Chronic Ultraviolet B Irradiation Causes Loss of Hyaluronic Acid from Mouse Dermis Because of Down-Regulation of Hyaluronic Acid Synthases
2007; Elsevier BV; Volume: 171; Issue: 5 Linguagem: Inglês
10.2353/ajpath.2007.070136
ISSN1525-2191
AutoresGuang Dai, Till Freudenberger, Petra Zipper, A. Melchior, Susanne Grether‐Beck, Berit Rabausch, Jens de Groot, Sören Twarock, Helmut Hanenberg, Bernhard Homey, Jean Krutmann, J. Reifenberger, Jens W. Fischer,
Tópico(s)Skin Protection and Aging
ResumoRemodeling of the dermal extracellular matrix occurs during photoaging. Here, the effect of repetitive UVB irradiation on dermal hyaluronic acid (HA) was examined. C57/BL6 mice were chronically (182 days) irradiated with UVB, and consecutive skin biopsies were collected during the irradiation period and afterward (300 and 400 days of age). UVB caused marked loss of HA from the papillary dermis and down-regulation of HA synthase 1 (HAS1), HAS2, and HAS3 mRNA expression. In contrast, hyaluronidases (HYAL) 1, HYAL2, and HA receptor CD44 were unchanged. Furthermore, transforming growth factor β-1 (TGF-β1) and TGF-β1-receptor II expression were decreased in UVB-irradiated biopsies, and TGF-β1 strongly induced HAS1 and HAS2 expression in cultured dermal fibroblasts. Therefore, TGF-β1 might be one factor involved in UVB-induced down-regulation of HAS enzymes. In addition, total cell number and the percentage of proliferating fibroblasts in the papillary dermis of UVB-irradiated mice were decreased. Down-regulation of HAS2 by lentiviral overexpression of short hairpin RNA in vitro caused inhibition of HA synthesis, DNA synthesis, and migration of dermal fibroblasts. In conclusion, chronic UVB irradiation induces loss of HA from the dermis, thereby contributing to the quiescent phenotype of dermal fibroblasts. Remodeling of the dermal extracellular matrix occurs during photoaging. Here, the effect of repetitive UVB irradiation on dermal hyaluronic acid (HA) was examined. C57/BL6 mice were chronically (182 days) irradiated with UVB, and consecutive skin biopsies were collected during the irradiation period and afterward (300 and 400 days of age). UVB caused marked loss of HA from the papillary dermis and down-regulation of HA synthase 1 (HAS1), HAS2, and HAS3 mRNA expression. In contrast, hyaluronidases (HYAL) 1, HYAL2, and HA receptor CD44 were unchanged. Furthermore, transforming growth factor β-1 (TGF-β1) and TGF-β1-receptor II expression were decreased in UVB-irradiated biopsies, and TGF-β1 strongly induced HAS1 and HAS2 expression in cultured dermal fibroblasts. Therefore, TGF-β1 might be one factor involved in UVB-induced down-regulation of HAS enzymes. In addition, total cell number and the percentage of proliferating fibroblasts in the papillary dermis of UVB-irradiated mice were decreased. Down-regulation of HAS2 by lentiviral overexpression of short hairpin RNA in vitro caused inhibition of HA synthesis, DNA synthesis, and migration of dermal fibroblasts. In conclusion, chronic UVB irradiation induces loss of HA from the dermis, thereby contributing to the quiescent phenotype of dermal fibroblasts. Solar UV irradiation of the skin causes sunburn, transient inflammation, cancer, and premature skin aging.1Cooper KD Oberhelman L Hamilton TA Baadsgaard O Terhune M LeVee G Anderson T Koren H UV exposure reduces immunization rates and promotes tolerance to epicutaneous antigens in humans: relationship to dose, CD1a−DR+ epidermal macrophage induction, and Langerhans cell depletion.Proc Natl Acad Sci USA. 1992; 89: 8497-8501Crossref PubMed Scopus (347) Google Scholar Photoaging is the most common form of skin damage caused by chronic, repetitive sun exposure.2Fisher GJ Wang ZQ Datta SC Varani J Kang S Voorhees JJ Pathophysiology of premature skin aging induced by ultraviolet light.N Engl J Med. 1997; 337: 1419-1428Crossref PubMed Scopus (1135) Google Scholar The long-term exposure to solar UV irradiation induces damage to the dermal connective tissue and the extracellular matrix (ECM), which in turn leads to the aged appearance of photodamaged skin. Hallmark of this UV-induced ECM remodeling is the degradation of collagen and elastin through the UVB-induced activation of matrix metalloproteinases and decreased de novo synthesis of collagen. The mechanisms of UVB-induced matrix metalloproteinase activation3Fisher GJ Datta SC Talwar HS Wang ZQ Varani J Kang S Voorhees JJ Molecular basis of sun-induced premature skin ageing and retinoid antagonism.Nature. 1996; 379: 335-339Crossref PubMed Scopus (1172) Google Scholar and inhibition of collagen synthesis have been studied in detail.2Fisher GJ Wang ZQ Datta SC Varani J Kang S Voorhees JJ Pathophysiology of premature skin aging induced by ultraviolet light.N Engl J Med. 1997; 337: 1419-1428Crossref PubMed Scopus (1135) Google Scholar In contrast the effect of UVB on hyaluronic acid (HA), another key component of the dermal ECM, is much less understood, and the underlying mechanisms are primarily unknown. HA is a linear polymer composed of repeating disaccharides (d-glucuronic acid-β-1,3-N-acetylglucosamine-β-1,4-) and assembled from the respective activated nucleotide sugars (UDP-glucuronic acid, UDP-N-acetylglucosamine) at the inner plasma membrane by HA synthases (HAS). Three different HAS isoforms are known that reside in the plasma membrane and extrude the growing HA polymer into the extracellular space.4Itano N Kimata K Molecular cloning of human hyaluronan synthase.Biochem Biophys Res Commun. 1996; 222: 816-820Crossref PubMed Scopus (103) Google Scholar HAS1 and HAS2 produce high molecular mass HA (2 to 4 × 106 Da), whereas HAS3 synthesizes smaller HA (0.4 to 2.5 × 105 Da).5Itano N Sawai T Yoshida M Lenas P Yamada Y Imagawa M Shinomura T Hamaguchi M Yoshida Y Ohnuki Y Miyauchi S Spicer AP McDonald JA Kimata K Three isoforms of mammalian hyaluronan synthases have distinct enzymatic properties.J Biol Chem. 1999; 274: 25085-25092Crossref PubMed Scopus (693) Google Scholar The variation of the MW is the only modification of HA because O- or N-sulfations do not occur. HA is an agonist of CD44 and RHAMM (receptor of HA-mediated motility), which enables HA to initiate specific signaling events.6Toole BP Wight TN Tammi MI Hyaluronan-cell interactions in cancer and vascular disease.J Biol Chem. 2002; 277: 4593-4596Crossref PubMed Scopus (424) Google Scholar This receptor signaling and the formation of pericellular HA coats supports proliferation and migration of a variety of cell types including skin fibroblasts.7Yoneda M Yamagata M Suzuki S Kimata K Hyaluronic acid modulates proliferation of mouse dermal fibroblasts in culture.J Cell Sci. 1988; 90: 265-273Crossref PubMed Google Scholar In addition, antiapoptotic effects of HA have been demonstrated. After fragmentation of HA through limited cleavage by hyaluronidase-1 (HYAL-1) and HYAL-2, low and intermediate MW HA are generated.8Stern R Hyaluronan catabolism: a new metabolic pathway.Eur J Cell Biol. 2004; 83: 317-325Crossref PubMed Scopus (305) Google Scholar HA fragments in turn activate Toll-like receptors 2 and 4 and thereby modulate inflammatory responses.9Termeer C Benedix F Sleeman J Fieber C Voith U Ahrens T Miyake K Freudenberg M Galanos C Simon JC Oligosaccharides of hyaluronan activate dendritic cells via toll-like receptor 4.J Exp Med. 2002; 195: 99-111Crossref PubMed Scopus (1145) Google Scholar, 10Jiang D Liang J Fan J Yu S Chen S Luo Y Prestwich GD Mascarenhas MM Garg HG Quinn DA Homer RJ Goldstein DR Bucala R Lee PJ Medzhitov R Noble PW Regulation of lung injury and repair by Toll-like receptors and hyaluronan.Nat Med. 2005; 11: 1173-1179Crossref PubMed Scopus (1120) Google Scholar In skin, HA also has important structural functions that are related to the unique molecular features of HA. The high polymer length and polyanionic charge enable HA to bind water, which in turn supports volume expansion and turgidity of skin, the diffusion of metabolites and nutrients and the elasticity of the skin.11Manuskiatti W Maibach HI Hyaluronic acid and skin: wound healing and aging.Int J Dermatol. 1996; 35: 539-544Crossref PubMed Scopus (138) Google Scholar Taken together, HA confers functions through the initiation of receptor signaling but also creates an extracellular microenvironment that supports the typical physicochemical and mechanical properties of the skin. Notably, the regulation and function of HAS isoforms have not been determined during skin aging in vivo or in dermal fibroblasts in vitro. In the epidermis, HA was shown to be induced during wound healing and regeneration.12Tammi R Pasonen-Seppanen S Kolehmainen E Tammi M Hyaluronan synthase induction and hyaluronan accumulation in mouse epidermis following skin injury.J Invest Dermatol. 2005; 124: 898-905Crossref PubMed Scopus (121) Google Scholar In contrast, in the dermis the regulatory pathways of HA are much less understood. Interestingly, several conditions that accelerate skin aging such as estrogen deficiency13Kanda N Watanabe S Regulatory roles of sex hormones in cutaneous biology and immunology.J Dermatol Sci. 2005; 38: 1-7Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar, 14Sator PG Schmidt JB Rabe T Zouboulis CC Skin aging and sex hormones in women—clinical perspectives for intervention by hormone replacement therapy.Exp Dermatol. 2004; 13: 36-40Crossref PubMed Google Scholar are associated with loss of HA from the dermis, and treatments that counteract actinic skin aging such as retinoic acid increase dermal HA.15Saavalainen K Pasonen-Seppanen S Dunlop TW Tammi R Tammi MI Carlberg C The human hyaluronan synthase 2 gene is a primary retinoic acid and epidermal growth factor responding gene.J Biol Chem. 2005; 280: 14636-14644Crossref PubMed Scopus (91) Google Scholar, 16Margelin D Medaisko C Lombard D Picard J Fourtanier A Hyaluronic acid and dermatan sulfate are selectively stimulated by retinoic acid in irradiated and nonirradiated hairless mouse skin.J Invest Dermatol. 1996; 106: 505-509Crossref PubMed Scopus (46) Google Scholar These results strongly suggest that dermal HA plays an important role during photoaging. In vivo ∼5% of UVB irradiation is thought to reach the upper dermis.17Bruls WA van Weelden H van der Leun JC Transmission of UV-radiation through human epidermal layers as a factor influencing the minimal erythema dose.Photochem Photobiol. 1984; 39: 63-67Crossref PubMed Scopus (71) Google Scholar Therefore both direct effects of UVB on fibroblasts in the papillary dermis and indirect effects through UVB-mediated responses in epidermal keratinocytes such as changes in gene expression, growth factor, and cytokine release must be considered.18Averbeck M Beilharz S Bauer M Gebhardt C Hartmann A Hochleitner K Kauer F Voith U Simon JC Termeer C In situ profiling and quantification of cytokines released during ultraviolet B-induced inflammation by combining dermal microdialysis and protein microarrays.Exp Dermatol. 2006; 15: 447-454Crossref PubMed Scopus (53) Google Scholar In addition, acute and chronic consequences of UVB irradiation must be distinguished. Acutely, UVB causes sunburn and transient inflammatory reactions.19Matsumura Y Ananthaswamy HN Short-term and long-term cellular and molecular events following UV irradiation of skin: implications for molecular medicine.Expert Rev Mol Med. 2002; 2002: 1-22Google Scholar In the long term, UVB irradiation causes remodeling of the skin, ultimately leading to the symptoms of photoaging such as wrinkling, decreased turgidity and elasticity, pigmentation, and neovessel formation. The aim of the present study was to elucidate further the effects of UVB on dermal HA, the underlying mechanisms, and the function of HA in dermal fibroblasts. In particular, the effect of chronic repetitive UVB irradiation on dermal HA was analyzed. For this purpose adult C57/BL6 mice were irradiated with UVB throughout a period of 182 days and the subsequent changes in HA content, HAS isoenzyme expression, and HYAL expression were determined. The function of HAS2 in dermal fibroblasts in vitro was analyzed by lentiviral expression of shRNA targeting HAS2. The present data show that chronic UVB induces a progressive loss of HA from the upper dermis because of transcriptional down-regulation of all three HAS isoforms. In addition, loss of HA and HAS2 are associated with a quiescent phenotype of dermal fibroblasts. CL57/BL6 mice were housed according to standard procedures. Beginning at the age of 42 days, the backs of all mice were shaved once a week. The animals were divided into a control group that was shaved but not irradiated. The second group was irradiated with UVB light three times per week at a dose of 210 mJ/cm2 [∼three times minimal erythema dose (MED)] throughout a period of 182 days.20Aszterbaum M Epstein J Oro A Douglas V LeBoit PE Scott MP Epstein Jr, EH Ultraviolet and ionizing radiation enhance the growth of BCCs and trichoblastomas in patched heterozygous knockout mice.Nat Med. 1999; 5: 1285-1291Crossref PubMed Scopus (341) Google Scholar The age of the mice at the end of the irradiation protocol was 224 days (32 weeks). The experimental design is illustrated in Figure 1A. The UVB radiation was provided by UV lamps with fluorescent bulbs (280 to 320 nm with a peak at 313 nm TL 20W/12; Philips, Eindhoven, The Netherlands). The light intensity was determined by means of a UV meter (Waldmann, Villingen-Schwennigen, Germany). All animal experiments have been approved by the local ethical committee for animal experiments. Skin biopsies were obtained from control and UVB-irradiated animals during the UVB irradiation protocol at 150 days and after the UVB irradiation at 300 and 400 days of age. Mice were anesthetized with an intraperitoneal injection of Ketanest/Rompun, (Pfizer Pharma Gmblt, Karlsrüe, Germany, and Bayer, Leuerküsen, Germany, respectively) and biopsies from the dorsal skin of 1 to 2 cm2 in size were taken. Half of the tissue was subsequently snap frozen in liquid nitrogen for preparation of total RNA and extraction of HA. The other half was immersed in formalin and embedded in paraffin according to standard procedures. Sections of 3 μm in thickness were subsequently cut and deparaffinized by standard methods. HA staining was performed as described previously.21Ripellino JA Klinger MM Margolis RU Margolis RK The hyaluronic acid binding region as a specific probe for the localization of hyaluronic acid in tissue sections.J Histochem Cytochem. 1985; 33: 1060-1066Crossref PubMed Scopus (177) Google Scholar In brief, deparaffinized sections were blocked with 10% fetal calf serum and 1% bovine serum albumin for 1 hour at room temperature. The slides were subsequently incubated with biotinylated HAbP (2 μg/ml; Seikagaku, Tokyo, Japan) at 4°C overnight. After three washes with phosphate-buffered saline (PBS), the sections were incubated with avidin-biotin peroxidase (Sigma, St. Louis, MO), and the color was developed with 3,3′-diaminobenzidine (DAB; Sigma) containing 0.03% H2O2. Nuclei were stained with hemalaun solution (Merck, Darmstadt, Germany). As a negative control, sections were incubated with Streptomyces hyaluronidase (ICN, Costa Mesa, CA) at a concentration of 2 U/ml (1 hour, 37°C) before HA staining. Proliferating cell nuclear antigen (PCNA) was stained as a marker for proliferation after antigen retrieval (25 minutes, 10 mmol/L citric acid, pH 6.0, and 0.05% Tween 20). The monoclonal anti-mouse antibody against PCNA (1:1600; Biozol, Eching, Germany) was detected by sheep anti-mouse Cy3-conjugate (1:100, Sigma). In addition, the proliferation marker Ki67 was analyzed using rabbit anti-mouse antibody (1:25; Novus Biologicals, Littleton, CO) and sheep anti-rabbit IgG (Cy3-conjugate, 1:50; Sigma-Aldrich, Steinheim, Germany). For determination of the proliferative index, nuclear staining (blue, Hoechst 33324) was turned into green by analySIS software (Soft Imaging System, Münster, Germany). Total cell counts and PCNA-positive cells were subsequently counted in the same area of the papillary dermis that was also used for quantitation of HA (see below). This area of interest was marked using the ROI brush tool of the Freeware Image J (National Institutes of Health, Bethesda, MD). The number of Hoechst 33324-stained nuclei was set as total cell number. Only those cells that showed a clear overlay (yellow) of the proliferation marker PCNA or Ki-67 stained in red and the nuclei shown in green (originally blue) were assumed to represent proliferating cells. The proliferative index was expressed by the percentage of PCNA-positive or Ki67-positive nuclei. Fibroblasts were detected by the use of polyclonal rabbit anti-vimentin antibody (1:100; Novus Biologicals) and goat anti-rabbit IgG fluorescein isothiocyanate (1:200; Santa Cruz Biotechnology, Santa Cruz, CA). Brightfield images were captured of HA affinity histochemistry using a BX-50 microscope (Olympus, Hamburg, Germany) at ×100 magnification and a ColorView II camera (Soft Imaging System). AnalySIS 3.2 software (Soft Imaging System) allowed computer control of image acquisition. For quantification of HA affinity histochemistry, ImageJ 1.37v software (National Institutes of Health) was used to convert bright-field (24-bit) images of DAB stainings to 8-bit images and for all further image processing. DAB-positive and -negative images were used to determine the threshold. Threshold values were chosen that maximize selection of the DAB-positive tissue while minimizing background interference. The resulting threshold values were held constant in the analysis of all images. To quantify the HA content in the DAB-stained sections, the staining parameters percent area and mean intensity were multiplied and normalized. Percent area is defined as the area of the image classified as DAB-stained, divided by the total image area. The mean intensity corresponds to the mean gray scale intensity. The measurements were performed within the first 35 μm below the epidermis, which contains the highest amount of HA. Per skin section the quantification of three randomly selected areas (×100 magnification) were averaged. This analysis was performed two times per biopsy using independently stained sections, and the average of the two sections was used for further calculations. In Figure 1, the HA content is expressed as percentage of nonirradiated control biopsies at 150 days. Dermal HA was extracted from biopsies after modification of published procedures.22Calabro A Hascall VC Midura RJ Adaptation of FACE methodology for microanalysis of total hyaluronan and chondroitin sulfate composition from cartilage.Glycobiology. 2000; 10: 283-293Crossref PubMed Scopus (157) Google Scholar, 23Papakonstantinou E Roth M Block LH Mirtsou-Fidani V Argiriadis P Karakiulakis G The differential distribution of hyaluronic acid in the layers of human atheromatic aortas is associated with vascular smooth muscle cell proliferation and migration.Atherosclerosis. 1998; 138: 79-89Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar In brief, skin biopsies were lyophilized and dry weight was determined. Subsequently, samples were digested by pronase (protease from Streptomyces griseus, 6 mg/ml in 100 mmol/L Tris-HCl, pH 8, 1 mmol/L CaCl2, and 1500 U/ml heparin, 60°C, 24 hours; Sigma-Aldrich). After ethanol precipitation (12 hours, −20°C) HA was recovered by centrifugation (10,000 × g at 4°C, 15 minutes), washed, lyophilized, and dissolved in distilled water. Samples were then diluted 1:10,000 and HA concentration determined by HA enzyme-linked immunosorbent assay (Corgenix, Peterborough, UK) and normalized to dry weight. In the supernatants of cultured human skin fibroblasts, HA concentration was determined by the HA enzyme-linked immunosorbent assay (Corgenix) 5 days after lentiviral infection and was calculated as ratio of HA and total cellular protein. Total RNA was isolated using RNeasy total RNA kits (Qiagen, Hilden, Germany). The RNA concentration was determined via photometric measurement at 260/280. Aliquots of total RNA (100 ng) were applied for cDNA synthesis using SuperscriptIII first-strand synthesis system for reverse transcriptase-polymerase chain reaction (RT-PCR) (Invitrogen, Karlsruhe, Germany). For analysis of mouse HAS1 to HAS3, transforming growth factor (TGF)-β1, Tβ1R-II, HYAL1, HYAL2, CD44, biglycan (BGN), and GAPDH, the primer sequences are given in Table 1. For analysis of mRNA expression in human fibroblasts, a specific primer pair was designed by Primer Express 2.0 software (Applied Biosystems, Darmstadt, Germany) based on the cDNA sequence published as indicated. The following primer pairs were used: 18SrRNA: sequence of McCallum and Maden24McCallum FS Maden BE Human 18 S ribosomal RNA sequence inferred from DNA sequence. Variations in 18 S sequences and secondary modification patterns between vertebrates.Biochem J. 1985; 232: 725-733Crossref PubMed Scopus (99) Google Scholar; HAS-1 primer: sequence of Shyjan and colleagues25Shyjan AM Heldin P Butcher EC Yoshino T Briskin MJ Functional cloning of the cDNA for a human hyaluronan synthase.J Biol Chem. 1996; 271: 23395-23399Crossref PubMed Scopus (148) Google Scholar; HAS-2 primer: sequence of Watanabe and Yamaguchi26Watanabe K Yamaguchi Y Molecular identification of a putative human hyaluronan synthase.J Biol Chem. 1996; 271: 22945-22948Crossref PubMed Scopus (185) Google Scholar; HAS-3 primer: sequence of Liu and colleagues27Liu N Gao F Han Z Xu X Underhill CB Zhang L Hyaluronan synthase 3 overexpression promotes the growth of TSU prostate cancer cells.Cancer Res. 2001; 61: 5207-5214PubMed Google Scholar; matrix metalloproteinase-1 primer: sequence of Whitham and colleagues.28Whitham SE Murphy G Angel P Rahmsdorf HJ Smith BJ Lyons A Harris TJ Reynolds JJ Herrlich P Docherty AJ Comparison of human stromelysin and collagenase by cloning and sequence analysis.Biochem J. 1986; 240: 913-916Crossref PubMed Scopus (326) Google Scholar Five independent experiments were performed with three determinations each, and the mean value of these was calculated. The PCR reactions were performed on an Opticon 1 (MJ Research, Waltham, MA) using SYBR Green PCR Master Mix (Applied Biosystems). For comparison of relative expression in real-time PCR control cells and treated cells, the 2[−ΔΔC(T)] method was used.Table 1Primer Sequences Used for Quantification of Gene ExpressionGenePrimer sequenceMouse HAS15′-CTATGCTACCAAGTATACCTCG-3′5′-TCTCGGAAGTAAGATTTGGAC-3′Mouse HAS25′-CGGTCGTCTCAAATTCATCTG-3′5′-ACAATGCATCTTGTTCAGCTC-3′Mouse HAS35′-GATGTCCAAATCCTCAACAAG-3′5′-CCCACTAATACATTGCACAC-3′Mouse biglycan5′-CTGAGGGAACTTCACTTGGA-3′5′-CAGATAGACAACCTGGAGGAG-3′Mouse TGFB15′-CCGCAACAACGCCATCTATG-3′5′-CTCTGCACGGGACAGCAAT-3′Mouse TGFBR25′-CAAGTCGGATGTGGAAATGG-3′5′-AAATGTTTCAGTGGATGGATGG-3′Mouse Hyal15′-AAGTACCAAGGAATCATGCC-3′5′-CTCAGGATAACTTGGATGGC-3′Mouse Hyal25′-GGTGGACCTTATCTCTACCAT-3′5′-TATTGGCAGGTCTCCATACTT-3′Mouse CD445′-GACCGGTTACCATAACTATTGTC-3′5′-CATCGATGTCTTCTTGGTGTG-3′Mouse GAPDH5′-TGGCAAAGTGGAGATTGTTGCC-3′5′-AAGATGGTGATGGGCTTCCCG-3′ Open table in a new tab Primary human dermal fibroblasts from different donors were cultured in Earle's minimum essential medium without glutamine (PAA Laboratories GmbH, Cölbe, Germany), supplemented with antibiotics/antimycotics, 2 mmol/L l-glutamine, and 10% fetal calf serum (Invitrogen) in a CO2 incubator (5% CO2) at 37°C. Up to five different cell lines from different donors were used between passages 5 and 10 for the described experiments. For the irradiation experiments, the cells were seeded into six-well plates and grown to 100% confluency. To knock-down HAS2 in skin fibroblasts, short hairpin RNA (shRNA) sequence29Wiznerowicz M Trono D Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference.J Virol. 2003; 77: 8957-8961Crossref PubMed Scopus (618) Google Scholar targeting HAS2 was cloned into the PacI-ClaI site of the pCL1-THPC-vector (forward: 5′-GCGATTATCACTGGATTCTTTCAAGAGAAGAATCC- AGTGATAATCGCTTTTTGGAAA T-3′, reverse: 5′-GCTA- AAGGTTTTTCGCTAATAGTGACCTAAGAAGAGAACTTT- CTTAGGTCACTATTAGCGTA-3′). In this lentiviral vector, the human H1 promoter drives the expression of shRNA, whereas the expression of EGFP, which works as a positive marker for infection, is driven by the SFFV U3 region.30Kalmes M Neumeyer A Rio P Hanenberg H Fritsche E Blomeke B Impact of the arylhydrocarbon receptor on eugenol- and isoeugenol-induced cell cycle arrest in human immortalized keratinocytes (HaCaT).Biol Chem. 2006; 387: 1201-1207Crossref PubMed Scopus (23) Google Scholar The vector, harvest of recombinant lentiviral particles, and infection of skin fibroblasts were performed as previously described.30Kalmes M Neumeyer A Rio P Hanenberg H Fritsche E Blomeke B Impact of the arylhydrocarbon receptor on eugenol- and isoeugenol-induced cell cycle arrest in human immortalized keratinocytes (HaCaT).Biol Chem. 2006; 387: 1201-1207Crossref PubMed Scopus (23) Google Scholar HA concentration in the supernatant of human skin fibroblasts was determined by using HA enzyme-linked immunosorbent assay (Corgenix) 5 days after infection and was calculated as ratio of HA and total cellular protein. DNA synthesis and migration were determined in the presence of FCS because pericellular HA coat formation requires inter-α-inhibitor from serum.31Carrette O Nemade RV Day AJ Brickner A Larsen WJ TSG-6 is concentrated in the extracellular matrix of mouse cumulus oocyte complexes through hyaluronan and inter-alpha-inhibitor binding.Biol Reprod. 2001; 65: 301-308Crossref PubMed Scopus (84) Google Scholar Five days after lentiviral infection and before the functional assays, the knockdown of HAS2 mRNA expression was verified by real-time RT-PCR. Subsequently, at day 6 after lentiviral infection, shHAS2- and pCL1-infected human skin fibroblasts were compared with respect to proliferation and migration. DNA synthesis was determined in response to 10% serum in serum-starved (24 hours) cells by measurement of [3H]thymidine incorporation as described before.32van den Boom M Sarbia M von Wnuck Lipinski K Mann P Meyer-Kirchrath J Rauch BH Grabitz K Levkau B Schror K Fischer JW Differential regulation of hyaluronic acid synthase isoforms in human saphenous vein smooth muscle cells: possible implications for vein graft stenosis.Circ Res. 2006; 98: 36-44Crossref PubMed Scopus (43) Google Scholar Modified Boyden chamber microchemotaxis assays were used to assess migration of shHAS2-transfected cells. Polycarbonate filters (pore size, 10 μmol/L; Neuroprobe, Cabin John, MD) were coated with monomeric type-I collagen (Nutacon BV, Leimuiden, The Netherlands) according to the manufacturer's instructions. Fibroblasts were trypsinized and seeded at 15,000 cells per well (250,000/cm2) into the upper wells and allowed to migrate toward 10% FCS for 6 hours at 37°C and 5% CO2. Migrated cells were fixed in methanol for 5 minutes and then stained with 5 μg/ml propidium iodide in PBS and analyzed by PhosphorImager scanning as described earlier.33Conley BA Koleva R Smith JD Kacer D Zhang D Bernabeu C Vary CP Endoglin controls cell migration and composition of focal adhesions: function of the cytosolic domain.J Biol Chem. 2004; 279: 27440-27449Crossref PubMed Scopus (109) Google Scholar Each experiment represents the average of at least six microchemotaxis chamber wells. For irradiation, the cell culture media were replaced by PBS. Cells were irradiated with 100 J/m2 UVB from FS20 sunlamps (Westinghouse Electric, Pittsburgh, PA). The UVB output was monitored by means of an IL1700 research radiometer and SEE240 UVB photodetector (International Light, Newburyport, MA) and was ∼2.4 W/m2 at a tube to target distance of 22 cm. Immediately after UVB exposure, PBS was replaced by fresh medium, and cells were further incubated until harvest. Staining with HAbP as a specific probe to detect HA revealed that the strongest staining of HA was found in papillary dermis (Figure 1B, arrows). The epidermis of adult mice showed weak HA staining as described earlier.12Tammi R Pasonen-Seppanen S Kolehmainen E Tammi M Hyaluronan synthase induction and hyaluronan accumulation in mouse epidermis following skin injury.J Invest Dermatol. 2005; 124: 898-905Crossref PubMed Scopus (121) Google Scholar As a specific negative control for the HA staining, hyaluronidase digestion was performed (not shown). To analyze the HA content of the dermal ECM during intrinsic aging, three consecutive skin biopsies from dorsal skin were collected from shaved C57/BL6 mice at the age of 150, 300, and 400 days. HA staining revealed that during intrinsic aging HA levels showed only a slight decline up to 400 days of age (Figure 1B). This was confirmed by densitometric quantification of the HA staining (Figure 1C). Next, dermal HA staining was investigated in age-matched UVB-irradiated mice. Irradiation [three times per week, threefold MED (210 mJ/cm2)] was initiated at the age of 42 days and continued for 182 days. From these mice three consecutive skin biopsies were collected at the same age as described above for the control mice. A pronounced loss of HA especially from the HA-rich papillary dermis (arrows) was observed beginning at 300 days after initiation of UVB irradiation and continued to progress in the 400-day samples (Figure 1B, bottom). Quantitative image analysis of HA affinity histochemistry in the papillary dermis supported this impression. At 400 days (third biopsy), the HA content of the papillary dermis was significantly decreased compared with nonirradiated controls (Figure 1C). Furthermore, the amount of total dermal HA per mg dry weight was significantly reduced (Figure 1D). These results suggest that chronic repetitive UVB irradiation throughout 182 days causes pronounced loss of HA from the upper dermis and that the loss of HA progresses even after cessation of the UVB irradiation. To investigate whether the loss of HA from the dermis is because of decreased synthesis, the expression levels of HAS isoenzymes HAS1, HAS2, and HAS3 were determined in the dorsal skin of nonirradiated controls and UVB-irradiated mice. Real-time PCR analysis of HAS1, HAS2, and HAS3 revealed that HAS1 is expressed at the lowest level (∼30 times less than HAS2 and HAS3) and that HAS2 and HAS3 show approx
Referência(s)