Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Estrogen Regulation of Cyclin D1 Gene Expression in ZR-75 Breast Cancer Cells Involves Multiple Enhancer Elements

2001; Elsevier BV; Volume: 276; Issue: 33 Linguagem: Inglês

10.1074/jbc.m103339200

ISSN

1083-351X

Autores

Emely Castro‐Rivera, Ismael Samudio, Stephen Safe,

Tópico(s)

Retinoids in leukemia and cellular processes

Resumo

Cyclin D1 gene expression is induced by 17β-estradiol (E2) in human breast cancer cells and is important for progression of cells through the G1 phase of the cell cycle. The mechanism of activation of cyclin D1 is mitogen- and cell context-dependent, and this study describes the role of multiple promoter elements required for induction of cyclin D1 by E2 in estrogen receptor (ER)-positive ZR-75 breast cancer cells. Transcriptional activation of cyclin D1 by E2 was dependent, in part, on a proximal cAMP-response element at −66, and this was linked to induction of protein kinase A-dependent pathways. These results contrasted to a recent report showing that induction of cyclin D1 by E2 in ER-positive MCF-7 and HeLa cells was due to up-regulation of c-jun and subsequent interaction of c-Jun-ATF-2 with the CRE. Moreover, further examination of the proximal region of the cyclin D1 promoter showed that three GC-rich Sp1-binding sites at −143 to −110 were also E2-responsive, and interaction of ERα and Sp1 proteins at these sites was confirmed by electromobility shift and chromatin immunoprecipitation assays. Thus, induction of cyclin D1 by E2 in ZR-75 cells is regulated through nuclear ERα/Sp1 and epigenetic protein kinase A activation pathways, and our results suggest that this mechanism may be cell context-dependent even among ER-positive breast cancer cell lines. Cyclin D1 gene expression is induced by 17β-estradiol (E2) in human breast cancer cells and is important for progression of cells through the G1 phase of the cell cycle. The mechanism of activation of cyclin D1 is mitogen- and cell context-dependent, and this study describes the role of multiple promoter elements required for induction of cyclin D1 by E2 in estrogen receptor (ER)-positive ZR-75 breast cancer cells. Transcriptional activation of cyclin D1 by E2 was dependent, in part, on a proximal cAMP-response element at −66, and this was linked to induction of protein kinase A-dependent pathways. These results contrasted to a recent report showing that induction of cyclin D1 by E2 in ER-positive MCF-7 and HeLa cells was due to up-regulation of c-jun and subsequent interaction of c-Jun-ATF-2 with the CRE. Moreover, further examination of the proximal region of the cyclin D1 promoter showed that three GC-rich Sp1-binding sites at −143 to −110 were also E2-responsive, and interaction of ERα and Sp1 proteins at these sites was confirmed by electromobility shift and chromatin immunoprecipitation assays. Thus, induction of cyclin D1 by E2 in ZR-75 cells is regulated through nuclear ERα/Sp1 and epigenetic protein kinase A activation pathways, and our results suggest that this mechanism may be cell context-dependent even among ER-positive breast cancer cell lines. cAMP-response element-binding protein activation function activating transcription factor cyclin D1 chromatin immunoprecipitation c-AMP-response element charcoal-stripped serum 17β-estradiol estrogen receptor human ER estrogen-response element p300/CRE-binding protein associated factor protein kinase A Dulbecco's modified Eagle's fetal bovine serum polymerase chain reaction cholera toxin electrophoretic mobility shift assay Mitogen stimulation of cell growth is accompanied by the coordinate expression of multiple genes and pathways including those required for different phases of cell cycle progression (1Sherr C.J. Cancer Res. 2000; 60: 3689-3695PubMed Google Scholar, 2Pavletich N.P. J. Mol. Biol. 1999; 287: 821-828Crossref PubMed Scopus (560) Google Scholar, 3Morgan D.O. Annu. Rev. Cell Dev. Biol. 1997; 13: 261-291Crossref PubMed Scopus (1769) Google Scholar, 4Sherr C.J. Cell. 1994; 79: 551-555Abstract Full Text PDF PubMed Scopus (2576) Google Scholar, 5Sherr C.J. Science. 1996; 274: 1672-1677Crossref PubMed Scopus (4927) Google Scholar, 6Sherr C.J. Cell. 1993; 73: 1059-1065Abstract Full Text PDF PubMed Scopus (1985) Google Scholar, 7Nurse P. Masui Y. Hartwell L. Nat. Med. 1998; 4: 1103-1106Crossref PubMed Scopus (122) Google Scholar). Cyclin D1 is induced early in the G1 phase of the cell cycle, and cyclin D1-cyclin-dependent kinase complexes are important for phosphorylation of several key substrates involved in cell proliferation including retinoblastoma protein and other pocket proteins. The critical role for cyclin D1 in the rate of progression of cells through G1 has stimulated studies on factors that regulate cyclin D1 gene expression in various cell types. Transcriptional activation of cyclin D1 depends in part on interaction of trans-acting factors with elements in the cyclin D1 gene promoter; it is clear from promoter analysis studies that the assembly of transcription factors is highly variable and dependent on multiple factors including the mitogen and cell context (8–20). For example, p21ras and p300 expression activated constructs containing cyclin D1 gene promoter inserts in JEG-3 human trophoblasts through interactions of proteins at a distal AP-1-like sequence at −954 in the promoter (13Albanese C. D'Amico M. Reutens A.T. Fu M. Watanabe G. Lee R.J. Kitsis R.N. Henglein B. Avantaggiati M. Somasundaram K. Thimmapaya B. Pestell R.G. J. Biol. Chem. 1999; 274: 34186-34195Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). Overexpression of p60v-src in MCF-7 breast cancer cells also activates cyclin D1 and involves activation of a cAMP-response element-binding protein (CREB)1 and activating transcription factor-2 (ATF-2) which interacts with a CRE at −66 in the cyclin D1 promoter (16Lee R.J. Albanese C. Stenger R.J. Watanabe G. Inghirami G. Haines G.K. Webster M. Muller W.J. Brugge J.S. Davis R.J. Pestell R.G. J. Biol. Chem. 1999; 274: 7341-7350Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). Cyclin D1 protein is overexpressed in ∼50% of mammary carcinomas (21Barnes D.M. Gillett C.E. Breast Cancer Res. Treat. 1998; 52: 1-15Crossref PubMed Scopus (225) Google Scholar, 22Weinstat-Saslow D. Merino M.J. Manrow R.E. Lawrence J.A. Bluth R.F. Wittenbel K.D. Simpson J.F. Page D.L. Steeg P.S. Nat. Med. 1995; 1: 1257-1260Crossref PubMed Scopus (291) Google Scholar, 23Buckley M.F. Sweeney K.J. Hamilton J.A. Sini R.L. Manning D.L. Nicholson R.I. deFazio A. Watts C.K. Musgrove E.A. Sutherland R.L. Oncogene. 1993; 8: 2127-2133PubMed Google Scholar), and 17β-estradiol (E2) induces cyclin D1 gene expression in estrogen receptor (ER)-positive human breast cancer cell lines (24Foster J.S. Wimalasena J. Mol. Endocrinol. 1996; 10: 488-498Crossref PubMed Scopus (203) Google Scholar, 25Prall O.W.J. Sarcevic B. Musgrove E.A. Watts C.K.W. Sutherland R.L. J. Biol. Chem. 1997; 272: 10882-10894Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar, 26Planas-Silva M.D. Weinberg R.A. Mol. Cell. Biol. 1997; 17: 4059-4069Crossref PubMed Scopus (233) Google Scholar, 27Musgrove E.A. Hamilton J.A. Lee C.S. Sweeney K.J. Watts C.K. Sutherland R.L. Mol. Cell. Biol. 1993; 13: 3577-3587Crossref PubMed Scopus (277) Google Scholar, 28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 29Altucci L. Addeo R. Cicatiello L. Dauvois S. Parker M.G. Truss M. Beato M. Sica V. Bresciani F. Weisz A. Oncogene. 1996; 12: 2315-2324PubMed Google Scholar). Cyclin D1 also directly binds ERα and stimulates ligand-independent transactivation (30Zwijsen R.M. Wientjens E. Klompmaker R. van der Sman J. Bernards R. Michalides R.J. Cell. 1997; 88: 405-415Abstract Full Text Full Text PDF PubMed Scopus (613) Google Scholar, 31Neuman E. Ladha M.H. Lin N. Upton T.M. Miller S.J. DiRenzo J. Pestell R.G. Hinds P.W. Dowdy S.F. Brown M. Ewen M.E. Mol. Cell. Biol. 1997; 17: 5338-5347Crossref PubMed Scopus (346) Google Scholar, 32Zwijsen R.M. Buckle R.S. Hijmans E.M. Loomans C.J.M. Bernards R. Genes Dev. 1988; 12: 3488-3498Crossref Scopus (271) Google Scholar, 33McMahon C. Suthiphongchai T. DiRenzo J. Ewen M.E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5382-5387Crossref PubMed Scopus (151) Google Scholar), and interaction of cyclin D1 with p300/CRE-binding protein-associated factor (P/CAF) further stimulates ER/cyclin D1 action (34Sabbah M. Courilleau D. Mester J. Redeuilh G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11217-11222Crossref PubMed Scopus (283) Google Scholar). Sabbah and co-workers (34Sabbah M. Courilleau D. Mester J. Redeuilh G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11217-11222Crossref PubMed Scopus (283) Google Scholar) showed the E2-induced reporter gene activity in MCF-7 cells transfected with a construct containing the −944 to +139 region of the cyclin D1 promoter, and deletion analysis of this promoter in ER-negative HeLa cells identified a CRE at −66 as the E2-responsive region. They identified a cAMP-dependent protein kinase A (PKA)-independent pathway for activation of this CRE, and transactivation was linked to induction of c-jun and interaction of c-Jun-ATF-2 heterodimers at the CRE. This study reports that E2 also induces cyclin D1 gene expression in ER-positive ZR-75 breast cancer cells, and deletion analysis of the promoter confirmed that the downstream CRE was E2-inducible through activation of PKA. Moreover, further examination of the promoter shows that three GC-rich Sp1-binding sites at −142 to −110 were also E2-responsive indicating that transcriptional activation of cyclin D1 by E2 involves multiple proximal cis-elements including GC-rich sites that bind hERα·Sp1 complexes. RPMI 1620, phosphate-buffered saline, acetyl coenzyme A, E2, 100× antibiotic/antimycotic solution, cyclin D1 antibody, cholera toxin plus 3-isobutyl-1-methylxanthine (CT), DME/F-12, and chloroquine were purchased from Sigma. Luciferase and β-galactosidase enzyme assay systems were obtained from Promega Corp. (Madison, WI). Fetal bovine serum (FBS) was obtained from Intergen (Purchase, NY) and JRH Biosciences (Lenexa, KS). [γ-32P]ATP (3000 Ci/mmol), [γ-32P]CTP, and [14C]chloramphenicol (53 mCi/mmol) were purchased from PerkinElmer Life Sciences. Restriction enzymes (XhoI and KpnI) and T4-polynucleotide kinase were purchased from Promega Corp. All other chemicals and biochemicals were the highest quality available from commercial sources. CREB1, CREM, ATF1, and c-Jun rabbit polyclonal antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). FBS was stripped twice with 1 to 2 ratio of dextran-coated charcoal (0.01m Tris-HCl, 0.25% Nort A charcoal, 0.025% dextran, pH 8.0) at 45 °C for 45 min. ZR-75A cells were obtained from the American Type Culture Collection (Manassas, VA) and maintained in RPMI 1620 medium with phenol red and supplemented with 10% FBS plus 0.2× antibiotic/antimycotic solution, 0.22% sodium bicarbonate, 0.011% sodium pyruvate, 0.45% dextrose, and 0.24% HEPES. Cells were grown in 150-cm2 culture flasks in an air:carbon dioxide (95:5) atmosphere at 37 °C. For transfection studies with CREB-Gal4 chimeric protein and constructs containing cyclin D1 promoter (wild type and mutant) inserts, cells were seeded in 6-well Falcon plates (>70% confluent) in DME/F-12 media containing 2.5% charcoal-stripped serum (CSS) for 16–24 h prior to transfection. Nuclear extracts for gel mobility shift assays were also obtained from ZR-75 cells grown in DME/F-12 and 2.5% CSS for 16–24 h prior to treatment with 10 nm E2 for 1 h as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). Cells for chromatin immunoprecipitation (ChIP) and Northern and Western blot assays were grown in 100- or 150-mm culture plates in serum-free DME/F-12 for 3 days to arrest cells in G0/G1. Cells in fresh serum-free DME/F-12 media were then treated with Me2SO or 10 nm E2 for different times, harvested, and then processed for the different assays. The time-dependent activation of pCD1 and pCD4 by E2 was carried out in ZR-75 cells maintained in DME/F-12 and 0.1% CSS for 3 days to arrest cells in G0/G1. Cells were then transfected with pCD1 or pCD4 and treated with 10 nm E2 for different times as described previously in MCF-7 cells using a similar construct (34Sabbah M. Courilleau D. Mester J. Redeuilh G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11217-11222Crossref PubMed Scopus (283) Google Scholar). Cells were treated with 10 nm E2 or Me2SO for 1 h prior to harvesting by trypsinization. Cells were then extracted in high salt (0.5m potassium chloride), and nuclear extracts for use in gel mobility shift assays were obtained and stored in small aliquots at −80 °C as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). Whole cell extracts were obtained from cells cultured in serum-free DME/F-12 for 3 days as described above and then treated with Me2SO or 10 nm E2 (in Me2SO) for 2, 6, 12, 18, and 24 h, respectively. Whole cell lysates used in Western blot analysis were essentially obtained as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar) and stored at −80 °C until required. The cyclin D1 (pA3-Luc-CYCD) promoter plasmid constructs that contain the cyclin D1 regulatory regions (−1745/+130 and −63/+130) fused to a luciferase reporter gene were kindly provided by Dr. Richard G. Pestell (Albert Einstein College of Medicine, Bronx, NY). A human ERα expression plasmid was kindly provided by Dr. Ming-Jer Tsai (Baylor College of Medicine, Houston, TX). The human ERβ expression plasmid was provided by Drs. E. Enmark and J.-A. Gustafsson from the Center for Biotechnology, Novum (Huddinge, Sweden). ERα deletion constructs HE11C, HE15C, and HE19C were originally obtained from Dr. Pierre Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Illkirch, France) and inserted into vector pCDNA3 (Invitrogen, Carlsbad, CA) in this laboratory. pGal45 contained five tandem Gal4-responsive elements and was provided by Dr. Timothy Zacharewski (Michigan State University, East Lansing, MI). Expression plasmids for human Sp1 and Sp3 proteins were made by excising the Sp1 or Sp3 cDNAs from pPac Sp1 (generously supplied by Dr. Robert Tjian, University of California, Berkeley, CA) or pPacSp3 (kindly provided by Dr. Guntram Suske, Institute fur Molekularbiologie und Turmorforschung, Marburg, Germany). Sp1 protein was kindly provided by Matt Stoner. pPac-hERα was produced by removal of hERα cDNA from pcDNA3 byEcoRI digest and ligation into a modifiedDrosophila expression plasmid pPacUbx multiple cloning site. Before insertion into pPacUbx, oligonucleotide linkers were added to hERα cDNA to ensure proper frame and expression as described (35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). The mutant CREB inhibitory expression plasmid (KCREB) was kindly provided by Dr. Elaine Lewis (Oregon Health Science Center, Portland, OR). The wild-type CREB-Gal4 chimera contained amino acids 1–147 and 4–285 of the Gal4 and CREB proteins, respectively, and the construct in pRc/RSV was obtained from Dr. Richard Goodman (Oregon Health Science Center). The following oligonucleotides were prepared by the Gene Technologies Laboratory (Texas A & M University, College Station, TX) or Genosys/Sigma (Woodlands, TX). Mutations are underlined and the substituted bases are indicated in bold type: pCD5-(−172/−100), 5′-CTC TGC CCC TCG CTG CTC CCG GCG TTT GGC GCC CGC GCC CCC TCC CCC TGC GCC CGC CCC CGC CCC CCT CCC-3′; pCD5m1-(−172/−100), 5′-CTC TGC CCC TCG CTG CTC CCG GCG TTT GGC GCA AGC GCC CCC TCC CCC TGC GCAAGC CCA AGC CCC CCT CCC-3′; pCD5m2-(−172/−100), 5′-CTC TGC CCC TCG CTG CTC CCG GCG TTT GGC GCC CGC GCC CCC TCC CCC TGC GCA AGC CCA AGC CCC CCT CCC-3′; pCD5m3-(−172/−100), 5′-CGC TCC CGG CGT TTG GATCCC GCG CCC CCT CCC CCT GCG CCC GCC CCC GCC CCC CTC CCC-3′; pCD6-(−168/−122), 5′-TGC CCC TCG CTG CTC CCG GCG TTT GGC GCC CGC GCC CCC TCC CCC TGC G-3′; pCD6m-(−168/−122), 5′-TGC CCC TCG CTG CTC CCG GCG TTT GGC GCA AGC GCC CCC TCC CCC TGC G-3′; pCD7-(−140/−100), 5′-CCG CGC CCC CTC CCC CTG CGC CCGCCC CCG CCC CCC TCC CG-3′; pCDO1-(−130/−100), 5′-CCC CCT GCG CCC GCC CCC GCC CCC CTC CCG-3′; pCDO2-(−86/−51), 5′-TCT TTG CTT AAC AAC CAG TAA CGT CAC ACG GCA TAC A-3′; ERE (consensus), 5′-GTC CAA AGT CAG GTC ACA GTG ACC TGA TCA AAG TT-3′; ERE (mutant), 5′-GTC CAA AGT CAG GAC ACA GTG TCC TGA TCA AAG TT-3′; CRE (consensus), 5′-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3′; CRE (mutant), 5′-AGA GAT TGC CTG TGG TCA GAG AGC TAG-3′; AP1, 5′-CGC TTG ATG ACT CAG CCG GAA-3′; Sp1 (consensus), 5′-AGC TTA TTC GAT CGG GGC GGG GCG AGC G-3′; and Sp1m (mutant), 5′-AGC TTA TTC CGA AGC GGG GCG AGC G-3′. The pGL2 luciferase reporter plasmid (Promega Corp.) was modified with the insertion of TATA sequence into its polylinker site immediately upstream of the luciferase expression gene. Cyclin D1 promoter fragments (−174 to −100, −164 to −120, −145 to −100, and −107 to +100) were synthesized or amplified as double-stranded DNA and inserted into the vector betweenKpnI and XhoI polylinker sites. All ligation products were transformed into competent Escherichia colicells. Plasmids were isolated, and clones were confirmed by restriction enzyme mapping and DNA sequencing. High quality plasmids for transfection were prepared using Qiagen Plasmid Mega Kit. Oligonucleotides were synthesized, purified, and annealed, and 5 pmol of specific oligonucleotides were 32P-labeled at the 5′-end using T4 polynucleotide kinase and [γ-32P]ATP. Gel mobility shift and supershift assays were performed as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar), and the amount/concentrations of nuclear extracts or proteins are indicated directly in the figures or legends. Cells were cultured in DME/F-12 (serum-free) for 3 days and then treated with Me2SO or E2 (for 30 min, 1, 2, 6, 12, and 24 h). RNA was extracted using an RNA extraction kit from Tel-Test (Friendswood, TX), and Northern blot analysis was performed as described previously (35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). The 874-base pair cyclin D1 cDNA used for Northern blot analysis was obtained using the following primers: sense primer, AGGAAGAGCCCCAGCCATGGGAA; antisense primer, TGTGCAAGCCAGGTCCACCT. β-Tubulin mRNA was used as an internal control to standardize cyclin D1 mRNA levels. Aliquots of whole cell extracts (100 µg) for Western blot analysis were separated on 10% SDS-polyacrylamide gel (35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar) using cyclin D1 rabbit IgG obtained from Sigma. Protein concentrations were determined by the method of Bradford (36Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211941) Google Scholar). ZR-75 cells were transiently transfected for 6–18 h by calcium phosphate coprecipitation with 2–4 µg of reporter plasmid and 2 µg of pcDNA3.1/His/LacZβ-galactosidase as a control vector. The reporter plasmids were cotransfected 1:0.33 to 1:0.5 with ERα or ERα variants expression vectors. Luciferase activities in the various treatment groups were performed on 30 µl of cell extract using the luciferase assay system, and results were normalized to β-galactosidase enzyme activity as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). ZR-75 or MCF-7 breast cancer cells were grown in 150-mm tissue culture plates to >70% confluency and treated with 10 nm E2 for various times. Formaldehyde was then added to the medium to give a 1% solution and incubated with shaking for 10 min at 20 °C. After addition of glycine (0.125 m) and incubation for 10 min, the media were removed; cells were washed with phosphate-buffered saline and 1 mm phenylmethylsulfonyl fluoride, scraped, and collected by centrifugation. Cells were then resuspended in swell buffer (85 mm KCl, 0.5% Nonidet P-40, 1 mmphenylmethylsulfonyl fluoride, 5 µg/ml leupeptin and aprotinin at pH 8.0) and homogenized. Nuclei were isolated by centrifugation at 1500 × g for 30 s, then resuspended in sonication buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl, pH 8.1), and sonicated for 45–60 s to obtain chromatin with appropriate fragment lengths (500–1000 base pair). This extract was then centrifuged at 15,000 × g for 10 min at 0 °C, aliquoted, and stored at −70 °C until used. The cross-linked chromatin preparations were diluted in buffer (1% Triton X-100, 100 mm NaCl, 0.5% SDS, 5 mm EDTA, and Tris-HCl, pH 8.1), and 20 µl of Ultralink protein A or G or A/G beads (Pierce) were added per 100 µl of chromatin and incubated for 4 h at 4 °C. A 100-µl aliquot was saved and used as the 100% input control. Salmon sperm DNA, specific antibodies, and 20 µl of Ultralink beads were added, and the mixture was incubated for 6 h at 4 °C. Samples were then centrifuged; beads were resuspended in dialysis buffer, vortexed for 5 min at 20 °C, and centrifuged at 15,000 × g for 10 s. Beads were then resuspended in immunoprecipitation buffer (11 mm Tris-HCl, 500 mm LiCl, 1% Nonidet P-40, 1% deoxycholic acid, pH 8.0) and vortexed for 5 min at 20 °C. The procedures with the dialysis and immunoprecipitation buffers were repeated (3–4 times), and beads were then resuspended in elution buffer (50 nmNaHCO3, 1% SDS, 1.5 µg/m sonicated salmon sperm DNA), vortexed, and incubated at 65 °C for 15 min. Supernatants were then isolated by centrifugation and incubated at 65 °C for 6 h to reverse protein-DNA cross-links. Wizard PCR kits (Promega) were used for additional DNA clean up, and PCR was used to detect the presence of promoter regions immunoprecipitated with commercially available ERα or Sp1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). The following primers were used for PCR analysis of immunoprecipitated promoter regions: cathepsin D Fw-(−294), 5′-TCC AGA CAT CCT CTC TGG AA-3′, and Rv-(−54), 5′-GGA GCG GAG GGT CCA TTC-3′; cathepsin D (exon 2) Fw-(+2469), 5′-TGC ACA AGT TCA CGT CCA TC-3′, and Rv-(+2615) 5′-TGT AGT TCT TGA GCA CCT CG-3′; cyclin D1 Fw-(−204), 5′-GGC GAT TTG CAT TTC TAT GA-3′, and Rv-(+32) 5′-CAA AAC TCC CCT GTA GTC CGT-3′. Cells were grown at room temperature in T-150 flasks in Schneider's medium (Life Technologies, Inc.) supplemented with 5% FBS (heat-inactivated at 55 °C for 30 min) and 0.5× antibiotic/antimycotic solution. Cells were grown in 12-well plates, and luciferase activities in various treatment groups were determined and normalized to β-galactosidase activity (internal control) as described previously (28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 35Dong L. Wang W. Wang F. Stoner M. Reed J.C. Harigai M. Kladde M. Vyhlidal C. Safe S. J. Biol. Chem. 1999; 174: 32099-32107Abstract Full Text Full Text PDF Scopus (237) Google Scholar). Results of transient transfection studies are presented as means ± S.D. for at least three separate experiments for each treatment group. All other experiments were carried out at least two times to confirm a consistent pattern of responses. Statistical differences between treatment groups were determined by analysis of variance and Scheffe's test. Treatment of ZR-75 cells with 10 nm E2 resulted in the induction of cyclin D1 mRNA levels within 30 min, and elevated expression subsequently decreased with time (Fig.1 A). These results are comparable to those reported previously in other ER-positive breast cancer cell lines (24Foster J.S. Wimalasena J. Mol. Endocrinol. 1996; 10: 488-498Crossref PubMed Scopus (203) Google Scholar, 25Prall O.W.J. Sarcevic B. Musgrove E.A. Watts C.K.W. Sutherland R.L. J. Biol. Chem. 1997; 272: 10882-10894Abstract Full Text Full Text PDF PubMed Scopus (386) Google Scholar, 26Planas-Silva M.D. Weinberg R.A. Mol. Cell. Biol. 1997; 17: 4059-4069Crossref PubMed Scopus (233) Google Scholar, 27Musgrove E.A. Hamilton J.A. Lee C.S. Sweeney K.J. Watts C.K. Sutherland R.L. Mol. Cell. Biol. 1993; 13: 3577-3587Crossref PubMed Scopus (277) Google Scholar, 28Wang W. Smith R. Safe S. Arch. Biochem. Biophys. 1998; 356: 239-248Crossref PubMed Scopus (67) Google Scholar, 29Altucci L. Addeo R. Cicatiello L. Dauvois S. Parker M.G. Truss M. Beato M. Sica V. Bresciani F. Weisz A. Oncogene. 1996; 12: 2315-2324PubMed Google Scholar). In addition, E2 also induces cyclin D1 protein (Fig. 1 B). Initial transient transfection studies with pCD1-(−1745 to +130) in ZR-75 cells showed that treatment with 50 nm E2 alone resulted in a 2-fold increase in reporter gene activity (Fig. 2 A). Transfection studies in ER-positive breast cancer cells with many E2-responsive constructs containing consensus and nonconsensus EREs, GC-rich, or AP1 sites show that hormone-induced transactivation is observed only after cotransfection with an ER expression plasmid (37Augereau P. Miralles F. Cavailles V. Gaudelet C. Parker M. Rochefort H. Mol. Endocrinol. 1994; 8: 693-703Crossref PubMed Scopus (108) Google Scholar, 38Lech J.J. Lewis S.K. Ren L. Fundam. Appl. Toxicol. 1996; 30: 229-232Crossref PubMed Scopus (143) Google Scholar, 39Berry M. Nunez A.-M. Chambon P. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1218-1222Crossref PubMed Scopus (294) Google Scholar, 40Weisz A. Rosales R. Nucleic Acids Res. 1990; 18: 5097-5106Crossref PubMed Scopus (267) Google Scholar, 41Gillesby B. Santostefano M. Porter W. Wu Z.F. Safe S. Zacharewski T. Biochemistry. 1997; 36: 6080-6089Crossref PubMed Scopus (127) Google Scholar, 42Savouret J.F. Bailly A. Misrahi M. Rarch C. Redeuilh G. Chauchereau A. Milgrom E. EMBO J. 1991; 10: 1875-1883Crossref PubMed Scopus (205) Google Scholar, 43Cavailles V. Augereau P. Rochefort H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 203-207Crossref PubMed Scopus (142) Google Scholar, 44Cavailles V. Garcia M. Rochefort H. Mol. Endocrinol. 1989; 3: 552-558Crossref PubMed Scopus (163) Google Scholar, 45Zacharewski T.R. Bondy K.L. McDonell P. Wu Z.F. Cancer Res. 1994; 54: 2707-2713PubMed Google Scholar, 46Krishnan V. Wang X. Safe S. J. Biol. Chem. 1994; 269: 15912-15917Abstract Full Text PDF PubMed Google Scholar, 47Porter W. Wang F. Wang W. Duan R. Safe S. Mol. Endocrinol. 1996; 10: 1371-1378PubMed Google Scholar, 48Sathya G. Li W. Klinge C.M. Anolik J.H. Hilf R. Bambara R.A. Mol. Endocrinol. 1997; 11: 1994-2003Crossref PubMed Google Scholar, 49Paech K. Webb P. Kuiper G.G. Nilsson S. Gustafsson J. Kushner P.J. Scanlan T.S. Science. 1997; 277: 1508-1510Crossref PubMed Scopus (2055) Google Scholar, 50Webb P. Lopez G.N. Uht R.M. Kushner P.J. Mol. Endocrinol. 1995; 9: 443-456Crossref PubMed Google Scholar, 51Porter W. Saville B. Hoivik D. Safe S. Mol. Endocrinol. 1997; 11: 1569-1580Crossref PubMed Scopus (324) Google Scholar, 52Wang F. Hoivik D. Pollenz R. Safe S. Nucleic Acids Res. 1998; 26: 3044-3052Crossref PubMed Scopus (94) Google Scholar, 53Wang W. Dong L. Saville B. Safe S. Mol. Endocrinol. 1999; 13: 1373-1387Crossref PubMed Google Scholar, 54Xie W. Duan R. Safe S. Endocrinology. 1999; 140: 219-227Crossref PubMed Scopus (68) Google Scholar, 55Sun G. Porter W. Safe S. Mol. Endocrinol. 1998; 12: 882-890Crossref PubMed Google Scholar, 56Qin C. Singh P. Safe S. Endocrinology. 1999; 140: 2501-2508Crossref PubMed Scopus (103) Google Scholar, 57Duan R. Porter W. Safe S. Endocrinology. 1998; 139: 1981-1990Crossref PubMed Google Scholar, 58Xie W. Duan R. Chen I. Samudio I. Safe S. Endocrinology. 2000; 141: 2439-2449Crossref PubMed Scopus (30) Google Scholar, 59Samudio I. Vyhlidal C. Wang F. Stoner M. Chen I. Kladde M. Barhoumi R. Burghardt R. Safe S. Endocrinology. 2001; 142: 1000-1008Crossref PubMed Scopus (31) Google Scholar, 60Saville B. Wormke M. Wang F. Nguyen T. Enmark E. Kuiper G. Gustafsson J.-A. Safe S. J. Biol. Chem. 2000; 275: 5379-5387Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar). This is due to the high copy numbers of plasmids in transfected cells and limiting levels of endogenous ER (37Augereau P. Miralles F. Cavailles V. Gaudelet C. Parker M. Rochefort H. Mol. Endocrinol. 1994; 8: 693-703Crossref PubMed Scopus (108) Google Scholar). The results summarized in Fig. 2 A show that E2 induces luciferase activity in ZR-75 cells transfected with pCD1 and cotransfected with ERα, but not ERβ, expression plasmid. Deletion analysis of the cyclin D1 gene promoter showed that E2-induced reporter gene activity in ZR-75 cells transfected with pCD1, pCD2, pCD3, and pCD4 (Fig. 2 B), and it was evident that deletion of the −1745 to −163 region of the promoter did not affect E2 responsiveness. Sabbah and co-workers reported previously (34Sabbah M. Courilleau D. Mester J. Redeuilh G. Proc. Natl. Acad. Sci. U. S. A. 19

Referência(s)