Portal de Periódicos da CAPES

Desensitization of G-protein-coupled Receptors

1999; Elsevier BV; Volume: 274; Issue: 3 Linguagem: Inglês

10.1074/jbc.274.3.1440

1083-351X

Zhan Xiao, Yihong Yao, Long Yu, Peter N. Devreotes,

Monoclonal and Polyclonal Antibodies Research

Agonist-induced phosphorylation of G-protein-coupled receptors has been shown to facilitate the desensitization processes, such as receptor internalization, decreased efficiency of coupling to G-proteins, or decreased ligand affinity. The lowered affinity may be an intrinsic property of the phosphorylated receptor or it may be the result of altered interactions between the modified receptor and downstream components such as G-proteins or arrestins. To address this issue, we purified cAR1, the major chemoattractant receptor of Dictyostelium discoideum by a strategy that is independent of the ligand binding capacity of the receptor. To our knowledge, this represents the first successful purification of a chemoattractant receptor. The hexyl-histidine-tagged receptor was solubilized from a highly enriched plasma membrane preparation and purified by Ni2+-chelating chromatography. The protocol offers a simple way to purify 100–500 μg of a G-protein coupled receptor that can be targeted to the plasma membrane ofD. discoideum. The K d value for the purified cAR1 was about 200 nm, consistent with that of receptors that are not coupled to G-proteins in intact cells. In contrast, the affinity of phosphorylated cAR1, purified from desensitized cells, was about three times lower. Treatment of the phosphorylated receptor with protein phosphatases caused dephosphorylation and parallel restoration of higher affinity. We propose that ligand-induced phosphorylation of G-protein-coupled receptors causes a decrease in intrinsic affinity and may be useful in maintaining the receptor's sensitivity at high agonist levels. This affinity decrease may precede other processes such as receptor internalization or uncoupling from G-proteins. Agonist-induced phosphorylation of G-protein-coupled receptors has been shown to facilitate the desensitization processes, such as receptor internalization, decreased efficiency of coupling to G-proteins, or decreased ligand affinity. The lowered affinity may be an intrinsic property of the phosphorylated receptor or it may be the result of altered interactions between the modified receptor and downstream components such as G-proteins or arrestins. To address this issue, we purified cAR1, the major chemoattractant receptor of Dictyostelium discoideum by a strategy that is independent of the ligand binding capacity of the receptor. To our knowledge, this represents the first successful purification of a chemoattractant receptor. The hexyl-histidine-tagged receptor was solubilized from a highly enriched plasma membrane preparation and purified by Ni2+-chelating chromatography. The protocol offers a simple way to purify 100–500 μg of a G-protein coupled receptor that can be targeted to the plasma membrane ofD. discoideum. The K d value for the purified cAR1 was about 200 nm, consistent with that of receptors that are not coupled to G-proteins in intact cells. In contrast, the affinity of phosphorylated cAR1, purified from desensitized cells, was about three times lower. Treatment of the phosphorylated receptor with protein phosphatases caused dephosphorylation and parallel restoration of higher affinity. We propose that ligand-induced phosphorylation of G-protein-coupled receptors causes a decrease in intrinsic affinity and may be useful in maintaining the receptor's sensitivity at high agonist levels. This affinity decrease may precede other processes such as receptor internalization or uncoupling from G-proteins. G-protein-coupled receptors (GPCRs) 1The abbreviations used are: GPCR, G-protein-coupled receptor; cAR1-H6, hexyl-histidine-tagged wild-type cAR1; cm1234-H6, hexyl-histidine-tagged non-phosphorylatable cAR1; PAGE, polyacrylamide gel electrophoresis; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. are involved in a wide variety of important biological processes including vision, olfaction, chemotaxis, and immune response. It is remarkable that the receptors for such diverse stimuli all share the same topological feature of seven-membrane spanning segments. It is believed that these segments cluster to form the binding pocket. Upon agonist binding, the receptors undergo conformational changes, activating intracellularly coupled G-proteins, which proceed to interact with the downstream effectors (1Strader C. Fong T. Graziano M. Tota M. FASEB J. 1995; 9: 745-754Crossref PubMed Scopus (330) Google Scholar). Despite extensive pharmacological studies on certain representative GPCRs, detailed biochemical and biophysical characterization of most of these receptors is still lacking. With the exception of rhodopsin, the extreme difficulties in purifying most GPCRs have hindered studies of the structures and functions of these proteins. A physiologically important property of GPCRs is their tendency to desensitize during exposure to agonist. Desensitization mechanisms include "down-regulation" or reduction of receptor number, "sequestration" or apparent shielding of the receptors from interacting ligands, and "uncoupling" from G-proteins. Agonist-induced receptor phosphorylation, usually carried out by G-protein-coupled receptor kinases, may contribute to each of these processes. In the case of the β-adrenergic receptor and rhodopsin, the two most extensively characterized GPCRs, phosphorylation is proposed to promote the association of arrestins and subsequent uncoupling from G-proteins and internalization (2Hausdorff W.P. Caron M.G. Lefkowitz R.J. FASEB J. 1990; 4: 2881-2889Crossref PubMed Scopus (1087) Google Scholar, 3Lohse M.J. Benovic J.L. Codina J. Caron M.G. Lefkowitz R.J. Science. 1990; 248: 4962Crossref Scopus (909) Google Scholar, 4Benovic J.L. Pike L.J. Cerione R.A. Staniszewski C. Yoshimasa T. Codina J. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1985; 260: 7094-7101Abstract Full Text PDF PubMed Google Scholar). Desensitization may also be accompanied by a lowered affinity of the phosphorylated receptor as in the cases of cAR1, angiotensin II receptor, D2 dopamine receptor (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar, 6Boulay G. Chreiten L. Richard D.E. Guillemette G. Endocrinology. 1994; 135: 2130-2136Crossref PubMed Scopus (43) Google Scholar, 7Boundy V.A. Pacheo M.A. Guan W. Molinoff P.B. Mol. Pharmacol. 1995; 48: 956-964PubMed Google Scholar), and possibly the yeast phermone receptor (21Reneke J.E. Blumer K.J. Courchesne W.E. Thorner J. Cell. 1988; 55: 221-234Abstract Full Text PDF PubMed Scopus (239) Google Scholar). It has been speculated that the lowered affinity is due to receptor uncoupling from G-proteins and consequent coupling to arrestins, but recent evidence suggests that receptor-arrestin complexes also display high affinity (8Gurevich V.V. Pals-Rylaarsdam R. Benovic J.L. Hosey M.M. Onorato J.J. J. Biol. Chem. 1997; 272: 28849-28852Abstract Full Text Full Text PDF PubMed Scopus (154) Google Scholar). It is possible that agonist-induced phosphorylation may lower the intrinsic affinity of the receptor. To investigate the intrinsic properties of a phosphorylated GPCR, we purified cAR1, the major chemoattractant receptor of the social amebae,Dictyostelium discoideum. cAR1 is coupled to the heterotrimeric G-protein G2, which transmits the activation signal downstream to mediate actin polymerization, chemotaxis, calcium uptake, cell-cell signaling, and differentiation (9Devreotes P.N. Neuron. 1994; 12: 235-241Abstract Full Text PDF PubMed Scopus (135) Google Scholar). We developed a purification protocol which, unlike previous GPCR purification schemes, does not rely on the ligand binding capacity of the receptor. In this procedure, a specialized plasma membrane subdomain highly enriched in receptor was isolated (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). After detergent extraction, the solubilized receptor was applied to a Ni2+ column and purified in a single step. Tens of micrograms of purified, active cAR1 are obtained from a liter of cell culture. The agonist affinity of the final purified receptor is similar to that of the binding sites on cells lacking G-proteins. To our knowledge, this represents the first successful attempt to purify a chemoattractant receptor to near homogeneity. In principle, this protocol can be extended to the purification of any GPCR that can be targeted to the plasma membrane ofD. discoideum cells. Using this purification procedure, we have found that the lower affinity displayed by phosphorylated receptors after agonist pretreatment in vivo is an intrinsic property of the modified proteins. When this phosphorylation was blocked by substituting serines 303 and 304, the major phosphorylation sites of cAR1, with alanine and glycine, the mutant receptor failed to display lowered affinity after similar agonist pretreatment (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar). Additionally, protein phosphatase treatment of the phosphorylated receptor led to its dephosphorylation and a corresponding enhanced ligand affinity. This suggests that receptor phosphorylation itself, independent of other interacting components or downstream processes, may directly contribute to the desensitization. C-terminal hexyl-histidine-tagged cAR1 constructs were created by polymerase chain reaction. The N-terminal primer, GCCGGAAGATCT TATTAAAAA ATGGGTCTTTTAGATGGAAATC, contains a BglII site (first underline) at the 5′ end, followed by the Dictyostelium consensus ribosomal binding site (italicized) and the N-terminal residues of cAR1 (second underline). The C-terminal primer, CGAGGCGTAGCTAGCTGGTGGATTATT TCCTTGACCATTTGTTGCA, contains the last six residues of cAR1 sequence (italicized), followed by two prolines (underlined) and a NheI site. Two constructs were made to create the hexyl-histidine-tagged wild-type cAR1 (abbreviated as cAR1-H6), the wild-type cDNA sequence of cAR1 was used as template. To create hexyl-histidine-tagged non-phosphorylatable form of cAR1 (abbreviated as cm1234-H6), a mutant cAR1 sequence in which all C-terminal serine and threonine residues were substituted (cm1234, Ref. 12Kim J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: 2060-2068Crossref PubMed Scopus (26) Google Scholar) was used. A modified pBluescript (Stratagene) containing a hexyl-histidine tag was created as follows: the EcoRV site was replaced with a BglII site. After digestion with BglII and BamHI, a double-stranded filler fragment containing sequentiallyBglII and NheI sites followed by a six-histidine sequence and an in-frame stop codon and a BamHI site was digested with BglII and BamHI and then cloned into the modified vector through BamHI and BglII sites. The sequence for the top strand of the filler (from 5′ to 3′) is as follows: GATCTCGCTCTGCTAGCCACCATCACCATCACCACTAATAAG. The polymerase chain reaction products were gel-purified, digested withBglII and NheI, and then cloned into compatible sites of the above mentioned pBluescript. The final fragments containing the assembled cAR1 followed by a six-histidine tag and stop codon was released by BglII/BamHI digestion and cloned into pB18, a D. discoideum integration expression vector; or released by BglII/NotI digestion and cloned into pMC34, an extra-chromosomal expression vector. Under both conditions the tagged sequence is downstream of the D. discoideum actin 15 promotor and expressed throughout the growth and developmental stages. The expression vectors encoding His-tagged cAR1 were transformed intocar1 − /car3 − cells (12Kim J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: 2060-2068Crossref PubMed Scopus (26) Google Scholar). Clones were grown up and further characterized by cAMP binding assay. The clone giving the highest binding was selected. Cells are maintained in a Petri dish in HL-5 medium (12Kim J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: 2060-2068Crossref PubMed Scopus (26) Google Scholar) plus 20 μg/ml G418. Cells are washed off the plate into large axenic cultures and grown up by shaking at 200 rpm at 22 oC to a density of 5–8 × 106/ml. cAMP binding of intact cells in either phosphate buffer or in saturated ammonium sulfate was carried out essentially as described (12Kim J.-Y. Caterina M.J. Milne J.L.S. Lin K.C. Borleis J.A. Devreotes P.N. J . Biol. Chem. 1997; 272: 2060-2068Crossref PubMed Scopus (26) Google Scholar). Briefly, for assay in phosphate buffer, 100 μl of cells at 108 cells/ml were incubated with various concentrations of [3H]cAMP (NEN Life Science Products Inc.) at 4 oC for 3 min and centrifuged at 12,000 × g for 2 min to remove unbound ligands. For ammonium sulfate assay, cells were suspended in saturated ammonium sulfate and [3H]cAMP was added. One wash with saturated ammonium sulfate was carried out. Background binding was obtained by adding unlabeled cAMP. CHIFF was prepared as described previously (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). Briefly, cells were harvested and washed once in DB (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). The cell pellet was resuspended in DB to 5 × 107/ml and shaken at 120 rpm at 22 oC for 4–6 h. Cells were harvested again and washed with TEB (40 mmTris-HCl, pH 7.5, 50 mm NaCl, 2 mm EDTA). They were finally resuspended in TEBP (TEB plus various protease inhibitor) to 2 × 108/ml. CHAPS powder was added at 20 mg/ml. After gentle mixing, the lysed cells were kept on ice for 3–5 min and then sucrose crystals were added to 55% final concentration. They were loaded under a 20–45% step sucrose density gradient and centrifuged at 150,000 × g for 12 h. The CHIFF band was collected and washed once, then resuspended to 5 × 108 cell equivalent/ml in TBP (TEBP without the EDTA) with 30% sucrose and then stored frozen at −70o. CHIFF was thawed and solubilized in 1–2% Lubrol PX for 2–4 h with mixing at 4 oC at a cell equivalent density of 3–4 × 108/ml. After centrifugation at 100,000 ×g for 30 min, the supernatant was recovered. NaCl and immidazole were added at final concentrations of 200 and 2 mm, respectively. About 40 ml of this supernatant was first batch incubated with 0.6 ml (sedimented volume) of metal-chelating Sepharose resin (Pharmacia) precharged with 50 mmNi2+ according to the manufacturer's suggestion. After 2–4 h incubation, the resin was spun down and loaded into a 5-ml Bio-Rad econocolumn. The supernatant was further absorbed over the column by gravity flow (for about 1 h). After washing the column with more than 20 ml of wash buffer (40 mm Tris-HCl, pH 7.5, 200 mm NaCl, 2 mm imidazole, and 0.1% Lubrol-PX), the column was further washed with buffer containing 15 mm nonylglucoside (40 mm Tris, 200 mm NaCl, 2 mm imidazole, and 15 mmnonylglucoside) to exchange the original Lubrol. This was found to be necessary since our result showed that nonylglucoside preserved receptor binding activity more consistently than Lubrol-PX. cAR1 was eluted in four steps of increasing concentrations of imidazole: 25, 50, 100, and 250 mm. Each step consisted of 4 column volumes of elution solution. The procedure was essentially as described (5Caterina M.J. Devreotes P.N. Borleis J. Hereld D. J. Biol. Chem. 1995; 270: 8667-8672Crossref PubMed Scopus (38) Google Scholar). cAR1-H6 cells suspended in DB were shaken at 200 rpm for 20 min with either 4 mm caffeine or 10 mmdithiothreitol plus 10−5m cAMP to convert cAR1 into either the basal (unphosphorylated) or desensitized (phosphorylated) forms, respectively. The efficiency of this treatment was monitored by analyzing the treated sample on SDS-PAGE and visualizing positions of the cAR1 band on the gel by immunoblotting. Basal state corresponded to a faster migrating form; the phosphorylated state corresponded to a slower migrating form. The cells were then lysed and processed for cAR1 purification through CHIFF as detailed above. The major cAR1 fractions of Ni2+ column elutions were pooled and further characterized for cAMP binding through equilibrium dialysis (13Burgess W.H. Jemiolo D.K. Kretsinger R.H. Biochim. Biophys. Acta. 1980; 623: 257-270Crossref PubMed Scopus (196) Google Scholar). The binding reaction typically contained 200 ng of pure protein, 15 mm nonylglucoside, 40 mm Tris-HCl, 2 mg/ml bovine serum albumin, and 10% sucrose. For background controls, 1,000-fold excess unlabeled cAMP was added to both sides of the chamber, the differential between the two sides was taken as the background. For CHIFF binding, no detergent was present and 5–10 mm dithiothreitol was added to inhibit phosphodiesterase activity. Usually the reaction was stopped after 6–8 h of mild rocking as this time was tested to be sufficient for equilibrium establishment. Ten different [3H]cAMP concentrations in the range of 1–5,000 nm were used to generate the binding curve. Computer modeling program ORIGIN (Microcal Software, Inc., Northampton, MA) was employed to fit the binding data and obtain the number of affinity states and value of dissociation constant (K d). Other binding assays, such as spin column assay and a polyethylene glycol precipitation assay, also confirmed the activity of the receptor preparations. But these methods were not satisfactory for quantitative analysis. The equilibrium dialysis method proved to be the most reproducible method. We confirmed the integrity of cAMP throughout the incubation process by monitoring its chromatographic behavior. Little phosphodiesterase activity was detected in the purified preparations of receptor. CHIFF prepared from desensitized cells were resuspended in 1 × NEB III buffer at a cell equivalent density of 1–2 × 109/ml. 2 units of alkaline phosphatase (New England Biolabs) was added and dephosphorylation carried out at 37 °C for 20–30 min. Gel Shifting assay indicated that this treatment was sufficient to dephosphorylate 80–90% of cAR1. The CHIFF membrane was recovered by centrifugation and resuspended in TEB for cAMP binding assay. Several lines of evidence indicated that the C-terminal hexyl-histidine fusion did not interfere with the functional properties of the receptor. To avoid any potential receptor heterogeneity caused by variable extents of phosphorylation, we initially used a hexyl-histidine-tagged cAR1 in which all serines and threonines in the C-terminal domain were substituted (cm1234-H6). After transformation intocar1 - /car3 − cells, transformed clones that expressed 3-fold higher surface cAMP-binding sites (3 × 105 sites/cell) than optimally developed wild-type cells were isolated. As shown in Fig.1 A, under physiological conditions in phosphate buffer, most of the receptors displayed an average affinity of 200–300 nm (K d = 235 ± 40 nm), and in the presence of ammonium sulfate, 2The binding in phosphate buffer corresponds to binding at physiological conditions. Ammonium sulfate has been shown to convert the receptors into a single high affinity state (K d 3–5 nm), so bindings obtained at 20–30 nm cAMP in ammonium sulfate reflect the total binding of cells. the affinity increased about 50-fold (K d = 3.5 ± 0.3 nm). These values are essentially the same as those previously reported for untagged receptors (11Hereld D. Vaughan R. Kim J.Y. Borleis J. Devreotes P.N. J. Biol. Chem. 1994; 269: 7036-7044Abstract Full Text PDF PubMed Google Scholar). To assess the functional properties of the tagged receptor, we plated the transformants on non-nutrient agar and observed the developmental properties of the cells. 3During nutrient deprivation, the D. discoideum cells start a developmental program whereby central cells secrete cAMP, attracting surrounding cells through chemotaxis. The surrounding cells in turn secrete cAMP to attract more distal cells. Eventually tens of thousands of cells will aggregate to form a mound. The four cAMP receptor proteins, cAR1-cAR4, are the cell surface receptors responsible for sensing the pulses of cAMP and activating downstream events. cAR1 is the major type expressed during the initial stage of aggregation. In its absence, cells fail to aggregate. As shown in Fig. 1 B, cm1234-H6 rescued the development ofcar1 - /car3 − cells as efficiently as the untagged cm1234, indicating that the C-terminal hexyl-histidine does not interfere with the functions of receptor. As expected, the vector transformed car1 - /car3 − cells showed no development. We have previously shown that wild-type cAR1 is quantitatively localized to a specialized plasma membrane fraction designated CHIFF (10Xiao Z. Devreotes P.N. Mol. Biol. Cell. 1997; 8: 855-869Crossref PubMed Scopus (37) Google Scholar). Our strategy was to use CHIFF as an intermediate purification step, providing a 500-fold enrichment, and then to solubilize and purify the hexyl-histidine-tagged receptor by metal affinity column chromatography. We first determined that the tagged receptor was also enriched in CHIFF and its activity remained intact. Our results indicated that cm1234-H6 displayed the same localization in CHIFF as wild-type cAR1 (data not shown), showing that the histidine tag does not interfere with the normal targeting of receptor to the specialized plasma membrane domains. The ligand binding activity of CHIFF membranes was characterized by equilibrium dialysis. Computer analysis indicated that a single affinity form was present, with a K d of 250 ± 65 nm (Fig. 1 C). This value was close to theK d of the predominant receptor population at the cell surface (K d = 235 nm, Fig.1 A) and indicated that the agonist binding sites remain essentially unchanged during the CHIFF preparation process. cm1234-H6 cAR1 was solubilized and purified to near homogeneity by chromatography on a Ni2+-chelating column. We have previously shown that CHIFF proteins can be efficiently extracted by the non-ionic detergent Lubrol-PX (9Devreotes P.N. Neuron. 1994; 12: 235-241Abstract Full Text PDF PubMed Scopus (135) Google Scholar). We resuspended the CHIFF sample to a density of 2–4 × 108 cell equivalents/ml and added 1% Lubrol-PX. It is crucial to carry out solubilization at this density; at higher densities, CHIFF fragments tend to aggregate, preventing efficient solubilization. Under these conditions, more than 90% of the receptor was typically extracted. The solubilized fraction was supplemented with NaCl and imidazole to prevent nonspecific absorption and then chromatographed over the Ni2+ column. After extensive washes, the bound receptor was eluted with four steps of increasing imidazole concentrations: 25, 50, 100, and 250 mm (Fig. 2). cAR1 emerged from the column in two peaks, about 25% eluted at 100 mmand the remainder eluted at 250 mm. This ratio varied slightly between experiments. The purified receptor displayed two major molecular weight forms according to gel migration positions, corresponding to a monomeric (indicated by "M") and a dimeric form (indicated by "D"). The second peak, emerging from the column at 250 mm imidazole, was enriched in the dimer form. Samples taken from the three stages of the purification process were examined by SDS-PAGE followed by silver staining (Fig. 2 C). Comparisons of protein profiles between intact cell, CHIFF, and final purified samples revealed a significant purification. Gel scanning showed that in both peaks eluted from the column the purity of receptor was over 80%. Latter experiments suggested that the purity could be further enhanced by prolonging the 25 mm wash step (data not shown). Next we determined whether the column-purified receptor retained cAMP binding activity. We assayed the cAMP binding activity of each column fraction by equilibrium dialysis. Specific bindings were obtained from these fractions (Fig.3 A, hatched bars). Comparison between this profile and the previous cAR1 protein elution profile (Fig. 3 A, inset) clearly demonstrated a direct correspondence between the levels of binding activity and receptor protein, suggesting that the purified cm1234-H6 is responsible for the observed binding. Having established that the purified receptor is still active, we quantitatively characterized its affinity by equilibrium dialysis. For these studies, we pooled both elution peaks containing cAR1, representing over 90% of the eluted receptors (Fig. 2 A, fractions 9–15). Specific binding data at 10 different cAMP concentrations were obtained. The curve was best fit by a single affinity state with a dissociation constant of 188 ± 39 nm (Fig. 3 B). This value is similar to that of cAR1 on CHIFF membranes and on the surface of cells lacking G-proteins (22Wu L. Valkema R. Van Haastert P.J. Devreotes P.N. J. Cell Biol. 1995; 129: 1667-1675Crossref PubMed Scopus (184) Google Scholar). These data suggest that the purified preparation consists of a homogeneous population of receptors not coupled to G-proteins. The data from a representative purification were tabulated (TableI) to illustrate the recoveries of protein, [3H]cAMP binding activity and changes in specific activity in this experiment. Step 1, which involves purifying CHIFF from cells, yielded approximately 50% of the receptor protein and 60% of cAMP binding activity. Since the CHIFF fraction contains less than 0.2% of the cellular protein, the specific activity of receptors increased nearly 500-fold during this step. Step 2, the purification of receptors from solubilized CHIFF, yielded 40% recoveries of both receptor protein and cAMP binding activity. The cumulative recoveries for the whole procedure were about 18% for the protein and 25% for binding activity. The overall fold of purification was about 7,000. The specific activity of the final purified sample was about 3 × 104 pmol/mg, corresponding to 1.8 × 1016 sites/mg. The theoretical specific activity of pure cAR1 is calculated to be 1.6 × 1016 sites/mg, assuming one binding site per cAR1 molecule. These data suggest that the purified receptors in detergent solution are fully active, although these calculations were based on several measurements which all have margins of error. We routinely purify about 10–20 μg of pure active receptor from 1010 cells, which corresponds to 1 liter of axenic culture. We can conveniently grow and harvest 30 liters of cells, which would correspond to about half a milligram of purified cAR1. The current limitation in the procedure is the requirement of a separate ultracentrifugation run to purify CHIFF from each 5 liters of culture.Table ITwo-step purification of cAR1Total proteincAR1 contentcAMP-bindingActivity recoverySpecific activityPurificationnmol sites-foldIntact cells620 ± 32 (mg)90 μgaThe cAR1 content of intact cells was determined from the total number of surface cAMP-binding sites. We assumes one binding site per receptor (M r 43,000). This assumption was verified by quantitative immunoblot comparing the receptor level in whole cells with known quantities of purified receptors.2.4 ± 0.2100%3.9 ± 0.3 pmol/mgCHIFF780 ± 40 (μg)43 ± 3bThe cAR1 content of CHIFF was determined by SDS-PAGE. The gel was silver-stained and scanned. The receptor abundance in CHIFF is usually in the range of 5–7%. The final purified sample was analyzed similarly. (47%)1.5 ± 0.262%1,923 ± 86493Purified cAR120 ± 2 (μg)16 ± 2 (18%)0.6 ± 0.125%30,000 ± 1,5007,600Protein concentrations were assayed by Bio-Rad microBCA assay (detergent compatible). When measuring the final purified receptor, we used both bovine serum albumin and purified oxaloglutarate transporter protein as standards (both gave similar results). This purification process used 1010 cm1234-H6 cells (1 liter fully grown culture). Total ligand binding of whole cells was obtained by ammonium sulfate binding assay at 20 nM cAMP concentration (4 times theK d level). Overall bindings for both CHIFF and pure cAR1 preparations were evaluated by equilibrium dialysis at 100 nm cAMP concentration, and then calculating the saturation binding values by extrapolation.a The cAR1 content of intact cells was determined from the total number of surface cAMP-binding sites. We assumes one binding site per receptor (M r 43,000). This assumption was verified by quantitative immunoblot comparing the receptor level in whole cells with known quantities of purified receptors.b The cAR1 content of CHIFF was determined by SDS-PAGE. The gel was silver-stained and scanned. The receptor abundance in CHIFF is usually in the range of 5–7%. The final purified sample was analyzed similarly. Open table in a new tab Protein concentrations were assayed by Bio-Rad microBCA assay (detergent compatible). When measuring the final purified receptor, we used both bovine serum albumin and purified oxaloglutarate transporter protein as standards (both gave similar results). This purification process used 1010 cm1234-H6 cells (1 liter fully grown culture). Total ligand binding of whole cells was obtained by ammonium sulfate binding assay at 20 nM cAMP concentration (4 times theK d level). Overall bindings for both CHIFF and pure cAR1 preparations were evaluated by equilibrium dialysis at 100 nm cAMP concentration, and then calculating the saturation binding values by extrapolation. To control for the specificity of the equilibrium dialysis binding assay, we performed several experiments. Purified receptors were divided into three equal sets: the first was not treated, the second was heat-denatured (95 °C for 5 min), and the third was treated with 1% SDS at room temperature for 10 min. The three sets were then assayed in parallel for [3H]cAMP binding. As shown in Fig. 3 C, only the first set displayed binding activity. The other two sets showed only very low activ