Phospholipid Biosynthesis Program Underlying Membrane Expansion during B-lymphocyte Differentiation
2007; Elsevier BV; Volume: 282; Issue: 10 Linguagem: Inglês
10.1074/jbc.m608175200
ISSN1083-351X
AutoresPaolo Fagone, Rungtawan Sriburi, Cheryl Ward-Chapman, Matthew W. Frank, Jina Wang, Christopher Gunter, Joseph W. Brewer, Suzanne Jackowski,
Tópico(s)Endoplasmic Reticulum Stress and Disease
ResumoStimulated B-lymphocytes differentiate into plasma cells committed to antibody production. Expansion of the endoplasmic reticulum and Golgi compartments is a prerequisite for high rate synthesis, assembly, and secretion of immunoglobulins. The bacterial cell wall component lipopolysaccharide (LPS) stimulates murine B-cells to proliferate and differentiate into antibody-secreting cells that morphologically resemble plasma cells. LPS activation of CH12 B-cells augmented phospholipid production and initiated a genetic program, including elevated expression of the genes for the synthesis, elongation, and desaturation of fatty acids that supply the phospholipid acyl moieties. Likewise, many of the genes in phospholipid biosynthesis were up-regulated, most notably those encoding Lipin1 and choline phosphotransferase. In contrast, CTP:phosphocholine cytidylyltransferase α (CCTα) protein, a key control point in phosphatidylcholine biosynthesis, increased because of stabilization of protein turnover rather than transcriptional activation. Furthermore, an elevation in cellular diacylglycerol and fatty acid correlated with enhanced allosteric activation of CCTα by the membrane lipids. This work defines a genetic and biochemical program for membrane phospholipid biogenesis that correlates with an increase in the phospholipid components of the endoplasmic reticulum and Golgi compartments in LPS-stimulated B-cells. Stimulated B-lymphocytes differentiate into plasma cells committed to antibody production. Expansion of the endoplasmic reticulum and Golgi compartments is a prerequisite for high rate synthesis, assembly, and secretion of immunoglobulins. The bacterial cell wall component lipopolysaccharide (LPS) stimulates murine B-cells to proliferate and differentiate into antibody-secreting cells that morphologically resemble plasma cells. LPS activation of CH12 B-cells augmented phospholipid production and initiated a genetic program, including elevated expression of the genes for the synthesis, elongation, and desaturation of fatty acids that supply the phospholipid acyl moieties. Likewise, many of the genes in phospholipid biosynthesis were up-regulated, most notably those encoding Lipin1 and choline phosphotransferase. In contrast, CTP:phosphocholine cytidylyltransferase α (CCTα) protein, a key control point in phosphatidylcholine biosynthesis, increased because of stabilization of protein turnover rather than transcriptional activation. Furthermore, an elevation in cellular diacylglycerol and fatty acid correlated with enhanced allosteric activation of CCTα by the membrane lipids. This work defines a genetic and biochemical program for membrane phospholipid biogenesis that correlates with an increase in the phospholipid components of the endoplasmic reticulum and Golgi compartments in LPS-stimulated B-cells. The differentiation of a B-lymphocyte into a plasma cell is characterized by a number of events, including expansion of the intracellular membrane network, particularly the rough endoplasmic reticulum (ER), 3The abbreviations used are: ER, endoplasmic reticulum; PtdCho, phosphatidylcholine; PtdEtn, phosphatidylethanolamine; PtdOH, phosphatidic acid; FA, fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid; DAG, diacylglycerol; CK, choline kinase; CCT, choline cytidylyl-transferase; CPT, choline phosphotransferase; P-choline, phosphocholine; CDP-choline, cytidine diphosphocholine; LPS, lipopolysaccharide; LUV, large unilamellar vesicle; DAPI, 4′,6-diamidino-2-phenylidone; CHX, cycloheximide; BiP, Ig-binding protein; GRP94, glucose-regulated protein 94; XBP-1(S), spliced form of X-box-binding protein1; MS, mass spectrometry; DTT, dithiothreitol; PBS, phosphate-buffered saline; qRT-PCR, quantitative reverse transcription-PCR; IL, interleukin; M, microsomes; C, cytosol; M:C, microsomes to cytosol ratio. where immunoglobulins are synthesized and assembled into functional antibodies. During amplification of the ER, a few resident proteins are expressed preferentially, although the majority increase proportionally to the increased membrane surface area, maintaining the overall membrane protein composition (1Wiest D.L. Burkhardt J.K. Hester S. Hortsch M. Meyer D.I. Argon Y. J. Cell Biol. 1990; 110: 1501-1511Crossref PubMed Scopus (187) Google Scholar). Expression of select targets of the unfolded protein response pathway, a complex interorganelle signaling system that emanates from the ER (2Wu J. Kaufman R.J. Cell Death. Differ. 2006; 13: 374-384Crossref PubMed Scopus (732) Google Scholar), is triggered during plasma cell differentiation (3Brewer J.W. Hendershot L.M. Nat. Immun. 2005; 6: 23-29Crossref Scopus (92) Google Scholar). These targets include ER chaperones like BiP and GRP94 and the transcription factor XBP-1 (1Wiest D.L. Burkhardt J.K. Hester S. Hortsch M. Meyer D.I. Argon Y. J. Cell Biol. 1990; 110: 1501-1511Crossref PubMed Scopus (187) Google Scholar, 4Gass J.N. Gifford N.M. Brewer J.W. J. Biol. Chem. 2002; 277: 49047-49054Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar, 5Reimold A.M. Iwakoshi N.N. Manis J. Vallabhajosyula P. Szomolanyi-Tsuda E. Gravallese E.M. Friend D. Grusby M.J. Alt F. Glimcher L.H. Nature. 2001; 412: 300-307Crossref PubMed Scopus (1050) Google Scholar, 6Iwakoshi N.N. Lee A.H. Vallabhajosyula P. Otipoby K.L. Rajewsky K. Glimcher L.H. Nat. Immun. 2003; 4: 321-329Crossref Scopus (708) Google Scholar). XBP-1 is essential for the development of plasma cells (5Reimold A.M. Iwakoshi N.N. Manis J. Vallabhajosyula P. Szomolanyi-Tsuda E. Gravallese E.M. Friend D. Grusby M.J. Alt F. Glimcher L.H. Nature. 2001; 412: 300-307Crossref PubMed Scopus (1050) Google Scholar), pancreatic acinar cells, and salivary gland cells (7Lee A.H. Chu G.C. Iwakoshi N.N. Glimcher L.H. EMBO J. 2005; 24: 4368-4380Crossref PubMed Scopus (356) Google Scholar), all of which are specialized for secretion and contain an elaborate ER network. The unfolded protein response mediates a novel splicing of XBP-1 mRNA to yield XBP-1(S), a basic leucine zipper protein with a transactivation domain. Indeed, heterologous enforced expression of XBP-1(S) in fibroblasts is sufficient to stimulate synthesis of phosphatidylcholine (PtdCho), the primary phospholipid of the ER membrane, leading to increased intracellular membrane surface area and volume of ER and increased cell size (8Sriburi R. Jackowski S. Mori K. Brewer J.W. J. Cell Biol. 2004; 167: 35-41Crossref PubMed Scopus (523) Google Scholar, 9Shaffer A.L. Shapiro-Shelef M. Iwakoshi N.N. Lee A.H. Qian S.B. Zhao H. Yu X. Yang L. Tan B.K. Rosenwald A. Immunity. 2004; 21: 81-93Abstract Full Text Full Text PDF PubMed Scopus (772) Google Scholar). The targets of transcriptional activation that drive membrane phospholipid synthesis during plasma cell maturation remain elusive, however, as expression of the genes of the PtdCho biosynthetic pathway are not significantly stimulated during XBP-1(S) induction (8Sriburi R. Jackowski S. Mori K. Brewer J.W. J. Cell Biol. 2004; 167: 35-41Crossref PubMed Scopus (523) Google Scholar, 9Shaffer A.L. Shapiro-Shelef M. Iwakoshi N.N. Lee A.H. Qian S.B. Zhao H. Yu X. Yang L. Tan B.K. Rosenwald A. Immunity. 2004; 21: 81-93Abstract Full Text Full Text PDF PubMed Scopus (772) Google Scholar). The major route for PtdCho production is the CDP-choline pathway (11Jackowski S. Fagone P. J. Biol. Chem. 2005; 280: 853-856Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar), and the supply of CDP-choline is governed by the activity of CCT. Three CCT isoforms are expressed differentially in tissues, but CCTα is the dominant isoform that is expressed ubiquitously (12Karim M.A. Jackson P. Jackowski S. Biochim. Biophys. Acta. 2003; 1633: 1-12Crossref PubMed Scopus (78) Google Scholar, 13Jackowski S. Rehg J.E. Zhang Y.-M. Wang J. Miller K. Jackson P. Karim M.A. Mol. Cell. Biol. 2004; 24: 4720-4733Crossref PubMed Scopus (45) Google Scholar). Several mechanisms that regulate PtdCho synthesis have been uncovered, and most of these center on CCT. The rate of membrane PtdCho synthesis increases via stabilization of the transcript encoding CCTα when macrophages proliferate in response to colony-stimulating factor-1 (14Hirabayashi Y. Kanamori A. Nomura K.H. Nomura K. Pfluegers Arch. 2004; 447: 760-762Crossref PubMed Scopus (17) Google Scholar). Similarly, enhanced expression of CCT accompanies the stimulation of PtdCho synthesis during neuronal differentiation (13Jackowski S. Rehg J.E. Zhang Y.-M. Wang J. Miller K. Jackson P. Karim M.A. Mol. Cell. Biol. 2004; 24: 4720-4733Crossref PubMed Scopus (45) Google Scholar, 15Carter J.M. Waite K.A. Campenot R.B. Vance J.E. Vance D.E. J. Biol. Chem. 2003; 278: 44988-44994Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). Stimulation of PtdCho synthesis is associated with cell cycle progression in other cell types (16Banchio C. Schang L.M. Vance D.E. J. Biol. Chem. 2003; 278: 32457-32464Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 17Golfman L.S. Bakovic M. Vance D.E. J. Biol. Chem. 2001; 276: 43688-43692Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar), and in IIC9 cells it is accompanied by relocation of the CCTα protein from the nucleus to the cytoplasm (18Northwood I.C. Tong A.H. Crawford B. Drobnies A.E. Cornell R.B. J. Biol. Chem. 1999; 274: 26240-26248Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Reduction of PtdCho synthesis in stimulated pancreatic acini (19Groblewski G.E. Wang Y. Ernst S.A. Kent C. Williams J.A. J. Biol. Chem. 1995; 270: 1437-1442Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar), in lung epithelial cells responding to tumor necrosis factor-α (20Mallampalli R.K. Ryan A.J. Salome R.G. Jackowski S. J. Biol. Chem. 2000; 275: 9699-9708Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 21Zhou J. Ryan A.J. Medh J. Mallampalli R.K. J. Biol. Chem. 2003; 278: 37032-37040Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar), or in cells undergoing farnesol-induced apoptosis (22Lagace T.A. Miller J.R. Ridgway N.D. Mol. Cell. Biol. 2002; 22: 4851-4862Crossref PubMed Scopus (50) Google Scholar) is associated with CCTα reduced activity because of protein degradation. Oxysterols stimulate CCTα phosphorylation, thereby decreasing PtdCho synthesis (23Agassandian M. Zhou J. Tephly L.A. Ryan A.J. Carter A.B. Mallampalli R.K. J. Biol. Chem. 2005; 280: 21577-21587Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). In addition to mechanisms that regulate CCT protein expression or modification, the biochemical activity of the enzyme is controlled by the membrane lipid composition as CCT responds to both activators and inhibitors embedded in the PtdCho matrix (24Attard G.S. Templer R.H. Smith W.S. Hunt A.N. Jackowski S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9032-9036Crossref PubMed Scopus (229) Google Scholar, 25Cornell R.B. Northwood I.C. Trends Biochem. Sci. 2000; 25: 441-447Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). The degree of interaction between membrane lipids and the CCT protein determines the rate of PtdCho synthesis (26Kent C. Biochim. Biophys. Acta. 1997; 1348: 79-90Crossref PubMed Scopus (192) Google Scholar) and provides a mechanism for adaptation to changes in the membrane environment. Finally, in the last step of PtdCho synthesis, the CPT uses both CDP-choline and DAG as substrates. Thus, in addition to the supply of CDP-choline, the supply of DAG can be a limiting factor in membrane PtdCho biosynthesis (27Jamil H. Utal A.K. Vance D.E. J. Biol. Chem. 1992; 267: 1752-1760Abstract Full Text PDF PubMed Google Scholar, 28Jackowski S. Wang J. Baburina I. Biochim. Biophys. Acta. 2000; 1483: 301-315Crossref PubMed Scopus (92) Google Scholar, 29Wright M.M. Henneberry A.L. Lagace T.A. Ridgway N.D. McMaster C.R. J. Biol. Chem. 2001; 276: 25254-25261Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 30Bagnato C. Igal R.A. J. Biol. Chem. 2003; 278: 52203-52211Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The CH12 cell line, a member of the CH series of murine B-lymphoma cell lines (31Haughton G. Arnold L.W. Bishop G.A. Mercolino T.J. Immunol. Rev. 1986; 93: 35-51Crossref PubMed Scopus (135) Google Scholar), was employed as a model system to look into the changes in lipid metabolism responsible for the acceleration of membrane phospholipid synthesis to support the differentiation of activated B-cells into antibody-secreting plasma cells. Similar to splenic B-cells, CH12 cells bear surface IgM and class II molecules of the major histocompatibility complex, and less than 3% secrete IgM under normal culture conditions (32Arnold L.W. LoCascio N.J. Lutz P.M. Pennell C.A. Klapper D. Haughton G. J. Immunol. 1983; 131: 2064-2068PubMed Google Scholar, 33Ovnic M. Corley R.B. J. Immunol. 1987; 138: 3075-3082PubMed Google Scholar). Differentiation and Ig secretion are induced either by lipopolysaccharide (LPS) exposure or by T-cells (33Ovnic M. Corley R.B. J. Immunol. 1987; 138: 3075-3082PubMed Google Scholar, 34LoCascio N.J. Haughton G. Arnold L.W. Corley R.B. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2466-2469Crossref PubMed Scopus (27) Google Scholar, 35LoCascio N.J. Arnold L.W. Corley R.B. Haughton G. J. Mol. Cell. Immunol. 1984; 1: 177-190PubMed Google Scholar, 36Stockdale A.M. Dul J.L. Wiest D.L. Digel M. Argon Y. J. Immunol. 1987; 139: 3527-3535PubMed Google Scholar), and the morphological differentiation is similar to LPS-stimulated splenic B-cells (1Wiest D.L. Burkhardt J.K. Hester S. Hortsch M. Meyer D.I. Argon Y. J. Cell Biol. 1990; 110: 1501-1511Crossref PubMed Scopus (187) Google Scholar). Analysis of the ultrastructural changes of CH12 cells during differentiation showed a 3-6-fold increase in the surface area of ER and Golgi and a similar increase in ER resident proteins as shown by EM and immunoblotting, respectively (1Wiest D.L. Burkhardt J.K. Hester S. Hortsch M. Meyer D.I. Argon Y. J. Cell Biol. 1990; 110: 1501-1511Crossref PubMed Scopus (187) Google Scholar). Our work defines a complex pattern of genetic and biochemical alterations in lipid metabolism that lead to expansion of the intracellular membrane network in LPS-induced differentiation of CH12 B-cells. CH12 B-cell Culture—The CH12 B-cell lymphoma cell line (31Haughton G. Arnold L.W. Bishop G.A. Mercolino T.J. Immunol. Rev. 1986; 93: 35-51Crossref PubMed Scopus (135) Google Scholar) was maintained by weekly passage as an ascites tumor in B10.A mice (The Jackson Laboratory, Bar Harbor, ME). Cells were harvested by peritoneal lavage and cultured in RPMI 1640 supplemented as described previously (4Gass J.N. Gifford N.M. Brewer J.W. J. Biol. Chem. 2002; 277: 49047-49054Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). CH12 B-cells were seeded at 2 × 105 cells/ml, and differentiation was induced by exposure to 25 μg/ml LPS (Escherichia coli 055:B5, Sigma) (31Haughton G. Arnold L.W. Bishop G.A. Mercolino T.J. Immunol. Rev. 1986; 93: 35-51Crossref PubMed Scopus (135) Google Scholar). Splenic B-cells were isolated from C57BL6/J mice by a depletion strategy using a B-cell isolation kit (Miltenyi Biotech) according to the manufacturer's protocol. All procedures involving mice were performed according to protocols approved by the Institutional Animal Care and Use Committees of both St. Jude Children's Research Hospital and Loyola University Medical Center. Lipid Extraction—CH12 cell pellets (2 × 107 cells) were resuspended in 1 ml of water or PBS. The total volume was measured, and a 100-μl aliquot was removed for protein determination. Lipids were extracted from a 900-μl aliquot by the method of Bligh and Dyer (37Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (43132) Google Scholar) using 2.4 ml of acetic acid in methanol (2%, v/v) and 1 ml of chloroform in the first step, followed by 1.5 ml of chloroform and 1.2 ml of water in the second step to yield two phases, organic and aqueous. The organic phase was collected and dried. Phospholipid Mass and Fatty Acid Distribution—Lipids extracted from CH12 cells were resuspended in 100 μl of chloroform/methanol (2:1, v/v). A 1-μl aliquot was loaded onto a thin layer silica gel rod and developed first in ether, dried, and then developed in chloroform/methanol/acetic acid/water (50: 25:8:2, v/v). Lipids were detected by flame ionization using an Iatroscan Instrument (Iatron Laboratories), and peaks were integrated with PEAKSIMPLE software (SRI Instruments). Peaks were identified by comigration with authentic standards. PtdCho and PtdEtn masses were calculated using standard curves for each. Lipids extracted from CH12 cells were resuspended in anhydrous methanol and converted into fatty acid methyl esters by addition of few drops of acetyl chloride followed by overnight incubation at room temperature. The solvent was dried under nitrogen, and the methyl esters were recovered by extraction using hexane/water (1:2, v/v). The organic phase was dried under nitrogen, and the methyl esters were dissolved into carbon disulfide and analyzed using a HP 5890 gas chromatograph equipped with a flame ionization detector and a capillary GC column: DB-225, 30 m × 0.53 mm, 0.5 μm (J & W Scientific). Methyl esters were identified by their retention times as determined using gas-liquid chromatography methyl ester standards in the FIM-FAME-7 mixture (Matreya). Phospholipid Electrospray-MS/MS Analysis—Mass spectrometry (MS) of PtdCho was performed by the Hartwell Center for Bioinformatics and Biotechnology at St. Jude Children's Research Hospital. Approximately 50 μg of total lipid was dissolved in 0.25 ml of chloroform/methanol 50:50 (v/v) + 1% formic acid. MS analysis was performed using a Finnigan™ TSQ® Quantum (Thermo Electron, San Jose, CA) triple quadrupole mass spectrometer equipped with the nanospray ion source. Samples were introduced via static nanoelectrospray using EconTips™ (New Objective, Woburn, MA). The instrument was operated in the positive ion mode using parent ion scanning for PtdCho. Ion source parameters were as follows: spray voltage 1000 V, capillary temperature 270 °C, capillary offset 35 V, and tube lens offset was set by infusion of the poly-tyrosine tuning and calibration solution (Thermo Electron, San Jose, CA) in electrospray mode. MS acquisition parameters for PtdCho were as follows: scan range 600-900 m/z, scan time 0.3 s, product mass 184.1 m/z, collision energy 40 V, peak width Q1 and Q3 0.7 FWHM, and Q2 CID gas 0.5 millitorr. Instrument control and data acquisition were performed with the Finnigan™ Xcalibur™ (version 1.4 SR1) software (Thermo Electron, San Jose, CA). IgM Secretion Rates and Enzyme-linked Immunosorbent Assays—CH12 cells, cultured for 24 and 48 h with or without LPS, were harvested and washed. Cells were subcultured at 2 × 105 viable cells/ml and incubated at 37 °C for 2 h; the amount of IgM secreted in the medium was measured by enzyme-linked immunosorbent assay using goat anti-mouse IgM, μ chain-specific, goat anti-mouse κ-alkaline phosphatase, κ chain-specific (SouthernBiotech, Birmingham, AL), and 4-methylumbelliferyl phosphate (Sigma) as substrate. Enzyme Assays—CK and CCT activities in CH12 cell lysates were measured as described previously (8Sriburi R. Jackowski S. Mori K. Brewer J.W. J. Cell Biol. 2004; 167: 35-41Crossref PubMed Scopus (523) Google Scholar). The activation of CCT by CH12 cell lipids was measured using purified recombinant CCTα protein. Recombinant rodent CCTα was expressed as histidine-tagged protein in SF9 insect cells and purified by metal-affinity and size-exclusion chromatographies using a HiTrap™ chelating HP column and a HiLoad™ 16/60 Superdex™ 200 column (Amersham Biosciences). Briefly, enzymatic activity was measured by incubation at 37 °C for 30 min of 0.5 μg/ml recombinant CCTα in assay buffer (100 mm HEPES, pH 7.4, 100 mm KCl, 20 mm MgCl2, 1 mm EGTA) in the presence of 1 mm CTP, 1 mm phosphocholine labeled with 3.2 μCi/mmol [14C]phosphocholine (55 mCi/mmol; Amersham Biosciences), and LUVs at concentrations ranging from 10 to 200 μg/ml. The enzymatic reaction was stopped with 400 mm EDTA (5 μl for 50 μl assay volume). Substrate and product were separated using Silica Gel H layers developed with methanol, 0.1 m NaCl, ammonium hydroxide (50:50:5, v/v) and identified by co-migration with authentic standards. The radioactivity associated with reagent and product was measured using a BIOSCAN AR-2000 imaging system. CCTα affinity for lipid was expressed as half-maximal stimulatory activity and was calculated by nonlinear regression analysis using Prism 4 software, version 4.00 (Graph-Pad software, Inc.). LUVs were prepared from lipids extracted from CH12 cells that were resuspended in buffer (15 mm sodium phosphate, pH 7.4, 150 mm NaCl) to a final phospholipid concentration of 1 mg/ml by vortexing and sonication. LUVs were extruded through a 100 nm pore diameter polycarbonate membrane, and the phospholipid concentration was determined colorimetrically using ammonium ferrothiocyanite (38Charles J. Stewart M. Anal. Biochem. 1980; 104: 10-14Crossref PubMed Scopus (1544) Google Scholar). LUVs were stored at 4 °C and used within 2 days of preparation. CPT activity in CH12 microsomes, prepared from frozen cell pellets, was determined as described previously (8Sriburi R. Jackowski S. Mori K. Brewer J.W. J. Cell Biol. 2004; 167: 35-41Crossref PubMed Scopus (523) Google Scholar, 39Henneberry A.L. McMaster C.R. Biochem. J. 1999; 339: 291-298Crossref PubMed Scopus (96) Google Scholar). DAG Quantification—DAG was quantified in lipids extracted from cells according to the protocol of Preiss et al. (40Preiss J.E. Loomis C.R. Bell R.M. Niedel J.E. Methods Enzymol. 1987; 141: 294-300Crossref PubMed Scopus (145) Google Scholar). The extracted samples or 1,2-dioleoyl-sn-glycerol standard (Avanti, Alabaster, AL) were solubilized in octyl-β-d-glucoside/cardiolipin, and DAG mass was determined by enzymatic assay in a reaction buffer containing 100 mm imidazole HCl, 100 mm NaCl, 25 mm MgCl2, 2 mm EGTA, pH 6.6, 20 mm DTT, DAG kinase (Calbiochem), and 10 mm ATP plus 1 μCi of [γ-32P]ATP (30 Ci/mmol). The reaction was incubated at room temperature for 30 min. The reaction was stopped by the addition of chloroform/methanol (1:2, v/v) and 1% HClO4, and the [32P]phosphatidic acid product was extracted using chloroform, 1% HClO4 (1:1, v/v). After centrifugation at 5,000 × g to separate the phases, the upper layer was discarded, and the lower layer, which contained [32P]phosphatidic acid product, was washed twice with 1% HClO4 and dried under vacuum. The dried samples were dissolved in 5% methanol in chloroform and fractionated on TLC plates developed in chloroform/methanol/acetic acid (65:27:8, v/v). Spots corresponding to the phosphatidic acid were scraped and counted for the radioactivity using scintillation spectroscopy. Metabolic Labeling—CH12 B-cells were seeded at 2 × 105 cells/ml in medium with or without 25 μg/ml LPS. At times after LPS addition, cells were harvested and resuspended in CH12 medium containing 6 μm choline and supplemented with 10 μCi/ml methyl[3H]choline (specific activity, 85 Ci/mmol) or 2 μCi/ml [2-14C]acetate (specific activity, 55 mCi/mmol), obtained from American Radiolabeled Chemicals, Inc. After labeling for 2, 2.5, or 3 h, cells were harvested, counted, and subjected to extraction according to the method of Bligh and Dyer (37Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (43132) Google Scholar). The amount of radiolabel incorporated into the organic and aqueous phases was quantified by scintillation counting. A 50-μl aliquot of each aqueous phase was spotted onto Silica Gel H layers (Analtech) that were developed in methanol, 0.1 m NaCl, ammonium hydroxide (50: 50:5, v/v). Choline, phosphocholine, and CDP-choline were identified by co-migration with standards and the bands excised; the fractional distribution of choline intermediates was determined by scintillation counting of the excised bands. The rate of [14C]acetate incorporation (2 h) into FA and DAG was estimated by TLC of the organic phase using CHCl3/methanol/acetic acid (98:2:1, v/v). FA and DAG were detected and identified by co-migration with [14C]dioleoyl-glycerol and [14C]oleic acid (American Radiolabeled Chemicals) using a Typhoon 9200 PhosphorImager (Amersham Biosciences) after exposure of the TLC plate to a phosphorus screen, and the band intensities were quantified using ImageQuant software, version 5.2 (Amersham Biosciences). CPT Assay in Permeabilized Cells—CH12 B-cells were seeded at 2 × 105 cells/ml in medium with or without 25 μg/ml LPS. At times after LPS addition, cells were harvested and resuspended at 108 cells/ml in 50 μl of labeling medium as follows: choline-free culture medium supplemented with 2 mm EGTA, 2 mm DTT, 80 μm digitonin, 0.02% Tween 20, and 100 μm [14C]CDP-choline 0.9 μCi/ml (American Radiolabeled Chemicals). Cells were incubated for 4 min at 37 °C; reactions were stopped by adding 240 μl of 2% acetic acid in methanol. Lipids were extracted as described earlier, and the amount of choline incorporated into PtdCho was estimated by scintillation spectroscopy. RNA Transcript Measurements—Total RNA was isolated from CH12 B-cells cultured with or without LPS for 3, 24, or 48 h using TRIzol (Invitrogen); contaminating genomic DNA was removed by digestion with DNase I, and aliquots were stored as an ethanol precipitate at -20 °C. cDNA was prepared from RNA by reverse transcription using Super-Script II RNase H- reverse transcriptase (Invitrogen) and random primers. Primers and probes for real time qRT-PCR were designed using Primer Express® software (version 2.0; Applied Biosystems) and are listed in Table 1. Real time qRT-PCR was carried out using the 7300 Real Time PCR System and 7300 System SDS software (version 1.2.3; Applied Biosystems). The Taqman Rodent GAPDH control reagent (Applied Biosystems) was the source of the primers and probes for quantifying the control Gapdh mRNA. The collected data were analyzed using the CT method (41Livak K.J. Schmittgen T.D. Methods (San Diego). 2001; 25: 402-408Crossref PubMed Scopus (127155) Google Scholar); the amount of target RNA was normalized to the endogenous Gapdh reference and related to the amount of target RNA in untreated cells. The specific number of experiments (n) and p values for statistical significance as evaluated by Student's t test (unpaired) are reported in each legend; the following convention was used for representing significance: * indicates 0.01 < p < 0.05; ** indicates 0.001 < p < 0.01, and *** indicates p < 0.001.TABLE 1Sequences of the real time qRT-PCR primers and probes (5′-3′)GeneForward primerReverse primerProbeChkaGGCCAAGATCTCATCCATTGAATGGTCAAAGTAGGCCTCGAATCTGGGTACATGGAATATGCCCAChkbAAGGGCCAGCTGACGAGTTCGGAGGCTCCAGGAGAAACCCCATCATCCTGAGGATCCAAPcyt1aTGGATGCACAGAGTTCAGCTAAATGCTCCATTAGGGCCAGGTCCTCTTTCCTCCTCTTCCTCGAATTGAChpt1GGCCCCCAACACCATCAGGGCAGTAGAAGATGAGCACTAGTGCTCGCCATCAACCTGGTCACCept1GTGTTGGCAAAAATGGGTCAACACTGATCCAATATGCAGAAAAGGCATAGCAGGAACAAGTGTCCTTT CFasnCCTGGATAGCATTCCGAACCTAGCACATCTCGAAGGCTACACACTGAGGGACCCTACCGCATAGCElovl6TTTTCGTGTGGCTTGTTTACGTTTGATCCCATTCCCACAGAAGTGGAATTGGAAAAGAATAAAATCTGAScd2TTCTTTGCTTTGTCCCTGATGATGGTGTACTCTGGAAGGTGAACACCGCCGCTCAGCTATAGGTCPpap2aGAAGAGGATCCACACACGACTCTTTCAGGGCTCGTGATTGGTTCAGTTCACGGAACTAPpap2bGCGATGTCCTGGCAGGATTGAGGTCGGACACGAAGAACACCAAGGAGCTCTGGTGGCCTGPecrGAGAGCACGGAGGGTCGATAGTGTGCGCGGCTGTTGATTGTCCTTCTTAATAATGGGTTTFads2CTTCAAAACCAACCACCTGTTCTACCAGGCAAGGCTTTCCATTCTCCTCCTGTCCCACATCATLpin1GCCGGAAGACTCCTGATAAAATGGTTGGCGACTGGTCACTAAAAGTCATTCACAGCGAGTC Open table in a new tab Affymetrix Array Analysis—Following the manufacturer's protocol, total RNA was used to prepare cRNA for hybridization, washing, and scanning of a GeneChip® Mouse Genome 430 2.0 array (Affymetrix, Inc., Santa Clara, CA) using a GeneChip® Fluidics Station 400 and a GeneArray™ scanner. Data were collected using Microarray Suite software (formerly known as GeneChip® Suite software). Comparison and statistical analysis of all the Affymetrix data were achieved using Spotfire® DecisionSite™ 8.11 (Spotfire, Inc.) software. The specific number of experiments (n) and p values for statistical significance as evaluated by Student's t test (unpaired) are reported in the footnotes to Table 2.TABLE 2Expression of genes in PtdCho synthesis altered in CH12 B-cells treated with LPS for 24 or 48 hProbe nameGene symbol.Gene nameRatio (+ LPS vs. untreated)24 h48 h1422619_ataThis is one of multiple probe sets.,bThis is not in agreement with real time qRT-PCR.Ppap2aPhosphatidic acid phosphatase 2a3.2cValues are 0.05 > p > 0.01, n = 4.1417403_ataThis is one of multiple probe sets.Elovl6ELOVL family member 6, elongation of long chain fatty acids2.5cValues are 0.05 > p > 0.01, n = 4.1428386_ataThis is one of multiple probe sets.Acsl3Acyl-CoA synthetase long chain family member 32.2cValues are 0.05 > p > 0.01, n = 4.1415822_ataThis is one of multiple probe sets.Scd2Stearoyl-coenzyme A desaturase 22.1cValues are 0.05 > p > 0.01, n = 4.1434287_ataThis is one of multiple probe sets.Agpat51-Acylglycerol-3-phosphate O-acyltransferase 5 (lysophosphatidic acid acyltransferase, ε)2.1dValues are 0.01 > p > 0.001, n = 4.1428821_atAgpat21-Acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, β)−2.5dValues are 0.01 > p > 0.001, n = 4.1439167_ataThis is one of multiple probe sets.PecrPeroxisomal trans-2-enoyl-CoA reductase3.5dValues are 0.01 > p > 0.001, n = 4.5.6dValues are 0.01 > p > 0.001, n = 4.1428336_ataThis is one of multiple probe sets.Agpat41-Acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic
Referência(s)