FIZZ1 Stimulation of Myofibroblast Differentiation
2004; Elsevier BV; Volume: 164; Issue: 4 Linguagem: Inglês
10.1016/s0002-9440(10)63218-x
ISSN1525-2191
AutoresTianju Liu, Saravana M. Dhanasekaran, Hongjian Jin, Biao Hu, Scott A. Tomlins, Arul M. Chinnaiyan, Sem H. Phan,
Tópico(s)Occupational and environmental lung diseases
ResumoBleomycin-induced pulmonary fibrosis is characterized by inflammation, emergence of myofibroblasts, and deposition of extracellular matrix. In an attempt to identify genes that may be involved in fibrosis, we used a 10,000 element (10 K) rat cDNA microarray to analyze the lung gene expression profiles in this model in the rat. Cluster analysis showed 628 genes were more than or equal to twofold up- or down-regulated, many of which were known to be involved in fibrosis. However, the most dramatic increase was observed with FIZZ1 (found in inflammatory zone; also known as RELM-α or resistin-like molecule-α), which was induced 17-fold to ∼25-fold at the peak of expression. In situ hybridization analysis revealed FIZZ1 expression to localize primarily to alveolar and airway epithelium, which was confirmed in vitro by analysis of isolated type II alveolar epithelial cells. However FIZZ1 expression was not detected in isolated lung fibroblasts. Co-culture of FIZZ1-expressing type II cells with fibroblasts stimulated α-smooth muscle actin and type I collagen expression independent of transforming growth factor-β. Transfection of a FIZZ1-expressing plasmid into fibroblasts or treatment with glutathione S-transferase-FIZZ1 fusion protein stimulated α-smooth muscle actin and collagen I production. These results suggest a novel role for FIZZ1 in myofibroblast differentiation in pulmonary fibrosis. Bleomycin-induced pulmonary fibrosis is characterized by inflammation, emergence of myofibroblasts, and deposition of extracellular matrix. In an attempt to identify genes that may be involved in fibrosis, we used a 10,000 element (10 K) rat cDNA microarray to analyze the lung gene expression profiles in this model in the rat. Cluster analysis showed 628 genes were more than or equal to twofold up- or down-regulated, many of which were known to be involved in fibrosis. However, the most dramatic increase was observed with FIZZ1 (found in inflammatory zone; also known as RELM-α or resistin-like molecule-α), which was induced 17-fold to ∼25-fold at the peak of expression. In situ hybridization analysis revealed FIZZ1 expression to localize primarily to alveolar and airway epithelium, which was confirmed in vitro by analysis of isolated type II alveolar epithelial cells. However FIZZ1 expression was not detected in isolated lung fibroblasts. Co-culture of FIZZ1-expressing type II cells with fibroblasts stimulated α-smooth muscle actin and type I collagen expression independent of transforming growth factor-β. Transfection of a FIZZ1-expressing plasmid into fibroblasts or treatment with glutathione S-transferase-FIZZ1 fusion protein stimulated α-smooth muscle actin and collagen I production. These results suggest a novel role for FIZZ1 in myofibroblast differentiation in pulmonary fibrosis. Pulmonary fibrosis is not an uncommon end result of a multitude of lung diseases and lung injury. Many of these result in progressive fibrosis that terminates in end-stage pulmonary disease and death from respiratory failure. Fibrosis associated with the idiopathic interstitial pneumonias is commonly an untreatable disease with significant mortality. Because the natural history of many of these diseases is unknown, animal model studies have been undertaken to fill in the gaps and to seek out clues for important pathogenic mechanisms. One of the models that have been extensively studied used bleomycin (BLM) to induce lung injury, inflammation, and fibrosis. BLM is an anti-neoplastic antibiotic, and is used clinically in treatment of various squamous cell carcinomas.1Thrall RS Scalise PJ Pulmonary fibrosis.in: Phan SH Thrall RS Lung Biology in Health and Disease. vol 80. Marcel Dekker, Inc., New York1995: 231Google Scholar BLM-induced lung fibrosis is a well-characterized animal model in which a progressive fibrotic process is developed after initial lung inflammation. It is characterized by increased proliferation of fibroblasts, increased expression of cytokines such as transforming growth factor (TGF)-β1, the de novo appearance of myofibroblasts with their distinct α-smooth muscle actin (α-SMA)-expressing phenotype, as well as the deposition of extracellular matrix.2Evans JN Kelley J Low RB Adler KB Increased contractility of isolated lung parenchyma in an animal model of pulmonary fibrosis induced by bleomycin.Am Rev Respir Dis. 1982; 125: 89-94PubMed Google Scholar, 3Phan SH Varani J Smith D Rat lung fibroblast collagen metabolism in BLM-induced pulmonary fibrosis.J Clin Invest. 1985; 76: 241-247Crossref PubMed Scopus (96) Google Scholar, 4Zhang HY Gharaee-Kermani M Zhang K Karmiol S Phan SH Lung fibroblast alpha-smooth muscle actin expression and contractile phenotype in BLM-induced pulmonary fibrosis.Am J Pathol. 1996; 148: 527-537PubMed Google Scholar Accumulated evidence revealed that expression of a number of genes was elevated after BLM administration including fibrogenic cytokines such as TGF-β1 and interleukin (IL)-5, which reaches peak expression on approximately day 7 after BLM injection.5Zhang K Flander KC Phan SH Cellular localization of transforming growth factor-β expression in bleomycin-induced pulmonary fibrosis.Am J Pathol. 1995; 147: 352-361PubMed Google Scholar, 6Gharaee-Kermani M Phan SH Lung interleukin-5 expression in murine bleomycin-induced pulmonary fibrosis.Am J Respir Cell Biol. 1997; 16: 438-447Crossref PubMed Scopus (68) Google Scholar, 7Phan SH Gharaee-Kermani M Wolber F Ryan US Stimulation of rat endothelial cell transforming growth factor-beta production by bleomycin.J Clin Invest. 1991; 87: 148-154Crossref PubMed Scopus (83) Google Scholar Increases in extracellular matrix expression, such as elastin, collagen I, collagen III, and α-SMA are also well established.4Zhang HY Gharaee-Kermani M Zhang K Karmiol S Phan SH Lung fibroblast alpha-smooth muscle actin expression and contractile phenotype in BLM-induced pulmonary fibrosis.Am J Pathol. 1996; 148: 527-537PubMed Google Scholar, 8Lucey EC Ngo HQ Agarwal A Smith BD Snider GL Goldstein RH Differential expression of elastin and alpha-1 collagen mRNA in mice with bleomycin-induced pulmonary fibrosis.Lab Invest. 1996; 74: 12-20PubMed Google Scholar, 9Shahzeidi S Mulier B de Crombrugghe B Jeffery PK McAnulty RJ Laurent GJ Enhanced type III collagen gene expression during bleomycin induced lung fibrosis.Thorax. 1993; 48: 622-628Crossref PubMed Scopus (37) Google Scholar, 10Dolhnikoff M Mauad T Ludwig MS Extracellular matrix and oscillatory mechanism of rat lung parenchyma in bleomycin-induced fibrosis.Am J Respir Crit Care Med. 1999; 160: 1750-1757Crossref PubMed Scopus (88) Google Scholar These diverse processes likely involve complex patterns of gene expression that remain to be fully elucidated. Identification of these genes and their biological activities should provide important clues to their roles in pulmonary fibrosis, and thus provide novel insights into pathogenesis and potential therapeutic approaches. Previous studies of gene expression have provided some clues as to the potential role of certain genes in pathogenesis of fibrosis, but elucidated little in the way of uncovering the whole spectrum of possible genes that may be involved because of the limitation of standard analysis of one or a few genes. The development of oligonucleotide array or cDNA microarray technology allows the global analysis of gene expression and provides the opportunity to explore simultaneously complex patterns of gene expression in an animal model, wherein evolution from initial injury to fibrosis can be sequentially studied. Recent studies using this approach have yielded some interesting data on patterns of gene expression, in one of which a previously unsuspected role for matrilysin in BLM-induced pulmonary fibrosis is uncovered. Analysis of known genes confirmed previous evidence of early up-regulation of genes associated with inflammation followed subsequently with up-regulation of those associated with fibrosis.11Zuo F Kaminski N Eugui E Allard J Yakhin Z Ben-dor A Lollin L Morris D Kim Y DeLustro B Sheppard D Pardo A Selman M Gene expression analysis reveals matrilysin as a key regulator of pulmonary fibrosis in mice and human.Proc Natl Acad Sci USA. 2002; 99: 6292-6297Crossref PubMed Scopus (534) Google Scholar, 12Katsuma S Nishi K Tanigawara K Ikawa H Shiojima S Takagak K Kaminishi Y Suzuki Y Hirasawa A Ohgi T Yano J Murakami Y Tsujimoto G Molecular monitoring of bleomycin-induced pulmonary fibrosis by cDNA microarray-based gene expression profiling.Biochem Biophys Res Commun. 2001; 288: 747-751Crossref PubMed Scopus (49) Google Scholar, 13Kaminski N Allard JD Pittet JF Zuo F Griffiths MJD Morris D Huang X Sheppard D Heller RA Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis.Proc Natl Acad Sci USA. 2000; 97: 1778-1783Crossref PubMed Scopus (371) Google Scholar A limitation is that only genes included in the microarray can be detected, nevertheless the approach has the potential of uncovering novel (or previously not suspected) genes that may play important roles in the pathogenesis of pulmonary fibrosis. To further examine global changes in gene expression and help identify additional, potentially novel genes that may be associated with pulmonary fibrosis, we used a 10,000 element (10 K) rat cDNA microarray to analyze the gene expression profiles in a rat model of BLM-induced pulmonary fibrosis. This approach enables screening for possible novel expressed genes and further investigation of their function. The results show more than 600 genes whose expression was significantly altered in BLM-treated lungs, some of which have been previously reported and known to be relevant to the pathogenesis of fibrosis. However, an unexpected finding was the dramatic induction of a novel molecule, previously identified as FIZZ1 (found in inflammatory zone; also known as RELM-α or resistin-like molecule-α) in BLM-induced lung injury. Initial characterization suggests expression to localize primarily to alveolar and airway epithelium, but was not expressed by fibroblasts. Studies using co-cultures of type II alveolar epithelial cells (AECs) and fibroblasts, as well as studies using a FIZZ1-expressing plasmid or rat glutathione S-transferase (GST)-FIZZ1 fusion protein indicated that FIZZ1 could promote myofibroblast differentiation that is independent of endogenous TGF-β1 activity. These findings suggest a novel activity of FIZZ1 that is consistent with a profibrotic role not dissimilar to that for TGF-β, at least with respect to de novo emergence of the myofibroblast phenotype. Female-specific pathogen-free Fisher 344 rats (7 to 8 weeks old) were purchased from Charles River Breeding Laboratories, Inc. (Wilmington, MA). Pulmonary fibrosis was induced by the endotracheal injection of 7.5 U/kg body weight of BLM (Blenoxane; Mead Johnson, NJ) in sterile phosphate-buffered saline (PBS) as before.3Phan SH Varani J Smith D Rat lung fibroblast collagen metabolism in BLM-induced pulmonary fibrosis.J Clin Invest. 1985; 76: 241-247Crossref PubMed Scopus (96) Google Scholar, 4Zhang HY Gharaee-Kermani M Zhang K Karmiol S Phan SH Lung fibroblast alpha-smooth muscle actin expression and contractile phenotype in BLM-induced pulmonary fibrosis.Am J Pathol. 1996; 148: 527-537PubMed Google Scholar The control group received the same volume of sterile PBS only. On days 7, 14, 21, and 28 after BLM injection, the rats were sacrificed and the lungs were removed and either immediately frozen in liquid nitrogen for mRNA analysis or used for isolation of fibroblasts and type II AECs. DNA microarray analysis was done essentially as previously described.14Chinnaiyan AM Huber-Lang M Kumar-Sinha C Barrette TR Shankar-Sinha S Sarma VJ Padgaonkar VA Ward PA Molecular signatures of sepsis: multiorgan gene expression profiles of systemic inflammation.Am J Pathol. 2001; 159: 1199-1209Abstract Full Text Full Text PDF PubMed Google Scholar The sequence-verified cDNA clones on the rat cDNA microarray are available from Research Genetics (www.resgen.com). All chips had various control elements, which included human rat and yeast genomic DNAs, standard saline citrate, and housekeeping genes. Isolated lung tissue RNA (15 μg) was used as a template for cDNA generation using reverse transcriptase (RT) (Invitrogen, Carlsbad, CA) in the present of amino allyl-dUTP (Sigma, St. Louis, MO) that allow for subsequent fluorescent labeling of cDNA using Cy3 or Cy5 NHS ester dyes (Amersham Pharmacia Biotech Ltd., Buckinghamshire, UK). The cDNA from each time point-matched control sample was labeled with fluorescence dye Cy3 and the experimental sample with Cy5. The labeled probes were then hybridized to rat cDNA microarray at 65°C overnight. RNA samples from a total of three rats at each time point were analyzed separately by three individual chips (one for each rat sample). Thus RNA samples from different animals were not pooled before analysis. Fluorescent images were obtained using a GenePix 4000B microarray scanner (Axon Instruments, Foster City, CA). Primary analysis was done by using the GenePix software package (Axon Instruments). Cy3 to Cy5 ratios were determined for the individual genes along with various other quality control parameters (eg, intensity over local background). The average median ratio values for all spots were normalized to 1.0. The data set was imported into Cluster Analysis of Gene Expression Dynamics (CAGED). CAGED v 1.0 software is designed to perform Bayesian model-based clustering on temporal gene expression data.15Romoni MF Sebastiani P Kohane IS Cluster analysis of gene expression dynamics.Proc Natl Acad Sci USA. 2002; 99: 9121-9126Crossref PubMed Scopus (379) Google Scholar Briefly, CAGED considers two temporal gene expression patterns as similar when they are generated by the same unknown process, and searches for the most probable set of processes generating the observed data. Our analysis only included genes with at least one observation greater than a twofold increase or below a twofold decrease for a total of 9154 genes. We analyzed the data with an autoregressive order (Markov order) of 1, a prior precision value of 1, a γ value of 0, a Bayes factor of 1, and Euclidean distance between gene profiles to guide the analysis. The clustering method is completely described previously15Romoni MF Sebastiani P Kohane IS Cluster analysis of gene expression dynamics.Proc Natl Acad Sci USA. 2002; 99: 9121-9126Crossref PubMed Scopus (379) Google Scholar and available at http://www.pathology.med.umich.edu/chinnaiyan/index.html. Clusters identified by CAGED were further analyzed using the program Cluster (log transformation of the data and average-linkage hierarchical clustering) and visualized with Tree View.16Eisen MB Spellman PT Brown PO Botstein D Cluster analysis and display of genome-wide expression patterns.Proc Natl Acad Sci USA. 1998; 95: 14863-14868Crossref PubMed Scopus (13371) Google Scholar CAGED cluster 4, containing 648 genes, was filtered to only include genes showing a threefold difference at any two time points, and two distinct clusters of up-regulated genes were identified. CAGED cluster 4 was then filtered to only include genes showing a fourfold difference at any two time points yielding a third group of up-regulated genes. For quantitative mRNA analysis, total RNAs were isolated from lung tissue, fibroblasts, or type II AECs. Primer Express 2.0 software (Applied Biosystems, Foster City, CA) was used to design Taqman primers and MGB probes (6-FAM conjugated) for FIZZ1 and α-SMA, which were then purchased from Applied Biosystems (PE/ABI, Foster City, CA). The primer sequences were as follows: rat FIZZ1: forward primer, 5′CAACAGGATGAAGACTGCAACCT3′; reverse primer, 5′GGGACCATCAGCTAAAGAAG3′; and probe, 5′ 6FAM-CCCTTCTCATCTGCGTCT3′; rat α-SMA: forward primer, 5′CGGGCTTTGCTGGTGATG3′; reverse primer, 5′CCCTCGATGGATGGGAAA3′; and probe, 5′ 6FAM-TGCTCCCAGGGCTG3′. Primers and probes for TGF-β1 and GAPDH were purchased from PE/ABI. For each assay, 100 ng of total RNA was used as template. GAPDH mRNA was used as internal control to normalize the amount of input RNA. One-step real time RT-PCR (48°C for 30 minutes, 95°C for 10 seconds followed by 45 cycles of 95°C for 10 seconds, 60°C for 1 minute) was undertaken with Taqman One Step RT-PCR Master Mix (PE/ABI) using a GeneAmp 5700 Sequence Detection System (PE/ABI). In situ hybridization was used to localize expression of FIZZ1 in lung tissue sections. Lung tissue samples from BLM-treated and saline-treated control animals were rapidly frozen on sacrifice and 10-μm frozen sections were made. Three anti-sense and corresponding sense digoxigenin-labeled FIZZ1 oligonucleotide probes were synthesized by Integrated DNA Technologies Inc. (Coralville, CA). A mixture of three different anti-sense probes was used to increase the sensitivity of in situ hybridization. A mixture of the corresponding three sense oligonucleotides were used as negative control. The sequences of the three anti-sense oligonucleotide probes were as follows: 1) 5′ACGGGTAATTGGGGCGAAGAACTTTTTTAT3′; 2) 5′GACCCTACTGACGATGACCAACAAGAACAC3′; and 3) 5′GGAAGAGTAGACGCAGAAGGAAGAGGTCGA3′. In situ hybridization was performed essentially as previously described17Nozaki Y Liu T Hatano K Gharaee-Kermani M Phan SH Induction of telomerase activity in fibroblasts from bleomycin-induced lungs.Am J Respir Cell Mol Biol. 2000; 23: 460-465Crossref PubMed Scopus (58) Google Scholar and in accordance with the kit manufacturer's instructions (Roche Molecular Biochemicals, Indianapolis, IN). Briefly, sections were digested with 1 μg/ml of Proteinase K (Invitrogen) for 30 minutes at 37°C. After postfixing by 4% paraformaldehyde (Sigma), sections were acetylated with 0.1 mol/L of triethanolamine (Sigma), and then incubated with prehybridization buffer [4× standard saline citrate containing 50% (v/v) deionized formamide (Sigma)] for 1 hour at 37°C. Sections were processed for in situ hybridization with mRNA in situ hybridization solution (DAKO, Carpinteria, CA) containing 10 ng/ml of probe mixture for 48 hours at 37°C, and then washed twice at high stringency at 37°C in 2× standard saline citrate for 15 minutes each, followed by two 15-minute washes in 0.1× standard saline citrate. After incubation with blocking buffer [100 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, 0.1% Triton X-100, and 2% normal sheep serum (Sigma)], sections were incubated with anti-digoxigenin-alkaline phosphatase (1:500 in blocking buffer, Roche Molecular Biochemicals). Color was then developed with the NBT/BCIP system (Roche Molecular Biochemicals) for 2 to 24 hours followed by counterstaining with methyl green (Vector Laboratories, Inc., Burlingame, CA). The FIZZ1 cDNA clone used in the rat cDNA microarray chips was confirmed to be a full-length FIZZ1 cDNA by sequencing and comparing with the known sequence of rat FIZZ1. This FIZZ1 cDNA was inserted into cloning vector pT7T33D-PAC with EcoRI and NotI. The full-length rat FIZZ1 cDNA insert was next digested from pT7T3D-PAC using XhoI and HindIII, and then subcloned into pEGFP-C2 (BD Biosciences, Clontech, Palo Alto, CA) using T4 DNA ligase (Promega, Madison, WI) in accordance with the manufacturer's instructions. The identity of the construct was confirmed by sequencing. Fibroblasts were maintained in Dulbecco's modified Eagle's medium supplemented with 10% plasma-derived fetal bovine serum, 10 ng/ml of platelet-derived growth factor, and 5 ng/ml of epidermal growth factor (R&D Systems, Minneapolis, MN). They were plated into six-well plates at a density of 2 × 105 cells/well and allowed to grow to ∼80% confluence. Cells were transiently transfected by pEGFP-FIZZ1 with transfection reagent Fugene 6 (Roche Molecular Biochemicals) at a ratio of 2:3 (μg:μl), and cells were harvested after 24, 48, 72, and 96 hours, either for RNA or protein analysis. Empty plasmid pEGFP-C2 was also transfected under the same conditions and used as negative control. Where indicated transfected cells were also transfected with sense or anti-sense FIZZ1 oligonucleotides as used in in situ hybridization analysis, to study the effects of specific inhibition of induced FIZZ1 expression. In additional experiments FIZZ1 plasmid-transfected cells expressing FIZZ1 were sonicated and the supernates applied onto naïve (ie, not transfected) fibroblast monolayers to study the effects of FIZZ1 on these cells. The full-length rat FIZZ1 insert was cloned in pGEX-4T-2 (BD Biosciences, Clontech), which encodes a GST sequence. GST-FIZZ1 fusion protein was expressed in Escherichia coli BL21 by using bulk GST purification modules (Amersham) according to the manufacturer's instructions. Briefly, a single colony containing a recombinant pGEX-FIZZ1 plasmid was inoculated into 5 ml of 2× YTA (16 g/L tryptone, 10 g/L yeast extract, and 5 g/L NaCl) medium to grow at 37°C overnight with vigorous shaking. Then the culture was diluted into 500 ml of 2×YTA medium and grown to an A600 nm of 0.6 to 0.8 (3 to ∼4 hours). FIZZ1 fusion protein expression was then induced with 1 mmol/L isopropyl-β-d-thiogalactoside for an additional 2 hours. The cells were pelleted and lysed with 10 μg/ml of lysozyme followed by sonication. A 50% slurry of glutathione-Sepharose 4B was then added to the sonicates and incubated at room temperature for 30 minutes. After removing nonbound material by washing with PBS, bound protein was then eluted by addition of 10 mmol/L of reduced glutathione (in 50 mmol/L Tris-HCl). Purity of the GST-FIZZ1 fusion protein in the eluates was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. For negative control, GST was induced and purified from the parental pGEX plasmid using the same procedure. For functional study, rat lung fibroblasts were plated onto six-well plates at a density of 2 × 105 cells/well and allowed to grow to ∼80% confluence. After 24 hours of serum deprivation, GST-FIZZ1 (4 or 8 μg/ml) or GST (8 μg/ml) was added to fibroblast monolayers. After 24 or 48 hours of incubation, the cells were harvested for analysis of α-SMA expression by Western blotting. Rat lung fibroblasts and AECs were isolated from control or BLM-treated animals, as described previously.3Phan SH Varani J Smith D Rat lung fibroblast collagen metabolism in BLM-induced pulmonary fibrosis.J Clin Invest. 1985; 76: 241-247Crossref PubMed Scopus (96) Google Scholar, 18Dobbs LG Isolation and culture of alveolar type II cells.Am J Physiol. 1990; 258: L134-L147PubMed Google Scholar Isolated fibroblasts were maintained in culture and passaged as previously described.3Phan SH Varani J Smith D Rat lung fibroblast collagen metabolism in BLM-induced pulmonary fibrosis.J Clin Invest. 1985; 76: 241-247Crossref PubMed Scopus (96) Google Scholar Only fibroblasts between passage 3 and 5 after primary culture were used. AECs were isolated by elastase cell dispersion and IgG panning.18Dobbs LG Isolation and culture of alveolar type II cells.Am J Physiol. 1990; 258: L134-L147PubMed Google Scholar Briefly, after multiple whole lung lavages with 1 mmol/L of EGTA in balanced salt solution, porcine pancreatic elastase (4.3 U/ml; Worthington, Lakewood, NJ) was instilled via the trachea to release type II cells. Contaminating cells bearing Fc receptors were removed from the cell suspension by panning on plates coated with rat IgG (Sigma). The cells were plated onto 6-well tissue culture dishes precoated with fibronectin (R&D Systems) in Dulbecco's modified Eagle's medium supplemented with 10% newborn calf serum (Sigma). Isolated cells were evaluated by immunofluorescent staining with anti-cytokeratin5/8 (BD Biosciences, San Diego, CA), which recognizes the cytokeratins found in AEC, but not present in macrophages, fibroblasts, and endothelial cells.18Dobbs LG Isolation and culture of alveolar type II cells.Am J Physiol. 1990; 258: L134-L147PubMed Google Scholar, 19Christensen PJ Bailie MB Goodman RE O'Brien AD Toews GB Paine III, B Role of diminished epithelial GM-CSF in the pathogenesis of BLM-induced pulmonary fibrosis.Am J Physiol. 2000; 279: L487-L495Google Scholar After 2 days in culture, the adherent cells were consistently >90% epithelial cells. Primary cultured AECs were used without passaging. The next day after isolation, AECs (1 × 105 per well) were added onto monolayers of normal rat lung fibroblasts plated 24 hours previously into six-well plates at a density of 2 × 105 cells/well. After an additional 36 hours the cells were harvested for Western blotting analysis and enzyme-linked immunosorbent assay (ELISA) assay for quantitation of α-SMA and collagen type I expression, respectively. Where indicated, 10 μg/ml of nonimmune IgG or monoclonal anti-TGF-β1 antibody (R&D Systems) were added to the fibroblast monolayers 24 hours before adding AECs to examine the contribution of TGF-β on expression of α-SMA and collagen I. This antibody neutralizes the biological activity of TGF-β1 and TGF-β1.2 according to the manufacturer's data sheet, and the cross-reactivity with TGF-β3 and TGF-β5 was less than 2%. The cell lysates were then harvested for protein analysis 36 hours after co-culture. This was done essentially as previously described.20Huaux F Liu T McGarry B Ullenbruch M Phan SH Dual roles of interleukin-4 (IL-4) in lung injury and fibrosis.J Immunol. 2003; 170: 2083-2092PubMed Google Scholar Briefly, cell extracts (200 ng protein/well in 100 μl of PBS) were added to coat each well of a 96-well ELISA plate, and incubated at 4°C overnight. After blocking with 1% bovine serum albumin, rabbit anti-rat collagen type I (1:500; Biodesign International, Saco, ME) and polyclonal horseradish peroxidase-conjugated goat anti-rabbit IgG (BD Pharmingen) were sequentially added as primary and secondary antibodies, respectively. The color was developed with 3,3′,5,5′-tetramethylbenzidine substrates (Sigma), and read at 450 nm with an ELx 800UV universal microplate reader (Bio-Tek Instruments Inc., Winooski, VT). Western blotting to detect α-SMA protein expression was performed as previously described.21Liu T Nozaki Y Phan SH Regulation of telomerase activity in rat lung fibroblasts.Am J Respir Cell Mol Biol. 2001; 26: 534-540Crossref Scopus (57) Google Scholar Ten μg of cell extract protein was separated by sodium dodecyl sulfate-polyacrylamide gel (12.5%) electrophoresis. Mouse anti-α-SMA antibody (Roche Molecular Biochemicals) and horseradish peroxidase-labeled anti-mouse IgG (Amersham) were used for immunostaining. The bands were visualized immediately by exposing to ECL Hyperfilm (Amersham), and after scanning were quantitated using 1D Image Analysis software (Kodak, Rochester, NY). We used a modified luciferase assay as described previously22Abe M Harpel JG Metz CN Nunes I Loskutoff DJ Rifkin DB An assay for transforming growth factor-β using cells transfected with plasminogen activator inhibitor-1 promoter-luciferase construct.Anal Biochem. 1994; 216: 276-284Crossref PubMed Scopus (682) Google Scholar to measure TGF-β1 activity. Briefly, mink lung epithelial cells transfected with plasminogen activator inhibitor-1 (PAI-1) promoter fused to the firefly luciferase reporter gene (a kind gift of Dr. DB Rifkin, New York University, New York, NY) were seeded in a 96-well plate with a density of 2 × 104 cells/well and cultured until ∼80% confluent. The media were then replaced with test samples diluted (1:2 dilution) in fresh media. To measure total activity, test samples were preacidified by using Quantikine human TGF-β1 kit (R&D Systems) before assay. After a 24-hour incubation, the media were removed and the cells were lysed with reporter lysis buffer (Promega). Luciferase activity was measured by luciferase assay system (Promega) and read using a reporter microplate luminometer (Turner Designs, Sunnyvale, CA). Human TGF-β1 (R&D Systems) was used as a standard. All data were expressed as mean ± SE unless otherwise indicated. Differences between means of various treatment and control groups were assessed for statistical significance by analysis of variance followed by post hoc analysis using Scheffé's test for comparison between any two groups. A P value <0.05 was considered to indicate statistical significance. Routine lung histopathology (hematoxylin and eosin staining) confirmed induction of the model by BLM as previously described.3Phan SH Varani J Smith D Rat lung fibroblast collagen metabolism in BLM-induced pulmonary fibrosis.J Clin Invest. 1985; 76: 241-247Crossref PubMed Scopus (96) Google Scholar, 4Zhang HY Gharaee-Kermani M Zhang K Karmiol S Phan SH Lung fibroblast alpha-smooth muscle actin expression and contractile phenotype in BLM-induced pulmonary fibrosis.Am J Pathol. 1996; 148: 527-537PubMed Google Scholar Cluster analysis showed distinguishable expression patterns between normal versus BLM-injured lungs, with respect to distinct groups of genes involved in both the early inflammatory and subsequent fibrotic responses. CAGED analysis of the temporal data set yielded five distinct clusters. The average profile of each cluster as well as the residual statistics and the expected values of an approximately normal distribution are available at http://www.pathology.med.umich.edu/chinnaiyan/index.html. To further examine the data, we next analyzed the results using Cluster as described in the Materials and Methods. Using Tree View, 628 of identified genes in the five clusters representing down- and up-regulated genes (on days 7, 14, 21, and 28; BLM-treated versus control lungs) are visualized in Figure 1. Cluster A was composed of 38 genes whose expression was down-regulated at all time points examined. The expression of most genes in this cluster was decreased maximally at day 7 after BLM injection, and remained down-regulated up to day 28. This cluster included trans
Referência(s)