S. Algarte M. Jeannin J.-F. Nucleic Acids Res. 1996; 24: 1682-1687Crossref PubMed Scopus (87) Google Scholar). Their report revealed potential binding sites in region −234 to +31 of the iNOS promoter/enhancer but lacked a detailed functional analysis of these sites. Until our present study, the functional importance of these sites in vascular smooth muscle cells had not been elucidated. Furthermore, there had been no identification of nuclear proteins (binding in the downstream region of the iNOS promoter/enhancer) that facilitate iNOS transactivation by NF-κB. Nuclear proteins that interact with members of the NF-κB family include the nonhistone chromosomal proteins of the high mobility group (HMG)-I(Y) family (22Bustin M. Reeves R. Prog. Nucleic Acids Res. Mol. Biol. 1996; 54: 35-100Crossref PubMed Google Scholar). HMG-I(Y) proteins play a role in the transcriptional regulation of certain mammalian genes whose promoter/enhancer regions contain AT-rich sequences (22Bustin M. Reeves R. Prog. Nucleic Acids Res. Mol. Biol. 1996; 54: 35-100Crossref PubMed Google Scholar, 23Bustin M. Lehn D.A. Landsman D. Biochim. Biophys. Acta. 1990; 1049: 231-243Crossref PubMed Scopus (440) Google Scholar, 24Grosschedl R. Giese K. Pagel J. Trends Genet. 1994; 10: 94-100Abstract Full Text PDF PubMed Scopus (736) Google Scholar). HMG-I(Y) refers to two proteins, HMG-I and HMG-Y, that are alternatively spliced products of the same gene (25Johnson K.R. Lehn D.A. Elton T.S. Barr P.J. Reeves R. J. Biol. Chem. 1988; 263: 18338-18342Abstract Full Text PDF PubMed Google Scholar). HMG-I(Y) binds to AT-rich regions in the minor groove of DNA (26Reeves R. Nissen M.S. J. Biol. Chem. 1990; 265: 8573-8582Abstract Full Text PDF PubMed Google Scholar), and it is known to bind Oct sequence motifs (27Eckner R. Birnstiel M.L. Nucleic Acids Res. 1989; 17: 5947-5959Crossref PubMed Scopus (57) Google Scholar). HMG-I(Y) facilitates the assembly of functional nucleoprotein complexes (enhanceosomes) by modifying DNA conformation and by recruiting nuclear proteins to an enhancer (28Falvo J.V. Thanos D. Maniatis T. Cell. 1995; 83: 1101-1111Abstract Full Text PDF PubMed Scopus (277) Google Scholar,29Thanos D. Maniatis T. Cell. 1995; 83: 1091-1100Abstract Full Text PDF PubMed Scopus (858) Google Scholar). The role of HMG-I(Y) in enhanceosome assembly has been studied extensively in the IFN-β gene after viral stimulation (28Falvo J.V. Thanos D. Maniatis T. Cell. 1995; 83: 1101-1111Abstract Full Text PDF PubMed Scopus (277) Google Scholar, 29Thanos D. Maniatis T. Cell. 1995; 83: 1091-1100Abstract Full Text PDF PubMed Scopus (858) Google Scholar, 30Thanos D. Maniatis T. Cell. 1992; 71: 777-789Abstract Full Text PDF PubMed Scopus (559) Google Scholar, 31Du W. Thanos D. Maniatis T. Cell. 1993; 74: 887-898Abstract Full Text PDF PubMed Scopus (395) Google Scholar, 32Thanos D. Maniatis T. Mol. Cell. Biol. 1995; 15: 152-164Crossref PubMed Scopus (127) Google Scholar, 33Kim T.K. Maniatis T. Mol. Cell. 1997; 1: 119-129Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar). HMG-I(Y) has been shown to enhance the binding of transcription factors, such as NF-κB and activating transcription factor-2, to their binding sites by DNA-protein and protein-protein interactions (28Falvo J.V. Thanos D. Maniatis T. Cell. 1995; 83: 1101-1111Abstract Full Text PDF PubMed Scopus (277) Google Scholar, 29Thanos D. Maniatis T. Cell. 1995; 83: 1091-1100Abstract Full Text PDF PubMed Scopus (858) Google Scholar, 30Thanos D. Maniatis T. Cell. 1992; 71: 777-789Abstract Full Text PDF PubMed Scopus (559) Google Scholar, 31Du W. Thanos D. Maniatis T. Cell. 1993; 74: 887-898Abstract Full Text PDF PubMed Scopus (395) Google Scholar, 32Thanos D. Maniatis T. Mol. Cell. Biol. 1995; 15: 152-164Crossref PubMed Scopus (127) Google Scholar, 33Kim T.K. Maniatis T. Mol. Cell. 1997; 1: 119-129Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar). Because of the aforementioned properties of HMG-I(Y), we determined whether this protein bound to the iNOS promoter/enhancer and interacted with NF-κB subunits to regulate iNOS gene transcription. We also determined whether the site of HMG-I(Y) binding overlapped a binding site for NF-κB (as occurs with IFN-β), or if HMG-I(Y) bound at a site different from NF-κB. Salmonella typhosa LPS (Sigma) was dissolved in 0.9% saline and stored at −20 °C. Recombinant human IL-1β (Collaborative Biomedical, Bedford, MA) was stored at −80 °C until use. Recombinant human NF-κB subunit p50 (Promega Corp., Madison, WI) was also stored at −80 °C until use. A goat polyclonal antibody to p50 (Santa Cruz Biotechnology, Santa Cruz, CA) was used for supershift experiments. Rat aortic smooth muscle cells (RASMC) were harvested from male Sprague-Dawley rats (200–250 g) by enzymatic dissociation according to the method of Gunther et al. (34Gunther S. Alexander R.W. Atkinson W.J. Gimbrone Jr., M.A. J. Cell Biol. 1982; 92: 289-298Crossref PubMed Scopus (278) Google Scholar). The cells were cultured in Dulbecco's modified Eagle's medium (JRH Biosciences, Lenexa, KS) supplemented with 10% heat-inactivated fetal bovine serum (FBS, HyClone, Logan, UT), penicillin (100 units/ml), streptomycin (100 μg/ml), and 25 mm HEPES (pH 7.4) (Sigma) in a humidified incubator at 37 °C. RASMC were passaged every 4–5 days, and experiments were performed on cells 4–6 passages from primary culture. Rat alveolar macrophage cell line NR8383 (35Helmke R.J. Boyd R.L. German V.F. Mangos J.A. In Vitro Cell. Dev. Biol. 1987; 23: 567-574Crossref PubMed Scopus (103) Google Scholar) was grown in RPMI 1640 medium (JRH Biosciences) supplemented with 2% heat-inactivated FBS (HyClone), penicillin (100 units/ml), and streptomycin (100 μg/ml) (Sigma) in a humidified incubator at 37 °C. Drosophila SL2 cells (ATCC, Rockville, MD) (36Schneider I. J. Embryol. Exp. Morphol. 1972; 27: 353-365PubMed Google Scholar) were maintained at 23 °C in Schneider's insect medium (Sigma) supplemented with 12% heat-inactivated FBS and gentamycin (50 μg/ml). Plasmid pGL2-Basic contained the firefly luciferase gene without any promoter (Promega, Madison, WI). Reporter constructs containing fragments of the mouse iNOS 5′-flanking sequence were named according to the location of the fragment from the transcription start site in the 5′ and 3′ directions. A 1516-base pair (bp) fragment amplified from mouse genomic DNA, containing 1485 bp of the 5′-flanking region and the first 31 bp after the transcription start site, was named iNOS(−1485/+31), as described (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). A shorter fragment, iNOS(−234/+31), was generated by polymerase chain reaction from iNOS(−1485/+31) as described (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). The downstream NF-κBd site was mutated (−85 to −83, GGG to CTC) in the −1485 to +31 fragment by using a site-directed mutagenesis technique (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), and this construct was named iNOS(−1485/+31 NF-κBm). To localize binding elements other than NF-κBd that may be important for IL-1β or LPS induction of iNOS, we used iNOS(−1485/+31 NF-κBm) as a template to generate a series of truncated iNOS 5′-flanking fragments by polymerase chain reaction. Constructs containing these 5′-deletion fragments were named iNOS(−331/+31 NF-κBm), iNOS(−208/+31 NF-κBm), iNOS(−141/+31 NF-κBm), iNOS(−97/+31 NF-κBm), and iNOS(−69/+31). We also used iNOS(−1485/+31) or iNOS(−1485/+31 NF-κBm) as a template to mutate the downstream Oct site (−61 to −54, ATGCAAAA to CGTACCCC) by a site-directed technique (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). The new constructs were named iNOS(−331/+31 OCTm) and iNOS(−331/+31 NF/OCTm). All constructs were inserted into pGL2-Basic and sequenced by the dideoxy nucleotide chain termination method (37Sambrook J. Fritsh E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Plainview, NY1989Google Scholar) to confirm the insert's orientation and sequence. Plasmid pOPRSVI-CAT contained the prokaryotic chloramphenicol acetyltransferase (CAT) gene (Stratagene, La Jolla, CA) driven by a Rous sarcoma virus-long terminal repeat promoter. Plasmid pPAC was described elsewhere (29Thanos D. Maniatis T. Cell. 1995; 83: 1091-1100Abstract Full Text PDF PubMed Scopus (858) Google Scholar, 38Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1079) Google Scholar). NF-κB subunit p50 and p65 expression constructs were made by inserting cDNAs coding for the subunits into the BamHI site of pPAC (39Krasnow M.A. Saffman E.E. Kornfeld K. Hogness D.S. Cell. 1989; 57: 1031-1043Abstract Full Text PDF PubMed Scopus (206) Google Scholar). Expression vectors phsp82LacZ and pPACHMGI were described elsewhere (29Thanos D. Maniatis T. Cell. 1995; 83: 1091-1100Abstract Full Text PDF PubMed Scopus (858) Google Scholar). RASMC were transfected by a DEAE-dextran method (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). In brief, 500,000 cells were plated onto 100-mm tissue culture dishes and allowed to grow for 48–72 h (until 80–90% confluent). Then iNOS luciferase constructs and pOPRSVI-CAT (to correct for differences in transfection efficiency) were added (5 μg each) to the RASMC in a solution containing 500 μg/ml DEAE-dextran. RASMC were subsequently shocked with 5% dimethyl sulfoxide solution for 1 min and then allowed to recover in medium containing 10% heat-inactivated FBS. Twelve hours after transfection, RASMC were placed in 2% FBS. RASMC were then stimulated with vehicle, human recombinant IL-1β (10 ng/ml), or LPS (1 μg/ml) for 48 h. The doses of IL-1β and LPS, and the duration of stimulation, were chosen on the basis of pilot experiments (data not shown). Rat alveolar macrophages (NR8383) were also transfected by the same DEAE-dextran method (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), with the exception that they were treated in a floating suspension (the RASMC were attached to culture dishes). Twelve hours after transfection, the macrophages were stimulated with LPS (1 μg/ml) for 48 h. In both the RASMC and macrophage transfection experiments, cell extracts were prepared by detergent lysis (Promega), and luciferase activity was measured with an AutoLumat LB953 luminometer (EG&G, Gaithersburg, MD) and the Promega luciferase assay system. To evaluate the efficiency of transfection, we performed a CAT assay by a modified two-phase fluor diffusion method as described (40Lee M.-E. Bloch K.D. Clifford J.A. Quertermous T. J. Biol. Chem. 1990; 265: 10446-10450Abstract Full Text PDF PubMed Google Scholar, 41Fen Z. Dhadly M.S. Yoshizumi M. Hilkert R.J. Quertermous T. Eddy R.L. Shows T.B. Lee M.-E. Biochemistry. 1993; 32: 7932-7938Crossref PubMed Scopus (55) Google Scholar). The ratio of luciferase to CAT activity in each sample served as a measure of normalized luciferase activity. SL2 cells were transfected by the calcium-phosphate method according to Di Nocera and Dawid (42Di Nocera P.P. Dawid I.B. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 7095-7098Crossref PubMed Scopus (268) Google Scholar). In brief, SL2 cells were plated in six-well tissue culture dishes (Costar Corp, Cambridge, MA) 24 h before transfection. Transfection was then performed in six separate wells for each condition. iNOS plasmids were added at 1 μg/well. Plasmids p50-pPAC, p65-pPAC, and phsp82LacZ were added at 100 ng/well. Plasmid pPACHMGI was added at 1 μg/well, alone or in combination with p50-pPAC or p65-pPAC (or both). The expression plasmid doses were chosen on the basis of pilot experiments (data not shown). Forty-eight hours after the initial transfection, extracts from the SL2 cells were prepared and luciferase activity was measured as described for RASMC. β-Galactosidase assays were performed as described elsewhere (43Yoshizumi M. Hsieh C.-M. Zhou F. Tsai J.-C. Patterson C. Perrella M.A. Lee M.-E. Mol. Cell. Biol. 1995; 15: 3266-3272Crossref PubMed Scopus (76) Google Scholar). The ratio of luciferase activity to β-galactosidase activity in each sample served as a measure of normalized luciferase activity. The prokaryotic expression plasmid for mouse HMG-I(Y), pRSETHMG-I(Y), was prepared as described (44Chin M.T. Pellacani A. Wang H. Lin S.S.J. Jain M.K. Perrella M.A. Lee M.-E. J. Biol. Chem. 1998; 273: 9755-9760Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Plasmid pRSETHMG-I(Y) (containing the HMG-I(Y) protein, a vector-derived polyhistidine tag, and an enterokinase cleavage site) was transferred into Escherichia coli strain BL21(DE3)pLysS. Expression was induced in culture (mid-log phase) by the addition of 1 mm isopropyl-1-thio-β-d-galactopyranoside. Three hours after induction of expression, the bacteria were lysed and HMG-I(Y) was purified by cobalt affinity chromatography under denaturing conditions according to the instructions of the manufacturer (CLONTECH). Proteins were renatured by dialysis overnight against 20 mm HEPES (pH 7.8), 20 mmKCl, and 0.2% Tween 20 at 4 °C. The dialysate was stored at −80 °C until use. EMSA were performed with double-stranded oligonucleotide probes encoding region −87 to −52 of the iNOS 5′-flanking sequence (TGGGGACTCTCCCTTTGGGAACAGTTATGCAAAATA). Probes were also generated with mutations in the −85 to −76 NF-κBd site (TGCTCCAGAGGGCTTTGGGAACAGTTATGCAAAATA) and the −61 to −54 Oct site (TGGGGACTCTCCCTTTGGGAACAGTTCGTACCCCTA). Prior to annealing, polynucleotide kinase (Boehringer Mannheim) was used to label the oligonucleotides with [γ-32P]ATP. A typical binding reaction contained 20,000 cpm DNA probe, 10 mmTris-HCl (pH 7.5), 50 mm KCl, 0.1 mm EDTA, 250 μg/ml acetylated bovine serum albumin, 1 mmdithiothreitol, 5% glycerol, 500 ng of poly(dG-dC·dG-dC), and recombinant HMG-I(Y) and/or p50 protein in a final volume of 25 μl. The reaction mixture was allowed to incubate for 20 min at room temperature. The DNA-protein complexes were then fractionated on a 5% native polyacrylamide electrophoretic gel in a 0.25× Tris borate-EDTA recirculating buffer system at 4 °C. Data from the SL2 cell transfection experiments were subjected to analysis of variance followed by Scheffe's test. Significance was assumed at p < 0.05. We have demonstrated elsewhere that the IL-1β-responsive elements in iNOS reside between bp −234 and +31 of the 5′-flanking sequence (20Perrella M.A. Patterson C. Tan L. Yet S.-F. Hsieh C.-M. Yoshizumi M. Lee M.-E. J. Biol. Chem. 1996; 271: 13776-13780Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Our previous data also suggested that elements other than NF-κBd in this downstream region contributed to activation of the iNOS promoter/enhancer by IL-1β in vascular smooth muscle cells. To reveal these other IL-1β-responsive elements in the iNOS 5′-flanking sequence, we generated deletion constructs containing a mutated NF-κBd site. This approach ensured that any induction of iNOS promoter/enhancer activity after transfection of the constructs into vascular smooth muscle cells would not be the result of nuclear protein binding to the NF-κBd site. Beyond a decrease in iNOS promoter/enhancer activity after mutation of the NF-κBd site (Fig. 1), no further reduction in IL-1β responsiveness occurred, even after the iNOS 5′-flanking sequence had been reduced to a construct containing bases −69 to +31 of the downstream promoter. Other than the TATA box, an AT-rich Oct site (−61 to −54) remained in this portion of the iNOS 5′-flanking sequence. Using site-directed mutagenesis, we generated constructs of the downstream iNOS 5′-flanking sequence that contained no mutations (iNOS(−234/+31)), a mutation at the NF-κBd site (iNOS(−331/+31 NF-κBm)), a mutation at the Oct site (iNOS(−331/+31 OCTm)), or mutations at both sites (iNOS(−331/+31 NF/OCTm)). These constructs were transfected into RASMC and stimulated with vehicle or IL-1β. Mutation of the NF-κBd site produced a 69% reduction in iNOS promoter/enhancer activity after stimulation with IL-1β (Fig. 2). Furthermore, mutation of the Oct site led to an even greater reduction (90%) in iNOS activity after IL-1β stimulation. Mutating both sites did not cause iNOS promoter/enhancer activity to fall below the level obtained by mutating the Oct site alone. Taken together, the data in Fig. 2 suggest that the Oct binding site (−61 to −54) is critical for induction of iNOS promoter/enhancer activity by IL-1β in vascular smooth muscle cells. The absence of a further reduction in iNOS promoter/enhancer activity after mutation of both sites suggests that there may be an interaction between nuclear proteins that bind at the Oct site and nuclear proteins that bind at the NF-κBd site. There were no significant differences in promoter/enhancer activity among iNOS constructs that received vehicle alone. To determine if this Oct site was important for iNOS induction by inflammatory stimuli other than IL-1β, we transfected constructs iNOS(−234/+31), iNOS(−331/+31 NF-κBm), iNOS(−331/+31 OCTm), and iNOS(−331/+31 NF/OCTm) into RASMC and stimulated the cells with LPS. LPS and IL-1β had an almost identical effect on iNOS promoter/enhancer activity. Mutation of the NF-κBd site caused a significant reduction (72%) in iNOS promoter/enhancer activity after LPS stimulation; activity was reduced even further (87%) in the construct containing a mutated Oct site (Fig.3 A). Again, activity after mutation of both sites was not different from activity after mutation of the Oct site alone. We also transfected these constructs into alveolar macrophages and stimulated the cells with LPS. In comparison with iNOS promoter/enhancer activity in vascular smooth muscle cells, mutation of the NF-κBd site produced a more dramatic reduction in macrophages (85%) after LPS stimulation (Fig.3 B). Mutation of the Oct site again caused a dramatic reduction (92%) in iNOS promoter/enhancer activity after LPS stimulation. These experiments demonstrate that binding of nuclear proteins at the downstream Oct site is important for activation of the iNOS promoter/enhancer in both vascular smooth muscle cells and macrophages, and that this site is important for iNOS activation after stimulation with two mediators of inflammation, IL-1β and LPS. To determine if HMG-I(Y) could bind to the iNOS promoter/enhancer region containing the NF-κBd and Oct sites, we performed EMSA with a radiolabeled probe encoding region −87 to −52 of the iNOS 5′-flanking sequence. Incubation of recombinant HMG-I(Y) with the probe containing intact NF-κBd and Oct sites resulted in a DNA-protein complex (Fig.4 A). This complex was specific because a 500-fold molar excess of unlabeled identical oligonucleotide, but not unrelated oligonucleotide, competed for HMG-I(Y) binding and abolished the DNA-protein complex. To localize the site of HMG-I(Y) binding, we incubated recombinant HMG-I(Y) with a radiolabeled probe containing intact NF-κBd and Oct sites, a mutated NF-κBd site, or a mutated Oct site. Like the wild-type probe containing intact binding sites, the probe containing a mutated NF-κBd site was able to bind to HMG-I(Y) (Fig.4 B). Mutation of the AT-rich Oct site, however, resulted in a marked reduction in HMG-I(Y) binding. In addition, a probe containing a mutated region between the NF-κBd and Oct sites did not disrupt HMG-I(Y) binding (data not shown). These data suggest that binding of HMG-I(Y) within region −87 to −52 of the iNOS promoter/enhancer occurs at the Oct binding site. EMSA were performed with a radiolabeled probe encoding region −87 to −52 of the iNOS 5′-flanking sequence (containing intact NF-κBd and Oct sites) and recombinant p50 (an important DNA binding subunit of NF-κB; Re
Referência(s)