Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Absence of Radiation-induced G1 Arrest in Two Closely Related Human Lymphoblast Cell Lines That Differ in p53 Status

1995; Elsevier BV; Volume: 270; Issue: 19 Linguagem: Inglês

10.1074/jbc.270.19.11033

ISSN

1083-351X

Autores

John B. Little, Hatsumi Nagasawa, Peter C. Keng, Yongjia Yu, Chuan‐Yuan Li,

Tópico(s)

Cancer Research and Treatments

Resumo

In order to examine more precisely the role of p53 in the activation of the G1/S checkpoint by ionizing radiation, we examined two human lymphoblast cell lines derived from the same donor. The TK6 line had a doubling time of 12.2 h and expressed wild type p53, while the WTK1 line had a doubling time of 12.7 h and expressed mutant p53. The two lines differ significantly in their susceptibility to radiation-induced cell killing and apoptosis. Cells were examined by flow cytometry at regular intervals from 0 to 12 h after irradiation with two different doses designed to yield equivalent survival levels in both cell lines. In some experiments, cells were incubated with colcemid to block them in the first postirradiation mitosis and prevent contamination of the flow cytometric profiles with second cycle cells. There was no significant difference between the two cell lines in the progression of irradiated cells out of G1 and into the S and G2 phases of the cell cycle. In particular, there was no evidence for a prolonged arrest in G1 in the TK6 cell line expressing wild type p53. Furthermore, expression of the p53 downstream genes WAF1/CIP1 and RB appeared normal in TK6 cells. These results suggest that factors other than those in the p53 signal transduction pathway alone may be required to activate the G1/S checkpoint in irradiated human cells and that apoptosis and G1 arrest may utilize different pathways. In order to examine more precisely the role of p53 in the activation of the G1/S checkpoint by ionizing radiation, we examined two human lymphoblast cell lines derived from the same donor. The TK6 line had a doubling time of 12.2 h and expressed wild type p53, while the WTK1 line had a doubling time of 12.7 h and expressed mutant p53. The two lines differ significantly in their susceptibility to radiation-induced cell killing and apoptosis. Cells were examined by flow cytometry at regular intervals from 0 to 12 h after irradiation with two different doses designed to yield equivalent survival levels in both cell lines. In some experiments, cells were incubated with colcemid to block them in the first postirradiation mitosis and prevent contamination of the flow cytometric profiles with second cycle cells. There was no significant difference between the two cell lines in the progression of irradiated cells out of G1 and into the S and G2 phases of the cell cycle. In particular, there was no evidence for a prolonged arrest in G1 in the TK6 cell line expressing wild type p53. Furthermore, expression of the p53 downstream genes WAF1/CIP1 and RB appeared normal in TK6 cells. These results suggest that factors other than those in the p53 signal transduction pathway alone may be required to activate the G1/S checkpoint in irradiated human cells and that apoptosis and G1 arrest may utilize different pathways. It has long been known that cultured cells respond to ionizing radiation exposure by slowing or arresting their progression through the cell cycle (reviewed in Ref. 1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar). A reversible arrest at the G2/M checkpoint (G2 block) has been a common finding in all cell types (1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar, 2Mak S. Till J.E. Radiat. Res. 1963; 20: 600-618Crossref PubMed Scopus (27) Google Scholar, 3Terasima T. Tolmach L.J. Biophys. J. 1963; 3: 11-22Abstract Full Text PDF PubMed Scopus (322) Google Scholar). Although a prolonged G1 arrest was described in irradiated human diploid fibroblasts (4Little J.B. Nature. 1968; 218: 1064-1065Crossref PubMed Scopus (67) Google Scholar), such an effect was not observed in tumor cells or transformed rodent cell lines. A short (<4 h) transient reduction in the rate of progression of G1 cells into S was observed in some of these latter cell lines but not in others (1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar, 2Mak S. Till J.E. Radiat. Res. 1963; 20: 600-618Crossref PubMed Scopus (27) Google Scholar, 5Leeper D.B. Schneiderman M.H. Dewey W.C. Radial. Res. 1973; 53: 326-337Crossref PubMed Scopus (58) Google Scholar).More recently, Kastan et al. (6Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar) and others (7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar, 8O'Connor P.M. Jackman J. Jondle D. Bhatia K. Magrath I. Kohn K.W. Cancer Res. 1993; 53: 4776-4780PubMed Google Scholar) reported the occurrence of a prolonged G1 arrest in certain human tumor cell lines exposed to moderate doses of radiation. The mechanism for such an arrest has been hypothesized to involve transcriptional activation of WAF1/CIP1 (9El-Deiry W.S. Harper J.W. O'Connor P.M. Velculescu V.E. Canman C.E. Jackman J. Pietenpol J.A. Burrell M. Hill D.E. Wang Y. Wiman K.G. Mercer W.E. Kastan M.B. Kohn K.W. Elledge S.J. Kinzler K.W. Vogelstein B. Cancer Res. 1994; 54: 1169-1174PubMed Google Scholar, 10Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar) by p53, which inhibits cyclin-Cdk complexes such as cyclin D-Cdk2, cyclin D-Cdk4, and cyclin E-Cdk2, which in turn causes the dephosphorylation of the retinoblastoma susceptibility gene (RB). The dephosphorylated Rb protein (pRb) binds transcriptional factor E2F and thus prevents cell cycle progression from G1 into the S phase (10Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar, 11Hartwell L.H. Kastan M.B. Science. 1994; 266: 1821-1828Crossref PubMed Scopus (2303) Google Scholar).This hypothesis has been supported by the finding that the occurrence of a G1 arrest appears to correlate with the p53 status of the cell; only cell lines expressing wild type p53 showed the radiation-induced G1 arrest. In most of these studies (7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar, 8O'Connor P.M. Jackman J. Jondle D. Bhatia K. Magrath I. Kohn K.W. Cancer Res. 1993; 53: 4776-4780PubMed Google Scholar, 12McIlwrath A.M. Vasey P.A. Ross G.M. Brown R. Cancer Res. 1994; 54: 3718-3722PubMed Google Scholar), flow cytometry was employed to analyze the relative distribution of cells in the various stages of the life cycle 17–24 h after irradiation. However, a number of variables may influence the interpretation of such results, including differences in growth properties and generation times of the cells, cell cycle distribution, radiosensitivity, and the presence of a variable G2 arrest.In the present report, we have examined the progression of G1 cells into S in two closely related human lymphoblast cell lines derived from the same donor. These cell lines have very similar cytologic and growth characteristics but differ in p53 status, radiosensitivity, and susceptibility to radiation-induced apoptosis. Flow cytometric analysis was carried out at multiple time points following irradiation, and the cells in some experiments were incubated with colcemid to block them in metaphase and prevent contamination with second cycle cells.EXPERIMENTAL PROCEDURESCells and Cultural Conditions—The TK6 lymphoblast cell line was originally obtained from Dr. William Thilly (13Skopek T.R. Liber H.L. Penman B.W. Thilly W.G. Biochem. Biophys. Res. Commun. 1978; 84: 411-416Crossref PubMed Scopus (180) Google Scholar). The WTK1 cell line was isolated in our laboratory (14Benjamin M.B. Potter H. Yandell D.W. Little J.B. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6652-6656Crossref PubMed Scopus (27) Google Scholar) from the WI-L2-NS line obtained from the American Type Culture Collection (CRL-8155). Both the TK6 and WI-L2-NS cell lines were derived from the same donor (15Levy J.A. Virolainen M. Defendi V. Cancer. 1968; 22: 61-73Crossref Scopus (200) Google Scholar), and the lineage has been described in detail elsewhere (16Amundson S.A. Xia F. Wolfson K. Liber H.L. Mutal. Res. 1993; 286: 233-241Crossref PubMed Scopus (94) Google Scholar). These cells were grown at 37 °C in suspension cultures in a humidified 5% CO2 atmosphere in RPMI 1640 medium supplemented with 10% heat-inactivated horse serum. They were appropriately diluted at daily intervals to maintain them in exponential growth at a density of approximately 4 × 105 cells/ml. For cloning and radiation survival experiments, cells were seeded in 96-well microtiter dishes at densities of 1–100 cells/well, depending upon the radiation dose, and the number of positive wells were scored 10–12 days later. Survival was calculated as described by Furth et al. (17Furth E.E. Thilly W.G. Penman B.W. Liber H.L. Rand W.M. Anal. Biochem. 1981; 110: 1-8Crossref PubMed Scopus (246) Google Scholar). For measurements of cell growth, cells were seeded at low density in 25-cm2 flasks. An aliquot of cells was removed at 3–6-h intervals and counted with a Coulter counter. Cells were irradiated with either 0, 1.5, or 3.0 gray (Gy) 1The abbreviations used are: GygrayPCRpolymerase chain reactionSSCPsingle strand conformation polymorphismMOPS4-morpholinepropanesulfonic acid. with γ rays from a cobalt-60 source yielding a dose rate of 0.16 Gy/s.Northern and Western Analysis—For Western analysis, protein was extracted 2 h after irradiation of cells log-phase growth by lysis of the cells in a buffer consisting of 50 mm Tris-HCl at pH 7.4, 250 mm NaCl, 0.5% Nonidet P-40, 50 mm NaF, 1 mm Na3VO4, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, 25 μg/ml aprotinin, 1 mm benzamide, and 10 μg/ml trypsin inhibitor (all from Sigma). The lysed cells were centrifuged at 16,000 × g for 5 min, and the supernatants were kept and analyzed. Equal amounts of protein (60 μg) were loaded into each lane in a 8% Polyacrylamide gel, electrophoresed, and blotted onto a polyvinylidene difluoride (Millipore) membrane. A monoclonal antibody to p53 (Ab6 from Oncogene) and a monoclonal antibody against pRb (G3–245 from Pharmingen) were used as the primary antibodies. The signal was then developed with the ECL system from Amersham.For Northern analysis, cells in log-phase growth were irradiated, and RNA extraction was performed 4 h later by first suspending the cells in a solution with 10 UBI Tris, 10 mm vanadyl-ribonucleoside complex, and 1% Nonidet P-40 detergent and then lysing them in 10 mm Tris, 150 mm NaCl, 1% SDS, followed by two extractions of phenol chloroform and one extraction of chloroform. RNA was then separated by agarose gel electrophoresis in MOPS buffer and transferred to nitrocellulose membranes; 20 μg of RNA was loaded into each lane. Northern analysis of WAF1 was performed by use of a WAF1 probe derived by PCR fragment amplification of cDNA from a human fibroblast cell line using primers A (5′ AGTTCCTTGTGGAGCCGGAGC 3′) and β (5′ TGTAGAGCGGGCCTTTGAGGC 3′).SSCP and Direct Sequencing—p53 status in these cell lines was determined by first screening 32P-labeled PCR products of exons 5–9 of the p53 gene by use of the SSCP technique and then sequencing the PCR products with abnormal bandshifts with the direct sequencing kit from U. S. Biochemical Corp. The primers and PCR conditions were those described previously (18Toguchida J. Yamaguchi T. Richie B. Beauchamp R. Dayton S.H. Herrera G.E. Yamamoto T. Kotoura P. Sasaki M. Little J.B. Weichselbaum R.R. Ishizaki K. Yandell D.W. Cancer Res. 1992; 52: 6194-6199PubMed Google Scholar).Cell Cycle Analysis—The cell cycle distributions of control and irradiated cells were analyzed by flow cytometry and propidium iodide staining. After treatment, 1.5 × 106 cells were washed twice with phosphate-buffered saline and fixed in 75% ethanol. Fixed cells were spun down to remove ethanol, treated with RNase (1 mg/ml, 15 min at room temperature), and then stained with propidium iodide (10 µg/ml, 15 min at room temperature) before analysis for DNA content. A Coulter Profile II flow cytometer equipped with a 25-milliwatt argon ion laser operating at 488-nm wavelength and 15 milliwatts of power was used for DNA histogram measurement. DNA fluorescence was monitored through a 488-nm interference barrier filter and a 610-nm-long pass filter. At least 2 × 106 cells were collected for each measurement. The percentage of G1, S, and G2/M cells was calculated from the DNA histograms using the mathematical model of Fried (19Fried J. Comput. Biomed. Res. 1976; 9: 263-276Crossref PubMed Scopus (155) Google Scholar).RESULTSDetermination of Status of Genes in the p53 Signal Transduction Pathway—Western analysis of p53 protein expression in control and irradiated TK6 and WTK1 cells is shown in Fig. 1A. As can be seen, p53 protein levels were enhanced after irradiation of the TK6 cell line. Although a high level of constitutive p53 expression was seen in the WTK1 cell line, expression was not enhanced by irradiation, suggestive of abnormal p53 protein function. These results were confirmed by analyzing expression of WAF1/CIPl mRNA, which is radiation-inducible only in cells with wild type p53 (9El-Deiry W.S. Harper J.W. O'Connor P.M. Velculescu V.E. Canman C.E. Jackman J. Pietenpol J.A. Burrell M. Hill D.E. Wang Y. Wiman K.G. Mercer W.E. Kastan M.B. Kohn K.W. Elledge S.J. Kinzler K.W. Vogelstein B. Cancer Res. 1994; 54: 1169-1174PubMed Google Scholar, 10Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar). As can be seen in Fig. 1B, WAF1/CIP1 expression was strongly induced by radiation in the TK6 cell line, whereas no expression was evident in non-irradiated TK6 cells or in WTK1.In order to confirm that WTK1 was producing non-functional p53 protein, SSCP analysis was carried out on exons 5–9 followed by direct sequencing. No abnormalities were found in SSCP blots of TK6, whereas a change in banding was observed for exon 7 of WTK1. Direct sequencing of exon 7 for both cell lines revealed a single base pair substitution in codon 237 of WTK1 (Fig. 2), which results in a methionine → isoleucine substitution in the p53 protein. The occurrence of this same mutation has been reported recently in WI-L2-NS, the parent cell line of WTK1 (20Carrier F. Smith M.L. Bae I. Kilpatrick K.E. Lansing T.J. Chen C.-Y. Engelstein M. Friend S.H. Henner W.D. Gilmer T.M. Kastan M.B. Fornace Jr., A.J. J. Biol. Chem. 1994; 51: 32672-32677Abstract Full Text PDF Google Scholar).FIG. 2Sequence analysis of a portion of p53 exon 7 in TK6 and WTK1 cells. TK6 shows the wild type sequence whereas a single C to T (antisense) base pair substitution has occurred in codon 237 of WTK1 that results in a methionine → isoleucine amino acid substitution.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Western analysis of pRb expression indicated that both cell lines express normal pRb. However, normal radiation-induced dephosphorylation of pRb occurred in the TK6 but not in the WTK1 cell line (Fig. 1C), consistent with the p53 status of these two cell lines. PCR-based direct sequencing revealed no mutations in the RB gene of TK6 cells. 2Q. Huang, personal communication.Survival Curve and Growth Rate Determinations—Radiation survival curves for the two cell lines are shown in Fig. 3. The D0 (inverse of the slope) was 0.57 Gy and the D10 (dose necessary to reduce survival to 10%) 1.65 Gy for the TK6 cell line. These parameters were 1.07 and 2.81, respectively, for the WTK1 cell line. Growth curves were determined by measuring cell density at 3–6-h intervals over a total of 96 h. Cell densities increased by a factor of about 200 during this interval. The doubling times as measured by linear regression were 12.2 h for the TK6 cells and 12.7 h for the WTK1 line.FIG. 3Radiation survival curves for TK6 (●) and WTK1 (■).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Analysis of G1 Arrest by Flow Cytometry—Flow cytometric profiles for control and irradiated TK6 and WTK1 cells are shown in Fig. 4. Radiation doses of 1.5 and 3.0 Gy were chosen as they permit analysis of the results at equivalent survival levels as well as at two radiation doses. The cell cycle distributions were measured at 3-h intervals during the 12-h period following irradiation, a period equal to approximately one generation time in these cells. As can be seen in Fig. 4, there was a decline in the fraction of cells in the S phase during the period of 3–12 h after irradiation, associated with a gradual accumulation of cells in G2/M. Although the profiles differ somewhat at the 6- and 9-h time intervals, there is no significant difference in cell cycle distribution between the two cell lines at 12 h postirradiation.FIG. 4Flow cytometric profiles for TK6 (A) and WTK1 (B) cells irradiated with 0, 1.5, or 3.0 Gy and examined 0, 3, 6, 9, or 12 h thereafter.View Large Image Figure ViewerDownload Hi-res image Download (PPT)In order to determine more precisely the kinetics of progression of cells from G1 into the first S phase without contaminating second cycle cells, the cultures were incubated with colcemid plus tritiated thymidine 1 h prior to irradiation. This treatment will block cells in mitosis but not affect traversal through interphase. The results of these experiments are shown in Fig. 5. As can be seen for both cell lines, the irradiated cells progressed out of G1 through S and accumulated in G2/M over the 12-h period of observation. Comparing the profiles at equivalent survival levels (1.5 Gy for TK6 and 3 Gy for WTK1), no marked difference in the kinetics of progression through the cell cycle is evident. Although there may be a small lagging population of G1 cells at 6 and 9 h in TK6 cells, perhaps reflecting a short transient G1/S delay, there is no evidence for a prolonged G1 arrest as originally described by Kastan and his co-workers (6Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar, 7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar). The G1 populations seen at 6–12 h in Fig. 4 must thus represent second cycle cells.FIG. 5Flow cytometric profiles for TK6 (A) and WTK1 (B) cells incubated with colcemid and [3H]thymidine 1 h before irradiation with 0, 1.5, or 3.0 Gy and examined 0, 3, 6, 9, or 12 h thereafter.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The flow cytometric profiles for TK6 and WTK1 cells analyzed 24 h after irradiation are shown in Fig. 6, where they are compared with the profiles for non-irradiated cells. Considerable DNA degradation not apparent at 12 h appears to have occurred in the TK6 cell line (Fig. 6A); such a pattern was not evident in WTK1 cells (Fig. 6B). This pattern of DNA degradation 24 h postirradiation as visualized by flow cytometry is almost identical to that reported by Zhen and Vaughn (21Zhen W. Vaughan A.T.M. Radiat. Res. 1995; 141: 170-175Crossref PubMed Scopus (30) Google Scholar) for TK6 cells where it was shown to represent cells undergoing apoptotic death.FIG. 6Flow cytometric profile for TK6 cells (panel A) and WTK1 cells (panel B) irradiated with 3.0 Gy and examined 24 h later (hatched profiles and dotted lines). Superimposed dark profiles are for control cells studied at the same time. The distribution of DNA content below the normal G1 peak in irradiated TK6 cells (panel A) is interpreted to represent DNA degradation consequent to apoptotic cell death (see text).View Large Image Figure ViewerDownload Hi-res image Download (PPT)DISCUSSIONTK6 cells show the phenotypic characteristics one would expect of p53+ lymphoid cells. They are sensitive to radiation-induced apoptosis (21Zhen W. Vaughan A.T.M. Radiat. Res. 1995; 141: 170-175Crossref PubMed Scopus (30) Google Scholar, 22Xia F. Wang X. Wang Y.-H. Tsang N.-M. Yandell D.W. Kelsey K.T. Liber H.L. Cancer Res. 1995; 55: 12-15PubMed Google Scholar), are relatively sensitive to radiation-induced reproductive failure (Fig. 3), and show enhanced expression of p53 protein and WAF1/CIP1 mRNA and dephosphorylation of pRb after exposure to ionizing radiation. WTK1, on the other hand, is relatively radioresistant, shows an elevated frequency of spontaneous and radiation-induced mutations (16Amundson S.A. Xia F. Wolfson K. Liber H.L. Mutal. Res. 1993; 286: 233-241Crossref PubMed Scopus (94) Google Scholar), and expresses mutant p53 protein. Other than p53 status, however, these two cell lines are very similar. They were derived from the same donor, have identical growth and morphologic characteristics, and have very similar doubling times. These similarities obviate some of the confounding variables encountered in comparing radiation effects on cell cycle progression in lines of differing origins and growth characteristics.There have been several reports indicating that exposure to ionizing radiation will induce a prolonged G1 arrest in a variety of human transformed and tumor cell types and that the occurrence of the G1 arrest correlates with the p53 status of the cell (6Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar, 7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar, 8O'Connor P.M. Jackman J. Jondle D. Bhatia K. Magrath I. Kohn K.W. Cancer Res. 1993; 53: 4776-4780PubMed Google Scholar). In one study, G1 arrest was correlated with the radiosensitivity of the human tumor cell lines (12McIlwrath A.M. Vasey P.A. Ross G.M. Brown R. Cancer Res. 1994; 54: 3718-3722PubMed Google Scholar). The occurrence of G1 arrest has generally been determined by flow cytometric analysis at relatively late times after irradiation (17–24 h). In the present investigation, we examined the progression of cells through the cell cycle at regular intervals during the first 12 h after irradiation, a time interval approximating the generation time of these cells. As can be seen in Fig. 4, there was no appreciable difference in the flow cytometry profiles during this interval between the TK6 (p53+) and WTK1 (p53-) cell lines. At the later times, however, interpretation of such profiles can be confounded by the accumulation of second cycle cells. To avoid this problem, we incubated cells with colcemid to block them in the first postirradiation mitosis; as can be seen in Fig. 5, the cells moved progressively out of G1 and through S accumulating in G2 in both cell lines. The population of G1 cells seen in both cell lines at later times in Fig. 4 might be interpreted as representing cells arrested in G1, as described by other investigators (e.g. Refs. 7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar, 23Strasser A. Harris A.W. Jacks T. Cory S. Cell. 1994; 79: 329-339Abstract Full Text PDF PubMed Scopus (674) Google Scholar). Based on the results in Fig. 5, however, these G1 cells (at least in the present experiments) appear to be in the second postirradiation cell cycle.The control of cell cycle progression and the response to DNA damage require the coordination of a variety of complex processes involving, in particular, cyclin-dependent kinases (11Hartwell L.H. Kastan M.B. Science. 1994; 266: 1821-1828Crossref PubMed Scopus (2303) Google Scholar). Although p53 is thought to be intimately involved in control of the G1/S checkpoint, the present results suggest that p53 function alone as well as expression of the downstream genes RB and WAF1/CIP1 in the p53 signal transduction pathway may not be sufficient for activation of the G1/S checkpoint after exposure to ionizing radiation. It should be noted, however, that the radiation doses we employed yielded approximately 3–20% survival of TK6 cells. Some studies have employed much higher, cytotoxic doses. In a recent report, for example, evidence suggesting a significant G1 arrest was evident on flow cytometric profiles 16 h after irradiation of ML-1 cells with 6.3 Gy (20Carrier F. Smith M.L. Bae I. Kilpatrick K.E. Lansing T.J. Chen C.-Y. Engelstein M. Friend S.H. Henner W.D. Gilmer T.M. Kastan M.B. Fornace Jr., A.J. J. Biol. Chem. 1994; 51: 32672-32677Abstract Full Text PDF Google Scholar). This high radiation dose probably yielded a survival level of 0.1% or less in this myeloid leukemia cell line; many of the cells appearing in the G1 peak 16 h after irradiation may thus represent dead or dying cells unable to initiate DNA synthesis.Finally, evidence for DNA degradation presumably as a result of cells undergoing apoptotic death was not seen until 24 h after irradiation of the TK6 cell line. This observation is consistent with previous reports that apoptosis in TK6 cells reaches a peak level at 24 h postirradiation, whereas there was little evidence for apoptosis at 12 h (21Zhen W. Vaughan A.T.M. Radiat. Res. 1995; 141: 170-175Crossref PubMed Scopus (30) Google Scholar, 22Xia F. Wang X. Wang Y.-H. Tsang N.-M. Yandell D.W. Kelsey K.T. Liber H.L. Cancer Res. 1995; 55: 12-15PubMed Google Scholar). The difference in the kinetics of radiation-induced apoptosis in TK6 as opposed to WTK1 cells is also reflected in the radiation sensitivity of the two cell lines as shown in Fig. 3. Based on these results, we hypothesize that different metabolic pathways may be involved in the induction of apoptosis and G1 arrest by radiation. It has long been known that cultured cells respond to ionizing radiation exposure by slowing or arresting their progression through the cell cycle (reviewed in Ref. 1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar). A reversible arrest at the G2/M checkpoint (G2 block) has been a common finding in all cell types (1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar, 2Mak S. Till J.E. Radiat. Res. 1963; 20: 600-618Crossref PubMed Scopus (27) Google Scholar, 3Terasima T. Tolmach L.J. Biophys. J. 1963; 3: 11-22Abstract Full Text PDF PubMed Scopus (322) Google Scholar). Although a prolonged G1 arrest was described in irradiated human diploid fibroblasts (4Little J.B. Nature. 1968; 218: 1064-1065Crossref PubMed Scopus (67) Google Scholar), such an effect was not observed in tumor cells or transformed rodent cell lines. A short (<4 h) transient reduction in the rate of progression of G1 cells into S was observed in some of these latter cell lines but not in others (1Okada S. Radiation Biochemistry.Vol. I. Academic Press, New York1970: 190-246Google Scholar, 2Mak S. Till J.E. Radiat. Res. 1963; 20: 600-618Crossref PubMed Scopus (27) Google Scholar, 5Leeper D.B. Schneiderman M.H. Dewey W.C. Radial. Res. 1973; 53: 326-337Crossref PubMed Scopus (58) Google Scholar). More recently, Kastan et al. (6Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar) and others (7Kuerbitz S.J. Plunkett B.S. Walsh W.V. Kastan M.B. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7491-7495Crossref PubMed Scopus (1839) Google Scholar, 8O'Connor P.M. Jackman J. Jondle D. Bhatia K. Magrath I. Kohn K.W. Cancer Res. 1993; 53: 4776-4780PubMed Google Scholar) reported the occurrence of a prolonged G1 arrest in certain human tumor cell lines exposed to moderate doses of radiation. The mechanism for such an arrest has been hypothesized to involve transcriptional activation of WAF1/CIP1 (9El-Deiry W.S. Harper J.W. O'Connor P.M. Velculescu V.E. Canman C.E. Jackman J. Pietenpol J.A. Burrell M. Hill D.E. Wang Y. Wiman K.G. Mercer W.E. Kastan M.B. Kohn K.W. Elledge S.J. Kinzler K.W. Vogelstein B. Cancer Res. 1994; 54: 1169-1174PubMed Google Scholar, 10Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar) by p53, which inhibits cyclin-Cdk complexes such as cyclin D-Cdk2, cyclin D-Cdk4, and cyclin E-Cdk2, which in turn causes the dephosphorylation of the retinoblastoma susceptibility gene (RB). The dephosphorylated Rb protein (pRb) binds transcriptional factor E2F and thus prevents cell cycle progression from G1 into the S phase (10Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar, 11Hartwell L.H. Kastan M.B. Science. 1994; 266: 1821-1828Crossref PubMed Scopus (2303) Google Scholar). This hypothesis has been supported by the finding that the occurrence of a G1 arrest appears to correlate with the p53 status of the cell; only cell lines expressing wild type p53 showed the ra

Referência(s)