Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Fas Ligand Downregulation with Antisense Oligonucleotides in Cells and in Cultured Tissues of Normal Skin Epidermis and Basal Cell Carcinoma

2003; Elsevier BV; Volume: 120; Issue: 6 Linguagem: Inglês

10.1038/jid.2003.13

ISSN

1523-1747

Autores

Jingmin Ji, Marion Wernli, Stanislaw A. Buechner, Peter Erb,

Tópico(s)

Bacillus and Francisella bacterial research

Resumo

Fas ligand (FasL), a member of the tumor necrosis factor family, induces apoptosis upon interaction with Fas-receptor-expressing cells. FasL normally plays an important immune regulatory role, but it can also cause severe skin diseases if overexpressed and it may serve some tumors for immune evasion. Thus, in situ QJ;inhibition of FasL expression with antisense oligonucleotides in patients may be a novel approach to overcome its pathogenic role. We designed and evaluated 15 phosphorothioate antisense oligonucleotides directed against different regions of the human FasL mRNA. They exhibited different inhibitory activities on FasL expression in HEK293 cells. The most potent antisense oligonucleotide, ASO8, specifically downre-gulated 90% FasL expression at the protein level and 80% at the mRNA level. FasL downregulation reduced the effector function of HEK293 cells toward Fas receptor positive target cells. Further studies demonstrated that ASO8 efficiently inhibited FasL synthesis in split skin and basal cell carcinoma tissue. Our results show that the modulation of FasL expression by antisense oligonucleotides is possible in cells as well as tissue and indicate that antisense oligonucleotides may provide a promising strategy for the therapy of FasL-mediated disorders. Fas ligand (FasL), a member of the tumor necrosis factor family, induces apoptosis upon interaction with Fas-receptor-expressing cells. FasL normally plays an important immune regulatory role, but it can also cause severe skin diseases if overexpressed and it may serve some tumors for immune evasion. Thus, in situ QJ;inhibition of FasL expression with antisense oligonucleotides in patients may be a novel approach to overcome its pathogenic role. We designed and evaluated 15 phosphorothioate antisense oligonucleotides directed against different regions of the human FasL mRNA. They exhibited different inhibitory activities on FasL expression in HEK293 cells. The most potent antisense oligonucleotide, ASO8, specifically downre-gulated 90% FasL expression at the protein level and 80% at the mRNA level. FasL downregulation reduced the effector function of HEK293 cells toward Fas receptor positive target cells. Further studies demonstrated that ASO8 efficiently inhibited FasL synthesis in split skin and basal cell carcinoma tissue. Our results show that the modulation of FasL expression by antisense oligonucleotides is possible in cells as well as tissue and indicate that antisense oligonucleotides may provide a promising strategy for the therapy of FasL-mediated disorders. antisense oligonucleotide Fas ligand Fas ligand (FasL, CD95 ligand), a type II membrane protein, belongs to the tumor necrosis factor (TNF) family (Suda et al., 1993Suda T. Takahashi T. Golstein P. Nagata S. Molecular cloning and expression of the Fas ligand, a novel member of the tumor necrosis factor family.Cell. 1993; 75: 1169-1178Abstract Full Text PDF PubMed Scopus (2390) Google Scholar; Takahashi et al., 1994Takahashi T. Tanaka M. Inazawa J. Abe T. Suda T. Nagata S. Human Fas ligand: Gene structure, chromosomal location and species specificity.Int Immunol. 1994; 6: 1567-1574Crossref PubMed Scopus (411) Google Scholar). Predominantly expressed in activated T lymphocytes and natural killer cells, it is also detected in skin epidermis and in immune-privileged sites such as the eye and testis (Schneider et al., 1997Schneider P. Bodmer J.L. Holler N. et al.Characterization of Fas (Apo-1, CD95)-Fas ligand interaction.J Biol Cliem. 1997; 272: 18827-18833Crossref PubMed Scopus (151) Google Scholar; Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar; D'Alessio et al., 2001D'Alessio A. Riccioli A. Laurctti P. et al.Testicular FasL is expressed by sperm cells.Proc Natl Acad Sci USA. 2001; 98: 3316-3321Crossref PubMed Scopus (117) Google Scholar). Upon binding to its receptor Fas, FasL induces apoptosis in Fas-bearing cells. FasL-Fas interactions play an important role in the elimination of excess cells in cmbryogenesis, metamorphosis, and tissue turnover, as well as in the development and regulation of the immune system. FasL-mediated apoptosis is also important for skin homeostasis (Polakowska et al., 1994Polakowska R.R. Piacentini M. Bartlett R. Goldsmith L.A. Haake A.R. Apoptosis in human skin development: morphogenesis, periderm, and stem cells.Dev Dyn. 1994; 199: 176-188Crossref PubMed Scopus (242) Google Scholar; Lee et al., 1998Lee S.H. Jang J.J. Lee J.Y. et al.Fas ligand is expressed in normal skin and in some cutaneous malignancies.Br J Dermatol. 1998; 139: 186-191Crossref PubMed Scopus (49) Google Scholar; Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). Kcratinocytes in normal human skin epidermis constitu-tively express FasL on the plasma membrane and may induce apoptosis of inflammatory Fas+ cells entering the epidermis (de Panfilis et al., 2002de Panfilis G. Semenza D. Lavazza A. Mulder A.A. Mommaas A.M. Pasolini G. Kcratinocytes constitutivcly express the CD95 ligand molecule on the plasma membrane: An in situ immunoelectron microscopy study on ultracryosections of normal human skin.Br J Dermatol. 2002; 147: 7-12Crossref PubMed Scopus (8) Google Scholar). The dysregulation of Fas–FasL interactions may be a key clement in the development of skin cancer (Hill et al., 1999Hill L.L. Ouhtit A. Loughlin S.M. Kripke M.L. Ananthaswamy H.N. Owen-Schaub L.B. Fas ligand: A sensor for DNA damage critical in skin cancer etiology.Science. 1999; 285: 898-900Crossref PubMed Scopus (219) Google Scholar). Some skin diseases arc caused by overcxpression of FasL. Kera-tinocytcs of patients with toxic epidermal necrolysis produce FasL, which induces apoptosis resulting in the fast destruction of the epidermis (Viard et al., 1998Viard I. Wchrli P. Bullani R. et al.Inhibition of toxic epidermal necrolysis by blockade of CD95 with human intravenous immunoglobulin.Science. 1998; 282: 490-493Crossref PubMed Scopus (946) Google Scholar). Various skin tumors express FasL, thereby potentially creating their own immunoprivileged sites (Hahne et al., 1996Hahne M. Rimoldi D. Schroter M. et al.Melanoma cell expression of Fas (Apo-1/ CD95) ligand: Implications for tumor immune escape.Science. 1996; 274: 1363-1366Crossref PubMed Scopus (1167) Google Scholar; Gutierrez-Steil et al., 1998Gutierrez-Steil C. Wrone-Smith T. Sun X. Krueger J.G. Coven T. Nickoloff B.J. Sunlight-induced basal cell carcinoma tumor cells and ultraviolet-B-irradiated psoriatic plaques express Fas ligand (CD95L).J Clin Invest. 1998; 101: 33-39Crossref PubMed Scopus (108) Google Scholar; Lee et al., 1998Lee S.H. Jang J.J. Lee J.Y. et al.Fas ligand is expressed in normal skin and in some cutaneous malignancies.Br J Dermatol. 1998; 139: 186-191Crossref PubMed Scopus (49) Google Scholar; Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). FasL-mediated immune suppression was also proposed in melanoma (Hahne et al., 1996Hahne M. Rimoldi D. Schroter M. et al.Melanoma cell expression of Fas (Apo-1/ CD95) ligand: Implications for tumor immune escape.Science. 1996; 274: 1363-1366Crossref PubMed Scopus (1167) Google Scholar). In normal melanocytes of the skin no FasL expression can be detected, but FasL upregulation occurs during tumorigenesis. The fact that FasL is highly expressed in basal cell carcinoma (BCC) coincides with the observation that the cells immediately adjacent to BCC were undergoing apoptosis, whereas T cells more distant to tumor cells remained viable (Buechner et al., 1997Buechner S.A. Wernli M. Harr T. Hahn S. Itin P. Erb P. Regression of basal cell carcinoma by intralcsional interferon-oc treatment is mediated by CD95 (Apo-1/Fas)-CD95 ligand-induced suicide.J Clin Invest. 1997; 100: 2691-2696Crossref PubMed Scopus (113) Google Scholar; Gutierrez-Steil et al., 1998Gutierrez-Steil C. Wrone-Smith T. Sun X. Krueger J.G. Coven T. Nickoloff B.J. Sunlight-induced basal cell carcinoma tumor cells and ultraviolet-B-irradiated psoriatic plaques express Fas ligand (CD95L).J Clin Invest. 1998; 101: 33-39Crossref PubMed Scopus (108) Google Scholar). Indeed, FasL-cxpressing melanoma or BCC cells are able to kill infiltrating Fas T lymphocytes by inducing apoptosis, thereby escaping the attack of cytotoxic T lymphocytes. Recently, wc found a similar situation with TRAIL, another member of the TNF family involved in apoptosis. TRAIL-antisense-expressing mastocytoma cells demonstrated significantly delayed tumor growth compared to control cells, as TRAIL downregulation allowed more macrophages to survive and to better attack the tumor cells (Strebel et al., 2002Strebel A. Bachmann F. Wernli M. Erb P. Tumor necrosis factor-related, apoptosis-inducing ligand supports growth of mouse mastocytoma tumors by killing tumor-infiltrating macrophages.Int J Cancer. 2002; 100: 627-634Crossref PubMed Scopus (12) Google Scholar). All the available data suggest that the downregulation of FasL in the above diseases could reduce or eliminate the disorders. In order to achieve efficient downregulation of FasL expression, phosphorothioate antisense oligonucleotides (ASO) were applied in this study. It has been demonstrated that ASO targeting genes involved in cancer development and progression inhibited cancer cell growth (Gautschi et al., 2001Gautschi O. Tschopp S. Olie R.A. et al.Activity of a novel bcl-2/bcl-xL-bispecific antisense oligonucleotide against tumors of diverse histologic origins.J Natl Cancer Inst. 2001; 93: 463-471Crossref PubMed Scopus (136) Google Scholar; Guticrrez-Puente et al., 2002Guticrrez-Puente Y. Zapata-Bcnavides P. Tari A.M. Lopez-Berestcin G. Bcl-2-related antiscnsc therapy.Semin Oncol. 2002; 29: 71-76Google Scholar; Lau et al., 2002Lau Q.C. Achenbach T.V. Borchers O. Muller R. Slater E.P. In vivo pro-apoptotic and antitumor efficacy of a c-Raf antisense phosphorothioatc oligonucleotide: Relationship to tumor size.Antisense Nucl Acid Drug Dev. 2002; 12: 11-20Crossref PubMed Scopus (10) Google Scholar; Olie et al., 2002Olie R.A. Hafner C. Kuttel R. et al.Bcl-2 and bcl-xL antisense oligonucleotides induce apoptosis in melanoma cells of different clinical stages.J Invest Dermatol. 2002; 118: 505-512Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). For example, the clinical studies using Bcl-2 antisense phosphorothioate oligonucleotides gave promising results in patients with melanoma (Janscn et al., 2000Janscn B. Wacheck V. Heere-Ress E. et al.Chemosensitisation of malignant melanoma by BCL2 antisense therapy.Lancet. 2000; 356: 1728-1733Abstract Full Text Full Text PDF PubMed Scopus (464) Google Scholar). The antisense strategy may be particularly well suited for application in skin diseases or in skin tumors as the skin is easily accessible (Crooke et al., 1996Crooke R.M. Crookc S.T. Graham M.J. Cooke M.E. Effect of antisense oligonucleotides on cytokine release from human kcratinocytes in an in vitro model of skm.Toxicol Appl Pharmacol. 1996; 140: 85-93Crossref PubMed Scopus (17) Google Scholar; Wingens et al., 1999Wingens M. Pfundt R. van Vlijmcn-Willcms I.M. van Hooijdonk C.A. van Erp P.E. Schalkwijk J. Sequence-specific inhibition of gene expression in intact human skin by epicutaneous application of chimeric antisense oligodeoxynuclcotides.Lab Invest. 1999; 79: 1415-1424PubMed Google Scholar; Fimmel et al., 2000Fimmel S. Saborowski A. Orfanos C.E. Zouboulis C.C. Development of efficient transient transfection systems for introducing antisense oligonucleotides into human epithelial skin cells.Horn Res. 2000; 54: 306-311Crossref PubMed Scopus (14) Google Scholar). Evaluating a scries of 20-mcr phosphorothioatc ASO directed against different regions of the human FasL mRNA, we selected the most potent ASO and demonstrate that it efficiently downrcgulates FasL expression not only in cultured cells but also in human normal split skin and BCC tissue. The human embryonic kidney 293 cells, HEK293-005, stably transfected with a human FasL-cxpressing plasmid (kindly provided by Dr. Pascal Schneider, Institute of Biochemistry, University of Lausanne, Switzerland), were cultured in Dulbccco's modified Eagle's nutrient mix (F-12) (Gibco Invitrogen, Basel, Switzerland) supplemented with 2% fetal bovine scrum (FBS) (Schneider et al., 1997Schneider P. Bodmer J.L. Holler N. et al.Characterization of Fas (Apo-1, CD95)-Fas ligand interaction.J Biol Cliem. 1997; 272: 18827-18833Crossref PubMed Scopus (151) Google Scholar). BALB/c B cell lymphoma A20.2 J (ATCC TIB208) cells stably transfected with green fluorescent protein (A20 GFP) were cultured in RPMI 1640 medium (Gibco Invitrogen) with 5% FBS at 37°C in 5% CO2 (Strebel et al., 2001Strebel A. Harr T. Bachmann F. Wernli M. Erb P. Green fluorescent protein as a novel tool to measure apoptosis and necrosis.Cytometry. 2001; 43: 126-133Crossref PubMed Scopus (46) Google Scholar). A total of 15 different ASO were designed to target various regions of FasL mRNA (Accession no. D38122) (Mita et al., 1994Mita E. Hayashi N. Iio S. et al.Role of Fas ligand in apoptosis induced by hepatitis C virus infection.Biochcm Biopbys Res Commun. 1994; 204: 468-474Crossref PubMed Scopus (169) Google Scholar; Takahashi et al., 1994Takahashi T. Tanaka M. Inazawa J. Abe T. Suda T. Nagata S. Human Fas ligand: Gene structure, chromosomal location and species specificity.Int Immunol. 1994; 6: 1567-1574Crossref PubMed Scopus (411) Google Scholar), based on the selection criteria and Mfold program (Zuker, 1989Zuker M. On finding all suboptimal foldings of an RNA molecule.Science. 1989; 244: 48-52Crossref PubMed Scopus (1687) Google Scholar; Smith et al., 2000Smith L. Andersen K.B. Hovgaard L. Jaroszewski J.W. Rational selection of antisense oligonucleotide sequences.EurJ Pharm Sci. 2000; 11: 191-198Crossref PubMed Scopus (37) Google Scholar; Sohail and Southern, 2000Sohail M. Southern E.M. Selecting optimal antisense reagents.Adv Drug Deliv Rev. 2000; 44: 23-34Crossref PubMed Scopus (83) Google Scholar; Lebedeva and Stein, 2001Lebedeva I. Stein C.A. Antisense oligonucleotides: Promise and reality.Aram Rev Pharmacol Toxicol. 2001; 41: 403-419Crossref PubMed Scopus (205) Google Scholar). All ASO were 20-mer long and phosphorothioatc-modified (Table I); they were synthesized and HPLC-purified by Europe Gene Scan (Freiburg, German). BLAST search of the NBCI database revealed no homology of these antisense sequences to any other known human genes. From ASO8 some shortened analogs (ASO8-2, CTCGG AGTTC TGCCA GCT; ASO8-4, CGGAG TTCTG CCAGC t; ASO8-6, GAGTT CTGCC AGCT; ASO8-8, GTTCT GCCAG CT) or mismatched analogs (ASO-2MM, CgCTC tGAGT TCTGC CAGCT; ASO-4MM, CgCaC tGtGT TCTGC CAGCT; ASO-6MM, CgCaC tGtGT TgTcC CAGCT) or its sense control (ASO8-sen, AGCTG GCAGA ACTCC GAGAG) were designed and synthesized in the same way.Table IASO against human FasL mRNAASOAntisense sequences (5′ to 3′)Target locationaAccording to Homo sapiens FasL mRNA, Accession no. D38122.CommentsASOITTCTCAGTCCTGTAGAGGCT125–1445' UTRASO2GCCAGCCCCAGCAAACGGTT152–1715' UTRASO3CATGGCAGCTGGTGAGTCAG172–191The initiator codonASO4CTGCTGCATGGCAGCTGGTG178–197The initiator codonASO5TAATTGAAGGGCTGCTGCAT189–208The initiator codonASO6AGTAGATCTGGGGATATGGG209–228Coding regionASO7TGGGCACAGAGGTTGGACAG281–300Coding regionASO8CTCTCGGAGTTCTGCCAGCT517–5361st splicing siteASO9GTGCATCTGGCTGGTAGACT535–5541st splicing siteASO10CCTATTTGCTTCTCCAAAGA564–5832nd splicing siteASO11GGGGTGGACTGGGGTGGCCT581–6002nd splicing siteASO12CCTGTTA A ATGGGCCACTTT621–6403rd splicing siteASO13CCTTGAGTTGGACTTGCCTG637–6563rd splicing siteASO14GAATATACAAAGTACAGCCC747–766Coding regionASO15CTTAGAGCTTATATAAGCCG1016–1035The terminator codona According to Homo sapiens FasL mRNA, Accession no. D38122. Open table in a new tab HEK293-005 cells were transfected with various concentrations of ASO in the presence of the carrier Lipofectamine 2000 reagent (Gibco) according to the manufacturer's protocol. The transfected cells were cultured at 37°C for different time periods depending on the experiment. The concentrations (nM) of ASO given in the figures and legends are final concentrations in medium. For tissue transfection human normal split skin or excised BCC tissue was cut into pieces of about 1–2 mm3. Each piece was transfected with 500 nM ASO8, or its sense control, or phosphate-buffered saline (PBS) together with Lipofectamine 2000 and cultured in RPMI 1640 medium supplemented with 5% FBS and 0.1 mg per ml gentamicin at 37°C in 5% CO2. After 2 d, each piece was transfected again and cultured for another 2 d. FasL protein expression was stained with mouse antihuman FasL monoclonal antibody G247-4 (BD) Pharmagen) and analyzed with a FACSCalibur flow cytometer (Becton-Dickinson, Basel, Switzerland). 10,000–20,000 cells were investigated. Data were processed with the Cell Quest software (Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). FasL mRNA levels of HEK293-005 cells were determined by quantitative real-time reverse transcriptase PCR (RT-PCR) in the ABI Prism 7700 Sequence Detection System (PE Applied Biosystcms, Foster City, CA). At 2 d post-transfection, cells were collected for isolation of total RNA with RNeasy kit (Qiagen, Basel, Switzerland). Reverse transcription and RT-PCR were performed as previously described (Zangemeister-Wittke et al., 2000Zangemeister-Wittke U. Leech S.H. Olie R.A. et al.A novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells.Clin Cancer Res. 2000; 6: 2547-2555PubMed Google Scholar; Dotsch et al., 2001Dotsch J. Hogen N. Nyul Z. HanzeJ Knerr I. Kirschbaum M. Rascher W. Increase of endothelial nitric oxide synthase and endothelin-1 mRNA expression in human placenta during gestation.Eur J Obstet Gynecol Rcprod Biol. 2001; 97: 163-167Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar; Mori et al., 2002Mori H. Colman S.M. Xiao Z. et al.Chromosome translocations and covert leukemic clones arc generated during normal fetal development.Proc Natl Acad Sci USA. 2002; 99: 8242-8247Crossref PubMed Scopus (450) Google Scholar). Human glyccraldchydc-3-phosphate dehydrogenase (GAPDH) mRNA was used as the internal control. The following primers and TaqMan probes were applied: FasL sense 5′ TGCCT TGGTA GGATT GGGC 3′, FasL antisense 5′ TCTCG GAGTT CTGCC AGCTC 3′, FasL probe 5′ (FAM) ATGTT TCAGC TCTTC CACC (TAMRA) 3′; GAPDH sense 5′ TCAGC AATGC CTCCT GCAC 3′, GAPDH antisense 5′ AC GAT ACCAA AGTTG TCATG GATG 3′, GAPDH probe 5′ (FAM) AACTG CTTAG CACCC C (TAMRA) 3′. At 1.5 d post-transfection with specific ASO8 or its sense control, FasL-expressing HEK293-005 cells were washed three times with 1 × PBS and then cocultured with the Fas-positive apoptosis reporter cells A20 GFP at a ratio of 2:1 (effecter cells:reporter cells) in fluorescence-activated cell sorter (FACS) tubes overnight. After washing with 1 × PBS, cells were rcsuspended in 1 × PBS and analyzed by flow cytometry to determine the percentage of apoptotic A20 GFP cells (Strebel et al., 2001Strebel A. Harr T. Bachmann F. Wernli M. Erb P. Green fluorescent protein as a novel tool to measure apoptosis and necrosis.Cytometry. 2001; 43: 126-133Crossref PubMed Scopus (46) Google Scholar). Immunohistochcmistry on 6 μm cryosections was done as described earlier (Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). FasL was stained with mouse antihuman monoclonal FasL G247-4 (BD Pharmagene, Basel, Switzerland). As isotype control, the same amount of mouse negative control IgG (Dako Diagnostics, Denmark) was used. Details of the procedure arc provided elsewhere (Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). In brief, the immuno-stainings of BCC were digitized. For imaging, the equivalent gray-level intensity within the region of interest was determined with the Openlab program (Improvision, Coventry, UK). The mean intensity value of the isotype control was subtracted from the mean intensity values of the FasL antibody. For calculation, the subtracted mean values of the measurements obtained from BCC transfected with ASO8 and its sense control were normalized to the corresponding mock value, which was set to 1.0 (Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). Although ASO have been widely applied to inhibit the expression of genes of interest, not all ASO function properly as various ASO targeting distinct sites on the same mRNA usually express differential activities. In order to identify the most potent ASO for inhibition of FasL expression, 15 different ASO, each 20 bases in length and predicted to hybridize only with FasL mRNA, were synthesized. Two ASO targeted the 5′ untranslated region (5′-UTR), three the translation initiation codon AUG, two targeted each of the three splicing sites, three the internal coding region, and one ASO targeted the translation termination site. Table I lists sequences and target locations of all ASO. The potency of the ASO (250 nm) was assessed by the reduction of FasL expression in HEK293-005 cells by FACS analysis upon transfection with Lipofcctaminc 2000. As shown in Fig 1, the inhibitory activity of the specific ASO varied greatly. ASOS, AS09, and AS013 down regulated FasL expression up to 90%, whereas AS06 and AS015 downregulated FasL by less than 40%. ASO transfccted into cells without Lipofectamine 2000 did not exhibit any significant inhibition of FasL expression (data not shown). The three most active ASO (ASO8, ASO9, and ASO13) all targeted the first or third splicing sites of FasL mRNA, respectively (Table I). This indicates that FasL mRNA must contain higher order RNA structures that limit the accessibility for the other ASO. Thus, the differential activities of the 15 ASO could be due to different accessibility of the FasL mRNA. To explore the accessibility of the region surrounding the target site of AS013, six more ASO were synthesized by shifting the target sites at both ends of AS013 in increments of three bases. All six ASO exhibited a similar (but not the same) inhibition of FasL expression to AS013, but never exceeded the activity of ASOB (data not shown). Therefore, for the following experiments only ASOH was used. Titration experiments with ASOB showed that the ASO-mcdiated inhibition is concentration dependent (Fig 2A). The higher the concentration of the ASO used to transfect HEK293 cells, the higher was the inhibition observed. The median inhibitory concentration IC50 for ASO8 was at 20 nM. Concentrations higher than 500 nM did not significantly increase the inhibitory potential of the ASO tested. Moreover, at concentrations higher than 1500 nM the cells tended to die (data not shown). To examine the specificity of ASO8, three mismatched analogs (ASO8-2 MM, ASO8-4MM, ASO8-6MM, containing two, four, six mismatched bases, respectively) and its sense oligonucleotide were designed and synthesized. The effect of each control ASO on FasL expression was determined by FACS analysis and the relative inhibition was normalized to the inhibition of ASO8, which was set to 1. Figure 2(B) shows that the 2MM analog lost its inhibitory potential on FasL expression by 70% compared to ASO8, whereas 4MM or 6MM analogs and sense control expressed little inhibition, indicating that the ASO8-mediated inhibition is sequence dependent. In addition, some shortened ASO8 analogs (ASO8-2, ASO8-4, ASO8-6, and ASO-8, which miss two, four, six, and eight bases at the 5′ end of ASO8, respectively) were synthesized and tested. ASO8-6 and ASO8-8 lost most of their inhibitory activity whereas ASO8-2 and ASO8-4 retained part of the ASO8 antisense activity (Fig 2C). Thus, the antisense effect of ASO8 on FasL is also dependent on the ASO chain length. ASO shorter than 14 bases in length lost their activity and ASO longer than 14 bases demonstrated increasing inhibitory activities with oligonucleotide chain length. Analogs longer than 20 bases were not tested, however, as they tend to hybridize to other mRNA molecules according to BLAST results, decreasing their inhibition specificity. To evaluate the time kinetics of ASO8, inhibition of FasL expression was determined by FACS analysis at days 2, 3, 4, 5, 7, and 9 post-transfection of HEK293-005 cells with 250 nM of ASO8 (Fig 2D). Although the inhibition level decreased gradually from day to day, more than 70% of FasL expression was still inhibited by ASO8 at day 4. On day 9, the remaining inhibition was about 20% of the original level. To confirm the inhibition of FasL expression by ASO8 at the mRNA level, total RNA was purified from the transfccted cells. FasL mRNA expression was determined by quantitative real-time RT-PCR simultaneously with GAPDH as internal control (Fig 2E). ASO8 downregulated FasL mRNA expression by 80%, whereas its sense control did not cause any inhibition. It was tested whether downregulation of FasL in HEK293-005 cells with ASO8 also downregulated their effector function towards Fas-expressing A20 GFP cells. Figure 3 demonstrates that more than 60% A20 GFP cells survived when cocultured with ASO8-transfccted HEK293-005 cells, in contrast to about 90% of A20 GFP cells that became apoptotic upon coculture with sensc-control-transfected HEK293-005 cells or with PBS-treated HEK293-005 cells. The reason why some A20 GFP cells (≈40%) still became apoptotic upon coculture with ASO8-transfected HEK293-005 effector cells is that ASO8 did not completely downrcgulatc FasL on all cells and a few effector cells may even not have been transfccted at all. In any case, the data demonstrate that downregulation of FasL protein expression on HEK293 cells by ASO8 substantially inhibits their effector function against Fas+ target cells. In normal skin epidermis the basal layer and to a lesser extent also the upper layers express FasL (Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar). It is thought that FasL serves as an important sensor in the epidermis to preserve skin integrity (Polakowska et al., 1994Polakowska R.R. Piacentini M. Bartlett R. Goldsmith L.A. Haake A.R. Apoptosis in human skin development: morphogenesis, periderm, and stem cells.Dev Dyn. 1994; 199: 176-188Crossref PubMed Scopus (242) Google Scholar; Hill et al., 1999Hill L.L. Ouhtit A. Loughlin S.M. Kripke M.L. Ananthaswamy H.N. Owen-Schaub L.B. Fas ligand: A sensor for DNA damage critical in skin cancer etiology.Science. 1999; 285: 898-900Crossref PubMed Scopus (219) Google Scholar). Furthermore, we wanted to know whether the FasL antisense strategy also works in tissue, e.g., skin epidermis. As tissue, split skin was used, which was cut into small pieces and cultured with 500 nM ASO8 or its sense control and the corresponding concentration of Lipofectamine 2000. In order to make the ASO accessible to as many cells as possible within the tissue, the transfection was repeated after 2 d. Two days later cryosections were made and analyzed by immunohistochemistry with mouse antihuman specific FasL monoclonal antibody G247-4. Figure 4 shows that ASO8 strongly downregulated FasL expression in split skin (Fig 4B), whereas the sense control did not (Fig 4C), indicating that ASO8 inhibits FasL expression not only in single cells but also in tissue. BCC is the most frequent skin tumor in Caucasians and its incidence is still rising. Strong FasL expression is detected in BCC and believed to be crucial for their expansion (Gutierrez-Steil et al., 1998Gutierrez-Steil C. Wrone-Smith T. Sun X. Krueger J.G. Coven T. Nickoloff B.J. Sunlight-induced basal cell carcinoma tumor cells and ultraviolet-B-irradiated psoriatic plaques express Fas ligand (CD95L).J Clin Invest. 1998; 101: 33-39Crossref PubMed Scopus (108) Google Scholar). Downregulation of FasL expression in BCC may allow immune effector cells to attack and kill BCC in patients. In this study, we addressed the question whether specific ASO might inhibit FasL expression in BCC tissue in vitro. BCC were treated with ASO8 and control similarly to split skin. Figure 5 demonstrates that ASO8 efficiently inhibited FasL expression (Fig 5B), whereas the sense control did not (Fig 5C), showing a similar FasL expression as in the control (Fig 5A). FasL expression was quantitated by computer-assisted image analysis (Fig 5D), showing that ASO8 but not the sense control downregulated FasL expression in BCC tissue up to 70%. This study demonstrates that rationally selected, specific phos-phorothioate ASO efficiently deactivate the human FasL gene as shown by the downrcgulation of FasL expression in cultured cells. The optimally active ASO targeted the first or third splicing sites of the FasL mRNA, had a length of 20 bases, and specifically inhibited FasL expression in a broad range of concentration applied for at least 4 d. Further investigation of the most potent ASO, ASO8, showed that it functioned efficiently not only in cultured cells but also in tissues, i.e., normal skin and a skin tumor, the BCC. Our data support the observation that human skin is easily accessible for phosphorothioate ASO (Wingens et al., 1999Wingens M. Pfundt R. van Vlijmcn-Willcms I.M. van Hooijdonk C.A. van Erp P.E. Schalkwijk J. Sequence-specific inhibition of gene expression in intact human skin by epicutaneous application of chimeric antisense oligodeoxynuclcotides.Lab Invest. 1999; 79: 1415-1424PubMed Google Scholar; Wraight and White, 2001Wraight C.J. White P.J. Antiscnsc oligonucleotides in cutaneous therapy.Pharmacol Tber. 2001; 90: 89-104Crossref PubMed Scopus (48) Google Scholar). Functionally, the downrcgulation of FasL expression resulted in a markedly reduced apoptosis-inducing potential of the Fas-expressing cells. Although FasL is assumed to function as an important sensor in normal skin epidermis (Polakowska et al., 1994Polakowska R.R. Piacentini M. Bartlett R. Goldsmith L.A. Haake A.R. Apoptosis in human skin development: morphogenesis, periderm, and stem cells.Dev Dyn. 1994; 199: 176-188Crossref PubMed Scopus (242) Google Scholar; Bachmann et al., 2001Bachmann F. Buechner S.A. Wernli M. Strebel S. Erb P. Ultraviolet light downregu-lates CD95 ligand and TRAIL receptor expression facilitating actinic keratosis and squamous cell carcinoma formation.J Invest Dermatol. 2001; 117: 59-66Abstract Full Text Full Text PDF PubMed Google Scholar), its role in tumor cells seems to be different (Gutierrez-Steil et al., 1998Gutierrez-Steil C. Wrone-Smith T. Sun X. Krueger J.G. Coven T. Nickoloff B.J. Sunlight-induced basal cell carcinoma tumor cells and ultraviolet-B-irradiated psoriatic plaques express Fas ligand (CD95L).J Clin Invest. 1998; 101: 33-39Crossref PubMed Scopus (108) Google Scholar). Published data support the concept that FasL-expressing tumor cells can evade immune surveillance by killing Fas-expressing effector cells (Hahne et al., 1996Hahne M. Rimoldi D. Schroter M. et al.Melanoma cell expression of Fas (Apo-1/ CD95) ligand: Implications for tumor immune escape.Science. 1996; 274: 1363-1366Crossref PubMed Scopus (1167) Google Scholar; O'Connell et al., 1996O'Connell J. O'Sullivan G.C. Collins J.K. Shanahan F. The Fas counterattack: Fasmediated T cell killing by colon cancer cells expressing Fas ligand.J Exp Med. 1996; 184: 1075-1082Crossref PubMed Scopus (854) Google Scholar; Bennett et al., 1999Bennett M.W. O'Connell J. O'Sullivan G.C. et al.Expression of Fas ligand by human gastric adenocarcinomas: A potential mechanism of immune escape in stomach cancer.Gut. 1999; 44: 156-162Crossref PubMed Scopus (114) Google Scholar; Gutierrez et al., 1999Gutierrez L.S. Eliza M. Niven-Fairchild T. Naftolin F. Mor G. The Fas/Fas-ligand system: A mechanism for immune evasion in human breast carcinomas.Breast Cancer Res Treat. 1999; 54: 245-253Crossref PubMed Scopus (77) Google Scholar). Recently, it was shown in a mouse model that the transfection of FasL-antisense-expressing plasmid DNA into tumor tissue downrcgulated FasL translation in the tumor cells, and inhibited tumor progression by approximately 50% compared with the control group, strongly indicating that the FasL-mediated tumor counter-attack was impaired (Nyhus et al., 2001Nyhus J.K. Wolford C. Feng L. Barbera-Guillem E. Direct in vivo transfection of antisense Fas-ligand reduces tumor growth and invasion.Gene Titer. 2001; 8: 209-214Google Scholar). Therefore, selective inhibition of FasL gene expression in tumor cells with ASO could be an efficient local pharmacologic approach to diminish the tumor′s immune privilege. Current treatment of BCC is by surgery or by the intralcsional application of interferon-α (IFN-α) (Buechner et al., 1997Buechner S.A. Wernli M. Harr T. Hahn S. Itin P. Erb P. Regression of basal cell carcinoma by intralcsional interferon-oc treatment is mediated by CD95 (Apo-1/Fas)-CD95 ligand-induced suicide.J Clin Invest. 1997; 100: 2691-2696Crossref PubMed Scopus (113) Google Scholar; Bower et al., 2001Bower C.P. Lear J.T. de Bcrker D.A. Basal cell carcinoma follow-up practices by dermatologists: A national survey.Br J Dermatol. 2001; 145: 949-956Crossref PubMed Scopus (21) Google Scholar). Upon treatment with IFN-α the Fas-negative but FasL-positivc BCC start to express Fas and the tumor cells become apoptotic, most probably due to Fas–FasL interaction (Buechner et al., 1997Buechner S.A. Wernli M. Harr T. Hahn S. Itin P. Erb P. Regression of basal cell carcinoma by intralcsional interferon-oc treatment is mediated by CD95 (Apo-1/Fas)-CD95 ligand-induced suicide.J Clin Invest. 1997; 100: 2691-2696Crossref PubMed Scopus (113) Google Scholar). Thus, upregulation of Fas successfully leads to tumor regression. Recently, it has been shown that Fas and FasL are significantly increased during photodynamic-therapy-mediated apoptosis in human epidermoid carcinoma A431 cells (Ahmad et al., 2000Ahmad N. Gupta S. Feyes D.K. Mukhtar H. Involvement of Fas (APO-l/CD-95) during photodynamic-therapy-mediated apoptosis in human epidermoid carcinoma A431 cells.J Invest Dermatol. 2000; 115: 1041-1046Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Alternatively, down regulation of FasL may also lead to tumor regression as the tumor cells, now lacking the protective molecule for immune evasion, may become susceptible to the attack of immune effector cells. This hypothesis will now be testable not only because BCC of the skin are easily accessible but also due to the fact that ASO can be effectively transfected into tissues. If the hypothesis turns out to be correct, other FasL-expressing tumors can also be tried as targets for such an ASO approach, e.g., squamous cell carcinoma and melanoma. Both tumors express FasL, and in analogy to BCC the major role of FasL is proposed to be to mediate immune evasion. The therapeutic use of ASO is feasible. Indeed, various therapeutic applications based on ASO are already in clinical trials (Wingens et al., 1999Wingens M. Pfundt R. van Vlijmcn-Willcms I.M. van Hooijdonk C.A. van Erp P.E. Schalkwijk J. Sequence-specific inhibition of gene expression in intact human skin by epicutaneous application of chimeric antisense oligodeoxynuclcotides.Lab Invest. 1999; 79: 1415-1424PubMed Google Scholar; Wraight and White, 2001Wraight C.J. White P.J. Antiscnsc oligonucleotides in cutaneous therapy.Pharmacol Tber. 2001; 90: 89-104Crossref PubMed Scopus (48) Google Scholar; Nedbal and Tcichmann, 2002Nedbal W. Tcichmann B. Advantages of antiscnsc drugs for the treatment of oral diseases.Antisense Nucl Acid Drug Dev. 2002; 12: 183-191Crossref PubMed Scopus (1) Google Scholar) and the first ASO drug (Vitravene) has been approved by the FDA, clearly implying that ASO have therapeutic prospects. This work was supported by the Swiss National Science Funds grant 3100-064233.00. We thank U. Gunthert and S. Jacob for discussion and critical reading of the manuscript, and M. Colombifor technical assistance.

Referência(s)