Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Cytosolic Phospholipase A2 Group IVα but Not Secreted Phospholipase A2 Group IIA, V, or X Induces Interleukin-8 and Cyclooxygenase-2 Gene and Protein Expression through Peroxisome Proliferator-activated Receptors γ 1 and 2 in Human Lung Cells

2004; Elsevier BV; Volume: 279; Issue: 47 Linguagem: Inglês

10.1074/jbc.m408926200

ISSN

1083-351X

Autores

Rafał Pawliczak, Carolea Logun, Patricia Madara, Marion Lawrence, Grzegorz Woszczek, Anetta Ptasinska, Marek L. Kowalski, Tong Wu, James H. Shelhamer,

Tópico(s)

Eicosanoids and Hypertension Pharmacology

Resumo

It has been reported that interleukin-8 (IL-8) and cyclooxygenase-2 (COX-2) expression is regulated by peroxisome proliferator-activated receptor (PPAR)-γ synthetic ligands. We have shown previously that cytosolic phospholipase A2 (cPLA2) is able to activate gene expression through PPAR-γ response elements (Pawliczak, R., Han, C., Huang, X. L., Demetris, A. J., Shelhamer, J. H., and Wu, T. (2002) J. Biol. Chem. 277, 33153–33163). In this study we investigated the influence of cPLA2 and secreted phospholipase A2 (sPLA2) Group IIA, Group V, and Group X on IL-8 and COX-2 expression in human lung epithelial cells (A549 cells). We also studied the results of cPLA2 activation by epidermal growth factor (EGF) and calcium ionophore (A23187) on IL-8 and COX-2 reporter gene activity, mRNA level, and protein synthesis. cPLA2 overexpression and activation increased both IL-8 and COX-2 reporter gene activity. Overexpression and activation of Group IIA, Group V, or Group X sPLA2s did not increase IL-8 and COX-2 reporter gene activity. Methyl arachidonyl fluorophosphate, a cPLA2 inhibitor, inhibited the effect of A23187 and of EGF on both IL-8 and COX-2 reporter gene activity, steady state levels of IL-8 and COX-2 mRNA, and IL-8 and COX-2 protein expression. Small inhibitory RNAs directed against PPAR-γ1 and -γ2 blunted the effect of A23187 and of EGF on IL-8 and COX-2 protein expression. Moreover small inhibitory RNAs directed against cPLA2 decreased the effect of A23187 and EGF on IL-8 and COX-2 protein expression. These results demonstrate that cPLA2 has an influence on IL-8 and COX 2 gene and protein expression at least in part through PPAR-γ. It has been reported that interleukin-8 (IL-8) and cyclooxygenase-2 (COX-2) expression is regulated by peroxisome proliferator-activated receptor (PPAR)-γ synthetic ligands. We have shown previously that cytosolic phospholipase A2 (cPLA2) is able to activate gene expression through PPAR-γ response elements (Pawliczak, R., Han, C., Huang, X. L., Demetris, A. J., Shelhamer, J. H., and Wu, T. (2002) J. Biol. Chem. 277, 33153–33163). In this study we investigated the influence of cPLA2 and secreted phospholipase A2 (sPLA2) Group IIA, Group V, and Group X on IL-8 and COX-2 expression in human lung epithelial cells (A549 cells). We also studied the results of cPLA2 activation by epidermal growth factor (EGF) and calcium ionophore (A23187) on IL-8 and COX-2 reporter gene activity, mRNA level, and protein synthesis. cPLA2 overexpression and activation increased both IL-8 and COX-2 reporter gene activity. Overexpression and activation of Group IIA, Group V, or Group X sPLA2s did not increase IL-8 and COX-2 reporter gene activity. Methyl arachidonyl fluorophosphate, a cPLA2 inhibitor, inhibited the effect of A23187 and of EGF on both IL-8 and COX-2 reporter gene activity, steady state levels of IL-8 and COX-2 mRNA, and IL-8 and COX-2 protein expression. Small inhibitory RNAs directed against PPAR-γ1 and -γ2 blunted the effect of A23187 and of EGF on IL-8 and COX-2 protein expression. Moreover small inhibitory RNAs directed against cPLA2 decreased the effect of A23187 and EGF on IL-8 and COX-2 protein expression. These results demonstrate that cPLA2 has an influence on IL-8 and COX 2 gene and protein expression at least in part through PPAR-γ. 85-kDa cytosolic phospholipase A2 (cPLA2) 1The abbreviations used are: cPLA2, cytosolic PLA2; CAT, chloramphenicol acetyltransferase; PLA2, phospholipase A2; iPLA2, intracellular calcium-independent PLA2; sPLA2, secretory PLA2; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; MAFP, methyl arachidonyl fluorophosphate; IL, interleukin; EGF, epidermal growth factor; COX, cyclooxygenase; siRNA, small inhibitory RNA; thioetheramide-PC, 1-palmitylthio-2-palmitoylamido-1,2-dideoxy-sn-glycero-3-phosphorylcholine; BEL, bromoenol lactone; CMV, cytomegalovirus.1The abbreviations used are: cPLA2, cytosolic PLA2; CAT, chloramphenicol acetyltransferase; PLA2, phospholipase A2; iPLA2, intracellular calcium-independent PLA2; sPLA2, secretory PLA2; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; MAFP, methyl arachidonyl fluorophosphate; IL, interleukin; EGF, epidermal growth factor; COX, cyclooxygenase; siRNA, small inhibitory RNA; thioetheramide-PC, 1-palmitylthio-2-palmitoylamido-1,2-dideoxy-sn-glycero-3-phosphorylcholine; BEL, bromoenol lactone; CMV, cytomegalovirus. is a cytoplasmic enzyme that metabolizes phospholipids to release arachidonic acid. Upon activation by various stimuli (including but not limited to calcium ionophore (A23187), IL-1β, tumor necrosis factor-α, and interferon-γ) cPLA2 is translocated to the cellular membranes, releasing arachidonic acid from membrane phospholipids (1Wu T. Levine S.J. Lawrence M.G. Logun C. Angus C.W. Shelhamer J.H. J. Clin. Investig. 1994; 93: 571-577Crossref PubMed Scopus (87) Google Scholar, 2Wu T. Ikezono T. Angus C.W. Shelhamer J.H. Biochim. Biophys. Acta. 1996; 1310: 175-184Crossref PubMed Scopus (59) Google Scholar, 3Wu T. Levine S.J. Cowan M. Logun C. Angus C.W. Shelhamer J.H. Am. J. Physiol. 1997; 273: L331-L338Crossref PubMed Google Scholar, 4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Stimuli such as epidermal growth factor (EGF), oxidative stress, or IL-1β may also cause cPLA2 activation through its phosphorylation (5Pawliczak R. Huang X.L. Nanavaty U.B. Lawrence M. Madara P. Shelhamer J.H. Am. J. Respir. Cell Mol. Biol. 2002; 27: 722-731Crossref PubMed Scopus (42) Google Scholar, 6Dolan-O'Keefe M. Chow V. Monnier J. Visner G.A. Nick H.S. Am. J. Physiol. 2000; 278: L649-L657Crossref PubMed Google Scholar). Previously we have reported that cPLA2 is able to alter gene expression through PPAR-γ activation and binding to peroxisome proliferator response elements (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The calcium ionophore A23187 activates cPLA2 by increasing intracellular calcium levels, causing cPLA2 translocation to the nuclear envelope (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 6Dolan-O'Keefe M. Chow V. Monnier J. Visner G.A. Nick H.S. Am. J. Physiol. 2000; 278: L649-L657Crossref PubMed Google Scholar, 7Evans J.H. Fergus D.J. Leslie C.C. Adv. Enzyme Regul. 2003; 43: 229-244Crossref PubMed Scopus (10) Google Scholar). EGF is also thought to increase cytosolic phospholipase A2 activity through activation of the mitogen-activated protein kinase pathway and phosphorylation of cPLA2 at serine 505 (and possibly other serine residues) (5Pawliczak R. Huang X.L. Nanavaty U.B. Lawrence M. Madara P. Shelhamer J.H. Am. J. Respir. Cell Mol. Biol. 2002; 27: 722-731Crossref PubMed Scopus (42) Google Scholar). Both stimuli are known to increase cPLA2 enzymatic activity and arachidonate release. PLA2 enzymes catalyze the hydrolysis of membrane glycerophospholipids to liberate arachidonic acid and lysophospholipids. So far, more than 20 enzymes that possess PLA2 activity have been identified and cloned in mammals (for reviews, see Refs. 8Kudo I. Murakami M. Prostaglandins Other Lipid Mediat. 2002; 68–69: 3-58Crossref PubMed Scopus (656) Google Scholar, 9Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar, 10Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (756) Google Scholar, 11Balsinde J. Balboa M.A. Insel P.A. Dennis E.A. Annu. Rev. Pharmacol. Toxicol. 1999; 39: 175-189Crossref PubMed Scopus (530) Google Scholar, 12Dennis E.A. Am. J. Respir. Crit. Care Med. 2000; 161: S32-S35Crossref PubMed Scopus (116) Google Scholar, 13Balsinde J. Balboa M.A. Dennis E.A. Ann. N. Y. Acad. Sci. 2000; 905: 11-15Crossref PubMed Scopus (9) Google Scholar, 14Winstead M.V. Balsinde J. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 28-39Crossref PubMed Scopus (219) Google Scholar, 15Balsinde J. Winstead M.V. Dennis E.A. FEBS Lett. 2002; 531: 2-6Crossref PubMed Scopus (402) Google Scholar). PLA2s have been classified according to their molecular weight, homology, and calcium influence on enzyme activity. cPLA2 appears to play a role in intracellular arachidonate release, whereas low molecular weight PLA2s (such as Groups IA, IB, IIA, IIC, and V) may be involved in extracellular arachidonic acid release due to the fact that they are secreted into extracellular milieu upon cell stimulation. Thus, there may be distinct roles or cross-talk between PLA2s in cell signaling (16Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 17Balboa M.A. Perez R. Balsinde J. J. Immunol. 2003; 171: 989-994Crossref PubMed Scopus (57) Google Scholar). On the other hand a group of calcium-independent phospholipases A2 seems to have a broader substrate specificity. Several lines of evidence (for a review, see Ref. 18Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar) suggest that the Group VI iPLA2 may be responsible for phospholipid fatty acid remodeling in resting cells. The role of iPLA2 in intracellular cell signaling remains to be clarified. IL-8 is a chemokine that is produced and secreted by human lung cells (19Benfield T.L. van Steenwijk R. Nielsen T.L. Dichter J.R. Lipschik G.Y. Jensen B.N. Junge J. Shelhamer J.H. Lundgren J.D. Respir. Med. 1995; 89: 285-290Abstract Full Text PDF PubMed Scopus (38) Google Scholar, 20Aoki Y. Qiu D. Zhao G.H. Kao P.N. Am. J. Physiol. 1998; 274: L1030-L1039Crossref PubMed Google Scholar). It has strong chemotactic properties for neutrophils and eosinophils. Moreover IL-8 is an important proinflammatory cytokine that plays a role in allergic inflammation. The IL-8 promoter contains a PPAR-γ response element localized to –1060 relative to the transcription start site, suggesting that PPAR-γ may play a role in regulation of IL-8 transcription. It has been reported that several PPAR-γ agonists such as troglitazone, rosiglitazone, and others activate IL-8 transcription and enhanced IL-8 secretion in many cell systems including but not limited to lung cells (21Zhang X. Wang J.M. Gong W.H. Mukaida N. Young H.A. J. Immunol. 2001; 166: 7104-7111Crossref PubMed Scopus (90) Google Scholar, 22Jozkowicz A. Dulak J. Prager M. Nanobashvili J. Nigisch A. Winter B. Weigel G. Huk I. Prostaglandins Other Lipid Mediat. 2001; 66: 165-177Crossref PubMed Scopus (56) Google Scholar, 23Subbanagounder G. Wong J.W. Lee H. Faull K.F. Miller E. Witztum J.L. Berliner J.A. J. Biol. Chem. 2002; 277: 7271-7281Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 24Harris S.G. Smith R.S. Phipps R.P. J. Immunol. 2002; 168: 1372-1379Crossref PubMed Scopus (72) Google Scholar, 25Fu Y. Luo N. Lopes-Virella M.F. Atherosclerosis. 2002; 160: 11-20Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Cyclooxygenase is a key enzyme in prostaglandin synthesis. Cyclooxygenase exists in two isoforms (26Hla T. Neilson K. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7384-7388Crossref PubMed Scopus (1479) Google Scholar). COX-1 is a housekeeping gene constitutively expressed in most human cells. COX-2 is a highly inducible cyclooxygenase isoform. Various proinflammatory stimuli such as IL-1β, tumor necrosis factor-α, and interferon-γ have been reported to increase COX-2 expression in many biological systems including bronchial cells (27Bradbury D.A. Newton R. Zhu Y.M. Stocks J. Corbett L. Holland E.D. Pang L.H. Knox A.J. Am. J. Physiol. 2002; 283: L717-L725Crossref PubMed Scopus (55) Google Scholar, 28Fong C.Y. Pang L. Holland E. Knox A.J. Am. J. Physiol. 2000; 279: L201-L207PubMed Google Scholar, 29Pang L. Knox A.J. Br. J. Pharmacol. 1997; 121: 579-587Crossref PubMed Scopus (160) Google Scholar). The COX-2 promoter contains a PPRE, thus PPAR-γ agonists including anti-inflammatory drugs may influence COX-2 transcription and expression. 15-Δ12,14-Prostaglandin J2, thiazolidinediones, and non-steroidal anti-inflammatory drugs have been reported to alter COX-2 expression (22Jozkowicz A. Dulak J. Prager M. Nanobashvili J. Nigisch A. Winter B. Weigel G. Huk I. Prostaglandins Other Lipid Mediat. 2001; 66: 165-177Crossref PubMed Scopus (56) Google Scholar, 24Harris S.G. Smith R.S. Phipps R.P. J. Immunol. 2002; 168: 1372-1379Crossref PubMed Scopus (72) Google Scholar, 30Ikawa H. Kameda H. Kamitani H. Baek S.J. Nixon J.B. Hsi L.C. Eling T.E. Exp. Cell Res. 2001; 267: 73-80Crossref PubMed Scopus (35) Google Scholar, 31Pang L. Nie M. Corbett L. Knox A.J. J. Immunol. 2003; 170: 1043-1051Crossref PubMed Scopus (86) Google Scholar). As mentioned cPLA2 activation might increase expression of genes containing PPRE in promoter regions. This hypothesis has been proved using an artificial reporter gene as described elsewhere (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The purpose of this study was to investigate whether Group IVA cPLA2 and other phospholipases (such as secreted phospholipase A2 Group IIA, V, or X) might influence IL-8 and COX-2 gene and protein expression in human lung cells. Materials—A549 cells, a human adenocarcinoma cell line, were obtained from ATTC (American Type Culture Collection, Manassas, VA) and were grown in Ham's F-12K medium (BIOSOURCE) with 10% fetal bovine serum (BIOSOURCE) and 2 mm of l-Glutamine (BIOSOURCE). All experiments were performed when cells were 80–90% confluent. Methyl arachidonyl fluorophosphate (MAFP) was obtained from Calbiochem. Bromoenol lactone (BEL), an iPLA2 inhibitor, and thioetheramide-PC, an sPLA2 inhibitor, were purchased from Cayman Chemicals (Ann Arbor, MI). Transient Transfection Assay—The cPLA2 overexpression plasmid was obtained from Drs. J. D. Clark and J. L. Knopf at the Genetics Institute, Boston, MA (22Jozkowicz A. Dulak J. Prager M. Nanobashvili J. Nigisch A. Winter B. Weigel G. Huk I. Prostaglandins Other Lipid Mediat. 2001; 66: 165-177Crossref PubMed Scopus (56) Google Scholar). The sPLA2 Group IIA expression vector in pcDNA3.1 (Invitrogen) was obtained as described previously (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The sPLA2 Group V and Group X vectors were obtained from Drs. D. A. Bass and Michael Seeds (23Subbanagounder G. Wong J.W. Lee H. Faull K.F. Miller E. Witztum J.L. Berliner J.A. J. Biol. Chem. 2002; 277: 7271-7281Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). The IL-8 luciferase reporter gene was obtained from Dr. Robert L. Danner. The COX-2 reporter gene was a kind gift from Dr. Stephen Prescott (24Harris S.G. Smith R.S. Phipps R.P. J. Immunol. 2002; 168: 1372-1379Crossref PubMed Scopus (72) Google Scholar). A plasmid with β-galactosidase gene driven by a CMV promoter was obtained from Clontech. A549 cells were transfected with 1.5 μg of reporter gene (IL-8 or COX-2) and 1.5 μg of expression vector. 0.2 μgof β-galactosidase/CMV plasmid was added as a control for transfection efficiency. Cells were transfected in 6-well dishes (PGS Scientific, Bethesda, MD) using LipofectAMINE Plus reagent (Invitrogen) for 4 h in serum-free Ham's F-12K medium (containing 2 mm l-glutamine). After transfection, medium was replaced with standard Ham's F-12K medium containing 10% fetal bovine serum and cells were maintained for 16 h. After exposure to cPLA2 or sPLA2 activators as described below, cells were washed three times in ice-cold phosphate-buffered saline and lysed using Passive Lysis Buffer (Promega, Madison, WI). Cell lysate was frozen at –80 °C. Luciferase activity was measured using a luciferase assay system (Promega) with a Turner TD20 luminometer (Promega). β-Galactosidase was measured using a Beta-Gal enzyme-linked immunosorbent assay kit (Roche Applied Science). Immunoblotting—A549 cells were grown on 6-well dishes and treated with 1 μm calcium ionophore A23187 (Calbiochem) for 8 h. In experiments involving cPLA2 or sPLA2 inhibitors, the inhibitors were added to medium (at the specified concentration) for 2 h before the experiments and maintained throughout the time of exposure to calcium ionophore or EGF. The vehicle, Me2SO or methyl acetate, was added to control cultures. Cells were harvested with trypsin (E-PET, Biofluids, Rockville, MD), scraped, collected, and washed three times with cold 1× phosphate-buffered saline. Cells were transferred to 0.5 ml of homogenization buffer containing 50 mm Hepes (pH 8.0), 1 mm EDTA, 1 mm EGTA, 100 μm leupeptin, 1 mm dithiothreitol, 10 mm phenylmethylsulfonyl fluoride, 0.5 mm soybean trypsin inhibitor, 15 mm aprotinin, and 0.25% Triton X-100. Cells were sonicated three times for 15 s and centrifuged at 1,000 × g for 5 min. Total protein of the cell lysate was assayed by BCA reagent (Pierce). Samples containing 20 μg of crude cell lysate protein were separated on 8 or 11% Tris-glycine gels (Invitrogen) using 1× Tris-glycine SDS running buffer. The separated proteins were electrophoretically transferred onto nitrocellulose membranes (Invitrogen). The membranes were then blocked using 5% nonfat dry milk with 0.1% Tween 20 for 2 h at room temperature. Protein expression was detected by using a 1:1000 dilution of rabbit anti-human PPAR-γ1 or -γ2 antibody or a 1:200 dilution of rabbit anti-human COX-2 antibody (Cayman Chemical) and a 1:1000 dilution of horseradish peroxidase-conjugated mouse anti-rabbit IgG as the second antibody (Jackson ImmunoResearch Laboratory, Inc., West Grove, PA). The blot was developed using the ECL Western blotting detection system (Amersham Biosciences) and exposed to Eastman Kodak MR radiographic film for 1 min. Arachidonic Acid Release from A549 Cells—Whole cell arachidonic acid release was performed as described previously (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). Briefly cells grown in 6-well dishes were transfected with expression vector or empty vector as described above. After 4 h, medium was changed, and cells were labeled for 16 h with 1 μCi/ml [5,6,8,9,11,12,14,15-3H]arachidonic acid ([3H]arachidonic acid) (214 Ci/mmol) (Amersham Biosciences) in Ham's F-12K medium with 10% fetal bovine serum. Subsequently cells were washed and treated with or without IL-1β. At the end of the 4-h treatment period, medium was harvested and centrifuged at 1000 × g for 5 min. An aliquot of medium was transferred to scintillation vials containing 10 ml of Bio-Safe II scintillation fluid (Research International Products Inc., Mount Prospect, IL) and counted in an LS 6500 scintillation counter (Beckman). Gene Expression Measurements Using a Real Time Polymerase Chain Reaction—Cells were grown as described above and exposed to EGF, A23187, or MAFP. Total RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA). IL-8 and COX-2 expression was measured using a real time PCR mRNA quantification using a TaqMan system (Applied Biosystems, Foster City, CA). COX-2 probe and primer sets were obtained from Synthegen (Houston, TX). To measure COX-2 mRNA expression, the following primer sequences were used based on mRNA sequence (GenBank™ accession number U04636): forward primer, 5′-GCTCAAACATGATGTTTGCATTC-3′; reverse primer, 5′-GCTGGCCCTCGCTTATGA-3′; probe sequence, 5′-TGCCCAGCACTTCACGCATCAGTT-3′. Commercially available probe and primer sets from Applied Biosystems were used to measure IL-8 and RNase P1 expression. 1 μg of total RNA was reverse transcribed using a reverse transcription kit from Applied Biosystems. Real time polymerase chain reaction was conducted using an Applied Biosystems kit and run on a 7900HT instrument (Applied Biosystems) according to the manufacturer's manual using RNase P1 gene as a standard. Relative gene expression is presented as a -fold induction as compared with control ± S.E. Transfection of A549 Cells with Small Inhibitory RNA (siRNA) Directed against PPAR-γ—siRNAs targeting bases 4–23 of the PPAR-γ1 and 4–24 of the PPAR-γ2 coding sequences were obtained from Integrated DNA Technologies (Coralville, IA). Untemplated TTs were added to the 3′-end of each strand. The siRNA sequences were 5′-GUUGACACAGGAUGCCAUUTT-3′ (PPAR-γ1) and 5′-GGUGAAACUCUGGGAGAUUCTT-3′ (PPAR-γ2). The single-stranded siRNAs were annealed by incubating a 100 mm concentration of each single strand in annealing buffer (100 mm potassium acetate, 30 mm Hepes, pH 7.4, 2 mm magnesium acetate) for 2 min at 90 °C and slowly cooled down to room temperature. Cells grown in 6-well plates were transfected with 100 nm siRNA duplexes using LipofectAMINE reagent (Invitrogen) (5 ml in 1 ml of culture medium) for 5 h. After transfection, medium was changed, and cells were maintained in medium with fetal bovine serum for 16 h. The effect of siRNA on PPAR-γ1 and -γ2 protein expression was assessed by immunoblotting as described above. Cells were then treated with or without A23187 or EGF as specified below. The effect of treatment of cells with siRNA duplexes on IL-8 protein levels was determined by enzyme-linked immunosorbent assay of cellular supernatants and for COX-2 protein expression by immunoblotting of cell lysates. Transfection of A549 Cells with siRNA Directed against cPLA2— RNA-DNA chimeras were synthesized by Integrated DNA Technologies. The sequence used to generate 100 nmol of siRNA duplex was: 5′-AAC UCU AGG GAC AGC AAC AUU TT; the complementary sequence was 5′-AAU GUU GCU GUC CCU AGA GUU TT, which corresponds to bases 299–319 of the cPLA2 coding sequence (GenBank™ accession number M68874). The annealing procedure was performed as described above. Medium (Ham's F-12 with glutamine) was incubated with LipofectAMINE (5 μl/ml) (Invitrogen) with or without siRNA duplex (final concentration, 20 nm) for 20 min at room temperature. Cells were treated for 5 h at 37 °C. Medium was then changed to Ham's F-12 with glutamine and fetal bovine serum, and the cells were incubated an additional 72 h. Cell lysate was collected for cPLA2 Western blots. The remaining cells were incubated for 8 h with medium alone, A23187(10–6m), or EGF (20 ng/ml). Medium was collected for IL-8 assay by enzyme-linked immunosorbent assay, and cell lysate was collected for COX-2 and cPLA2 Western blots. Electrophoretic Mobility Shift Assay—PPRE probes were synthesized by Keystone Laboratories (Camarillo, CA) corresponding to PPRE sequences (underlined) present in the COX-2 (5′-GAGGCGACAGGTCATAACCCTACT-3′) and IL-8 promoters (5′-GGGTCCTCAGAGGTCAGACTTGGTGT-3′). The inverted PPRE sequence in the COX-2 promoter is at –3599 to –3573 relative to the transcription start site and is present as bases of –3542 to –3565 in GenBank™ accession number AF044206. The IL-8 PPRE sequence represents bases –1070 to –1045 relative to the transcription start site and is present as bases 412–437 of GenBank™ accession number M28130. Single-stranded nucleotides were reannealed by heating to 95 °C for 5 min and cooled down slowly to room temperature. A549 cells were incubated with and without A23187 (10–6m) or EGF (10 ng/ml) for 30 min, 1 h, and 2 h prior to harvest at the 2-h time point. Nuclear extracts were prepared using a nuclear extraction kit according to the manufacturer's directions (Sigma). DNA binding was performed by incubating 3 μg of nuclear protein in a total volume of 10 μl of binding buffer (50 mm NaCl, 10 mm Tris-HCl, pH 7.5, 0.5 mm dithiothreitol, 0.5 mm EDTA, 1 mm MgCl2, 0.05 μg/μl poly(dI-dC)·poly(dI-dC), 15% glycerol) and 10,000 cpm 32P-labeled double-stranded PPRE probes for 20 min at room temperature. The specificity of protein binding to labeled probe was assessed by competition with unlabeled probe or with PPRE consensus sequence. For the competition experiments, a 100× excess of unlabeled probe or PPRE consensus sequence (CAAAACTAGGTCAAAGGTCA) (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the electrophoretic mobility shift assay mixture. Nuclear protein derived from cells exposed to A23187 (1 μm) for 60 min was utilized for these experiments. Protein-DNA complexes were resolved on a 6% DNA retardation gel (Invitrogen) in 0.5× Tris-borate-EDTA buffer at 200 V for 30 min. The dried gel was exposed to x-ray film (Kodak) with an intensifying screen at –70 °C overnight or until adequate signal was developed. An Amersham Biosciences 301 computing densitometer was used to digitize images. Statistical Analysis—Statistical analysis was performed using Microsoft Excel 2000 (Redmond, WA) software run on an iMAC computer (Apple, Cupertino, CA). Comparisons were performed using two-tailed unpaired Student's t tests. Values of p < 0.05 were considered statistically significant. The Influence of cPLA2 Activation on IL-8 and COX-2 mRNA Levels—Real time polymerase chain reaction was used to study change in steady state levels of IL-8 and COX-2 mRNA after treatment. Calcium ionophore A23187 and EGF increased both IL-8 and COX-2 mRNA levels as shown in Fig. 1, A and B. Treatment with the calcium ionophore A23187 resulted in an increase in IL-8 and COX-2 mRNA levels. The increase in the IL-8 transcript was present even after 24 h. By this time, the COX-2 mRNA levels had returned to control levels (Fig. 1A). EGF treatment of A549 cells also resulted in an increase in steady state mRNA levels for both IL-8 and COX-2. This effect was transient for COX-2 and disappeared after 2 h. IL-8 mRNA levels were still increased at the 24-h time point (Fig. 1B). These effects were in part decreased by MAFP as shown in Fig. 1, C and D. The Influence of cPLA2 Activation on IL-8 Reporter Gene Activity: the Effect of MAFP, a cPLA2 Inhibitor—To test whether cPLA2 overexpression might induce IL-8 transcription, a reporter gene assay was used. Cells were transfected with an IL-8 reporter gene and cotransfected with a cPLA2 expression vector or empty vector. Twenty-four hours after transfection, cells were exposed for 4 h to culture medium with Me2SO, A23187 (10–6m), or EGF (20 ng/ml) to activate cPLA2. cPLA2 overexpression induced an increase in IL-8 reporter gene activity as shown on Fig. 2A. When transfected cells were stimulated by A23187 (10–6m) for 4 h, IL-8 reporter gene activity was increased as compared with cells treated with Me2SO (A23187 vehicle). These results suggest that both cPLA2 activation and cPLA2 overexpression and activation induce IL-8 reporter gene activity. Further cPLA2 activation induced by EGF caused a similar effect on IL-8 reporter gene activity (Fig. 2B). The effect of cPLA2 activation (either by A23187 or EGF) was in part inhibited by preincubation with a specific cPLA2 inhibitor, MAFP (10 μm), as shown in Fig. 2, A and B. The Influence of cPLA2 Activation on COX-2 Reporter Gene Activity: the Effect of MAFP, a cPLA2 Inhibitor—Similar experiments were performed to test the hypothesis that cPLA2 overexpression might induce COX-2 transcription. cPLA2 overexpression induced an increase of COX-2 reporter gene activity as shown on Fig. 2C. When transfected cells were stimulated with A23187 (10–6m) for 4 h, COX-2 reporter gene activity was increased compared with cells treated with Me2SO (A23187 vehicle). These data suggest that both cPLA2 activation and cPLA2 overexpression and activation induce COX-2 reporter gene activity. Furthermore treatment of cells with EGF produced a similar effect on COX-2 reporter gene activity. The effect of EGF was also in part inhibited by preincubation with a specific cPLA2 inhibitor, MAFP (10 μm), as shown on Fig. 2D. The Influence of sPLA2 Group IIA, sPLA2 Group V, and sPLA2 Group X Activation on IL-8 and COX-2 Reporter Gene Activity—cPLA2 is not the only phospholipase A2 expressed in human lung cells. Therefore, we used vectors overexpressing sPLA2 Group IIA, Group V, and Group X proteins and tested whether overexpression of these enzymes might influence IL-8 and COX-2 reporter gene activity. IL-1β is known to induce the release of sPLA2 from the cells to the medium. This process is associated with an increase in sPLA2 enzyme activity in the extracellular space, activated by the calcium levels present in the medium. Previously we have shown that transfection of cells with an sPLA2 Group IIA expression vector induces an increase in arachidonic acid release (4Pawliczak R. Han C. Huang X.L. Demetris A.J. Shelhamer J.H. Wu T. J. Biol. Chem. 2002; 277: 33153-33163Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). In Fig. 3, A and B, we present evidence that transfection of cells with sPLA2 Group V or Group X vectors, respectively, results in increased arachidonate release compared with cells transfected with empty vectors. These data suggest that these vectors produce functionally active proteins enhancing arachidonate release. Fig. 4, A, B, and C, demonstrate the lack of activation of IL-8 reporter gene in cells transfected with expression vectors encoding sPLA2 Group IIA, V, or X. In all three cases, an increase in sPLA2 activity is associated with a decrease in IL-8 reporter gene activity suggesting the possibility of an inhibitory effect of secreted phospholipase products on IL-8 transcription. Fig. 5, A, B, and C, demonstrate the influence of sPLA2 activation on COX-2 reporter gene activity. Transfection of cells with expression vectors encoding for Group IIA, V, or X isoforms of secreted phospholipases A2 did not activate COX-2

Referência(s)