Portal de Periódicos da CAPES

Influence of polymorphisms in VDR and COLIA1 genes on the risk of osteoporotic fractures in aged men

2003; Elsevier BV; Volume: 63; Linguagem: Inglês

10.1046/j.1523-1755.63.s85.5.x

1523-1755

Daniel Álvarez-Hernández, Manuel Naves‐Díaz, J. Bernardino Díaz-López, Carlos García Gómez, Iñigo Santamarı́a, Jorge B. Cannata‐Andía,

Bone Metabolism and Diseases

Influence of polymorphisms in VDR and COLIA1 genes on the risk of osteoporotic fractures in aged men.BackgroundOsteoporosis in chronic renal failure is a common finding caused by several factors, including age. In the last decade, the likely effect of genetic markers related with the appearance and evolution of osteoporosis has been mainly studied in women, with no categorical results. The aim of this study was to assess the influence of polymorphisms of the vitamin D receptor (VDR) and COLIA1 genes on the risk of osteoporotic fractures in men older than 50 years.MethodsThe study population comprised 156 men, aged 64 ± 9 (50–86), randomly selected from the population list of Oviedo, Spain. Prevalent vertebral fractures and incident non-vertebral fractures were identified, as well as several genetic polymorphisms. Prevalent vertebral fractures were considered according to the Genant grade 2 classifications. The analyzed genetic polymorphisms were located on restriction sites BsmI (B,b), ApaI (A,a), and TaqI (T,t) in the VDR and on Sp1 (S,s) in COLIA1.ResultsAlthough none of the VDR gene polymorphisms separately analyzed showed any differences between fractured and non-fractured men, the utilization of haplotypes could be employed in order to find osteoporotic fractures in men. By contrast, the COLIA1 polymorphism was associated with osteoporotic fractures. The percentage of prevalent vertebral fractures was significantly higher in the "ss" genotype with respect to the other genotypes. These results show that in men, the "ss" genotype of COLIA1 polymorphism could be the best osteoporotic fracture risk genetic predictor, independent of bone mass values. Influence of polymorphisms in VDR and COLIA1 genes on the risk of osteoporotic fractures in aged men. Osteoporosis in chronic renal failure is a common finding caused by several factors, including age. In the last decade, the likely effect of genetic markers related with the appearance and evolution of osteoporosis has been mainly studied in women, with no categorical results. The aim of this study was to assess the influence of polymorphisms of the vitamin D receptor (VDR) and COLIA1 genes on the risk of osteoporotic fractures in men older than 50 years. The study population comprised 156 men, aged 64 ± 9 (50–86), randomly selected from the population list of Oviedo, Spain. Prevalent vertebral fractures and incident non-vertebral fractures were identified, as well as several genetic polymorphisms. Prevalent vertebral fractures were considered according to the Genant grade 2 classifications. The analyzed genetic polymorphisms were located on restriction sites BsmI (B,b), ApaI (A,a), and TaqI (T,t) in the VDR and on Sp1 (S,s) in COLIA1. Although none of the VDR gene polymorphisms separately analyzed showed any differences between fractured and non-fractured men, the utilization of haplotypes could be employed in order to find osteoporotic fractures in men. By contrast, the COLIA1 polymorphism was associated with osteoporotic fractures. The percentage of prevalent vertebral fractures was significantly higher in the "ss" genotype with respect to the other genotypes. These results show that in men, the "ss" genotype of COLIA1 polymorphism could be the best osteoporotic fracture risk genetic predictor, independent of bone mass values. Reduction in bone mass in chronic renal failure occurs depending upon the stage of renal failure and also on osteoporosis caused by age. Many candidate genes are involved in the onset of osteoporosis. Since an initial report finding a relationship between the vitamin D receptor (VDR) gene polymorphisms and bone mass1.Morrison N.A. Qi J.C. Tokita A. et al.Prediction of bone density from vitamin D receptor alleles.Nature. 1994; 367: 284-287Crossref PubMed Scopus (1706) Google Scholar, a number of studies subsequently carried out using this gene polymorphism have reached differing conclusions2.Houston L.A. Grant S.F. Reid D.M. Ralston S.H. Vitamin D receptor polymorphism, bone mineral density, and osteoporotic vertebral fracture: Studies in a UK population.Bone. 1996; 18: 249-252Abstract Full Text PDF PubMed Scopus (152) Google Scholar,3.Hustmyer F.G. Peacock M. Hui S. et al.Bone mineral density in relation to polymorphism at the vitamin D receptor gene locus.J Clin Invest. 1994; 94: 2130-2134Crossref PubMed Scopus (237) Google Scholar. In addition, other candidate genes, such as collagen type I, have been studied4.Grant S.F. Reid D.M. Blake G. et al.Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I alpha 1 gene.Nat Genet. 1996; 14: 203-205Crossref PubMed Scopus (565) Google Scholar,5.Uitterlinden A.G. Burger H. Huang Q. et al.Relation of alleles of the collagen type Ialpha1 gene to bone density and the risk of osteoporotic fractures in postmenopausal women.N Engl J Med. 1998; 338: 1016-1021Crossref PubMed Scopus (386) Google Scholar; however, the effect of these polymorphisms seems to be less strong that the initial studies reported6.Cooper G.S. Umbach D.M. Are vitamin D receptor polymorphisms associated with bone mineral density? A meta-analysis.J Bone Miner Res. 1996; 11: 1841-1849Crossref PubMed Scopus (372) Google Scholar,7.Mann V. Hobson E.E. Li B. et al.A COL1A1 Sp1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality.J Clin Invest. 2001; 107: 899-907Crossref PubMed Scopus (368) Google Scholar. Various suggestions have been made as to why these discrepancies exist, including ethnic, racial, or environmental differences among the populations studied. Other possible explanations include an inadequate population sample, therefore resulting in a lack of statistical data in order to detect the discrepancies, or, in many cases, the absence of a proper population selection criterion. Although it has always been recognized that osteoporosis has a higher prevalence in women, in recent years many studies have begun focusing on its effect on men. The few studies which have dealt with genetic polymorphisms and fractures in men have been carried out in populations in which the number of subjects was low8.Langdahl B.L. Ralston S.H. Grant S.F. Eriksen E.F. An Sp1 binding site polymorphism in the COLIA1 gene predicts osteoporotic fractures in both men and women.J Bone Miner Res. 1998; 13: 1384-1389Crossref PubMed Scopus (163) Google Scholar,9.Langdahl B.L. Gravholt C.H. Brixen K. Eriksen E.F. Polymorphisms in the vitamin D receptor gene and bone mass, bone turnover and osteoporotic fractures.Eur J Clin Invest. 2000; 30: 608-617Crossref PubMed Scopus (97) Google Scholar. Only one study was performed with a suitable number of people10.McGuigan F.E. Armbrecht G. Smith R. et al.Prediction of osteoporotic fractures by bone densitometry and COLIA1 genotyping: A prospective, population-based study in men and women.Osteoporos Int. 2001; 12: 91-96Crossref PubMed Scopus (52) Google Scholar; however, it focused on the risk of incident fractures. The aim of this study was to evaluate the effect of the VDR and collagen type I gene polymorphisms on the prevalence and incidence of osteoporotic fractures in a male study group monitored over an eight-year follow-up period. The study group consisted of 156 men aged 50 and above, mean age 64 ± 9 (range, 50–86), randomly selected from the population list of Oviedo who had previously participated in the European Vertebral Osteoporosis Study (EVOS)11.O'Neill T.W. Felsenberg D. Varlow J. et al.The prevalence of vertebral deformity in european men and women: The European Vertebral Osteoporosis Study.J Bone Miner Res. 1996; 11: 1010-1018Crossref PubMed Scopus (798) Google Scholar. They underwent several biochemical marker tests and bone mineral density measurements. Each participant had two lateral radiographs of the dorsal and lumbar spinal area to check for any vertebral fractures. Vertebral fracture was defined using the Genant grade 2 method12.Genant H.K. Wu C.Y. van Kuijk C. Nevitt M.C. Vertebral fracture assessment using a semiquantitative technique.J Bone Miner Res. 1993; 8: 1137-1148Crossref PubMed Scopus (2396) Google Scholar. This method uses more restrictive criteria than Genant grade 1, therefore minimizing the presence of fractures caused by trauma, which a radiographic analysis alone will not always accurately determine. In short, all vertebrae between T4 and L4 were diagnosed as being fractured when a reduction of at least 25% in the anterior, medium, or posterior length was detected. The subject was only diagnosed as having an osteoporotic vertebral fracture when a wedge, biconcavity, or crush of at least grade 2 in one of the 13 analyzed vertebrae was present. All subjects were prospectively monitored by four postal questionnaires over an eight-year period in order to find out if any incident osteoporotic fracture of nonvertebral site had occurred. A peripheral blood sample was taken from all subjects so that DNA could be later extracted and analyzed to determine the different VDR and collagen type I gene polymorphisms. A fragment of 1365 bp of the VDR gene (spanning intron 8 and exon 9) containing BsmI, ApaI, and TaqI target sites was then amplified by polymerase chain reaction (PCR) using the following primers: forward: GCAGAGTGTGCAGGCGATTCG and reverse: TGAAGCTCGTGTTCCCCGCAAT in a 30 μL reaction volume. PCR conditions were 30 seconds at 95°C, 15 seconds at 64°C, and 25 seconds at 72°C for 30 cycles. The PCR product was divided into three different aliquots and digested with the BsmI, ApaI, and TaqI restriction enzymes (Stratagene, La Jolla, CA, USA). The samples were then electrophoresed in a 2% agarose gel. The absence of the target site for the three endonucleases produced a single band of 1365 bp (alleles B, A, and T for BsmI, ApaI, and TaqI, respectively). The allele "b" (BsmI) produced two bands of 113 and 1252 bp, the allele "a" (ApaI) 284 and 1081 bp, and the allele "t" (TaqI) 208 and 1157 bp. To avoid technical and analytic problems, the digestion of the three recognition sites was performed individually and the complete digestion of the PCR products for each of the restriction enzymes used was confirmed. The three VDR gene polymorphisms were grouped into the most common haplotypes (more than 95% of the sample): baT, bAT, and BAt. To obtain the different haplotypes we combined the BB and Bb genotypes for "B" allele, AA and Aa for "A" allele, and Tt and tt for "t" allele. A guanine-to-thymidine polymorphism in the Sp1 binding site in the COLIA1 gene was determined by PCR using a mismatched primer to introduce a diallelic Msc1 restriction site, as previously described4.Grant S.F. Reid D.M. Blake G. et al.Reduced bone density and osteoporosis associated with a polymorphic Sp1 binding site in the collagen type I alpha 1 gene.Nat Genet. 1996; 14: 203-205Crossref PubMed Scopus (565) Google Scholar. Under these conditions, the assay discriminates two alleles, G and T, which correspond to the presence of guanine and thymidine, respectively, as the first base in the Sp1-binding site in the first intron of the COLIA1 gene. The PCR conditions were 15 seconds at 95°C, 15 seconds at 68°C, and 20 seconds at 72°C for 35 cycles. The PCR product was digested with the Van91 I restriction enzyme (New England Biolabs, Beverly, MA, USA) and electrophoresed in 2% agarose. For the statistical analysis of the results, the proportional fracture of the different polymorphisms was carried out using the chi-square test. Likewise, the relative risks of both prevalent vertebral fracture and incidental nonvertebral fracture were calculated, with 95% confidence interval in each of the studied alleles, respectively. Statistical significance was considered to be P < 0.05. No differences between the different gene polymorphisms and age, body mass index, or lumbar and neck bone mineral density (BMD) were found Table 1.Table 1Characteristics of population by VDR and COLIA1 gene polymorphismsBB (N = 25)Bb (N = 77)bb (N = 52)AA (N = 37)Aa (N = 72)aa (N = 25)TT (N = 47)Tt (N = 67)tt (N = 20)SS (N = 85)Ss (N = 37)ss (N = 11)Age years63±965±864±966±964±865±964±966±962±865±964±861±8BMI kg/m227.9±3.127.4±3.327.3±3.527.6±2.727.5±3.627.3±3.527.3±3.627.3±3.328.7±2.827.5±3.527.6±3.026.9±3.6BMD lumbar g/cm21.072±0.1921.013±0.1511.010±0.1561.044±0.1901.017±0.1621.030±0.1261.020±0.1571.019±0.1771.065±0.1271.0716±0.1671.060±0.1310.993±0.200BMD neck g/cm20.854±0.1460.803±0.1180.804±0.1230.825±0.1490.816±0.1190.805±0.1310.800±0.1350.818±0.1120.850±0.1590.801±0.1270.849±0.1400.820±0.115Abbreviations are: BMI, body mass index; BMD, bone mineral density; VDR, vitamin D receptor. Open table in a new tab Abbreviations are: BMI, body mass index; BMD, bone mineral density; VDR, vitamin D receptor. The presence of prevalent vertebral fractures was not associated with any of the three VDR gene polymorphisms studied Table 2; however, baT and BAt haplotypes showed less vertebral fracture than the bAT haplotype (P = 0.023).Table 2Distribution of BsmI, ApaI, and TaqI genotypes and VDR haplotypes in fractured and non-fractured menFracturedNon-fracturedGenotypes BsmI BB3 (12.0%)22 (88.0%) Bb9 (13.2%)68 (96.8%) bb8 (15.4%)44 (84.6%)χ2=0.818Genotypes ApaI AA4 (10.8%)33 (89.2%) Aa12 (16.7%)60 (83.3%) aa1 (4.0%)24 (96.0%)χ2=0.240Genotypes TaqI TT7 (14.9%)40 (85.1%) Tt7 (10.4%)60 (89.6%) tt7 (15.0%)17 (85.0%)χ2=0.738VDR haplotypes baT1 (4.2%)23 (95.8%) bAT6 (31.6%)13 (68.4%) BAt10 (11.6%)76 (88.4%)χ2=0.023 Open table in a new tab The "ss" genotype of the collagen type I gene polymorphism was associated with a high frequency of prevalent vertebral fracture when compared with the rest of the genotypes (P = 0.003) Table 3. The presence of the "ss" genotype increased the risk of vertebral fracture by a factor of 6 and 14, respectively, compared with SS and Ss genotypes. When the prevalent vertebral fracture was associated with incident nonvertebral fracture, which occurred during the follow-up period, this relative risk factor rose to 6.6 and 21, respectively. Incident nonvertebral fractures were not associated with the collagen type I gene polymorphism.Table 3Distribution of COLIA1 genotypes in fractured and non-fractured menFracturedNon-fracturedGenotypes SS10 (11.8%)75 (88.2%) Ss2 (5.4%)35 (94.6%) ss5 (45.5%)6 (54.5%)χ2 (genotypes)χ2=11.42SignificanceP=0.003Prevalent vertebral fracture ss vs. SSaRelative risk and 95% confidence interval6.3 (1.6–24.3)Prevalent vertebral fracture ss vs. SsaRelative risk and 95% confidence interval14.6 (2.3–92.6)Incident osteoporotic fractures ss vs. SSaRelative risk and 95% confidence interval5.2 (0.4–66.7)Incident osteoporotic fractures ss vs. SsaRelative risk and 95% confidence interval5.9 (0.3–121.9)Prevalent vertebral fracture + incident osteoporotic fracture ss vs. SSaRelative risk and 95% confidence interval6.6 (1.8–25.0)Prevalent vertebral fracture + incident osteoporotic fracture ss vs. SsaRelative risk and 95% confidence interval21.0 (3.3–133.3)a Relative risk and 95% confidence interval Open table in a new tab The genotypic distribution of the different VDR gene polymorphisms has proved to be similar to other Caucasian populations6.Cooper G.S. Umbach D.M. Are vitamin D receptor polymorphisms associated with bone mineral density? A meta-analysis.J Bone Miner Res. 1996; 11: 1841-1849Crossref PubMed Scopus (372) Google Scholar,13.Marco M.P. Martinez I. Amoedo M.L. et al.Vitamin D receptor genotype influences parathyroid hormone and calcitriol levels in predialysis patients.Kidney Int. 1999; 56: 1349-1353Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar. Although the COLIA1 gene polymorphism showed a slightly higher proportion of "ss" subjects compared with other populations8.Langdahl B.L. Ralston S.H. Grant S.F. Eriksen E.F. An Sp1 binding site polymorphism in the COLIA1 gene predicts osteoporotic fractures in both men and women.J Bone Miner Res. 1998; 13: 1384-1389Crossref PubMed Scopus (163) Google Scholar, 14.Garnero P. Borel O. Grant S.F. et al.Collagen Ialpha1 Sp1 polymorphism, bone mass, and bone turnover in healthy French premenopausal women: The OFELY study.J Bone Miner Res. 1998; 13: 813-817Crossref PubMed Scopus (125) Google Scholar, 15.Keen R.W. Woodford-Richens K.L. Grant S.F. et al.Association of polymorphism at the type I collagen (COL1A1) locus with reduced bone mineral density, increased fracture risk, and increased collagen turnover.Arthritis Rheum. 1999; 42: 285-290Crossref PubMed Scopus (101) Google Scholar, 16.Weichetova M. Stepan J.J. Michalska D. et al.COLIA1 polymorphism contributes to bone mineral density to assess prevalent wrist fractures.Bone. 2000; 26: 287-290Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, the random recruitment of subjects minimizes any selection bias in this population. In our study of males with a mean age similar to that of our dialysis population, the presence of a specific genotype of collagen type I gene polymorphism was related with a high frequency of fractures. However, this relationship was not observed in any of the different VDR gene polymorphisms analyzed. Langdahl et al8.Langdahl B.L. Ralston S.H. Grant S.F. Eriksen E.F. An Sp1 binding site polymorphism in the COLIA1 gene predicts osteoporotic fractures in both men and women.J Bone Miner Res. 1998; 13: 1384-1389Crossref PubMed Scopus (163) Google Scholar noted that the COLIA1 Sp1 polymorphism was significantly associated with osteoporotic vertebral fractures in men, and the effect on fracture risk appears to be independent, in part, of BMD. Some studies in women using a population of limited size failed to detect a significant difference between COLIA1 alleles and bone mass or osteoporotic fractures, however17.Aerssens J. Dequeker J. Peeters J. et al.Polymorphisms of the VDR, ER and COLIA1 genes and osteoporotic hip fracture in elderly postmenopausal women.Osteoporos Int. 2000; 11: 583-591Crossref PubMed Scopus (77) Google Scholar, 18.Hustmyer F.G. Liu G. Johnston C.C. et al.Polymorphism at an Sp1 binding site of COL1A1 and bone mineral density in premenopausal female twins and elderly fracture patients.Osteoporos Int. 1999; 9: 346-350Crossref PubMed Scopus (55) Google Scholar, 19.Liden M. Wilen B. Ljunghall S. Melhus H. Polymorphism at the Sp 1 binding site in the collagen type I alpha 1 gene does not predict bone mineral density in postmenopausal women in Sweden.Calcif Tissue Int. 1998; 63: 293-295Crossref PubMed Scopus (70) Google Scholar, 20.Lander E.S. Schork N.J. Genetic dissection of complex traits.Science. 1994; 265: 2037-2048Crossref PubMed Scopus (2678) Google Scholar. It is currently unclear whether the differences between different studies represent true heterogeneity between populations in terms of the contribution that COLIA1 alleles make to regulation of bone mass and fracture risk, or to other factors, such as small sample size, population admixture, or patient selection. The collagen type I is the most abundant protein in bone that takes part in the skeleton, and therefore its coding gene has been considered a possible regulator of bone mass. Any variations in its composition could condition more or less stability, resulting in the appearance of fractures. In fact, functional studies have found that the unfavorable genotype in the collagen type I gene polymorphism is associated with osteoporosis due to: (1) evidence of allele-specific differences in binding of the Sp1 protein to the polymorphic recognition site; (2) differences in allele-specific transcription; (3) differences in collagen protein production with an increase in collagen (type I) chain α1 compared with the collagen chain α2; and (4) differences in bone strength in samples derived from patients of different genotype7.Mann V. Hobson E.E. Li B. et al.A COL1A1 Sp1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality.J Clin Invest. 2001; 107: 899-907Crossref PubMed Scopus (368) Google Scholar,21.Qureshi A.M. McGuigan F.E. Seymour D.G. et al.Association between COLIA1 Sp1 alleles and femoral neck geometry.Calcif Tissue Int. 2001; 69: 67-72Crossref PubMed Scopus (50) Google Scholar. In keeping with previous studies10.McGuigan F.E. Armbrecht G. Smith R. et al.Prediction of osteoporotic fractures by bone densitometry and COLIA1 genotyping: A prospective, population-based study in men and women.Osteoporos Int. 2001; 12: 91-96Crossref PubMed Scopus (52) Google Scholar, we found a small effect of the "s" allele on new fractures. However, the low number of fractures that occurred and also the power to detect any effect was limited. On the other hand, vitamin D plays a central role in calcium homoeostasis by regulating calcium absorption, bone resorption, bone cell differentiation, and parathyroid hormone secretion, so VDR could be a possible candidate gene for the regulation of bone mass. Although the contribution of VDR to genetic regulation of bone mass has been disputed22.Peacock M. Vitamin D receptor gene alleles and osteoporosis: A contrasting view.J Bone Miner Res. 1995; 10: 1294-1297Crossref PubMed Scopus (169) Google Scholar, the association between VDR and bone mass may be masked in certain populations, caused by an interaction with environmental factors such as calcium intake or vitamin D status23.Graafmans W.C. Lips P. Ooms M.E. et al.The effect of vitamin D supplementation on the bone mineral density of the femoral neck is associated with vitamin D receptor genotype.J Bone Miner Res. 1997; 12: 1241-1245Crossref PubMed Scopus (139) Google Scholar,24.Ferrari S. Rizzoli R. Chevalley T. et al.Vitamin-D-receptor-gene polymorphisms and change in lumbar-spine bone mineral density.Lancet. 1995; 345: 423-424Abstract PubMed Scopus (225) Google Scholar. Meanwhile, a previous study performed in the same cohort showed a relationship between VDR gene polymorphism and bone mass in women25.Gomez C. Naves M.L. Barrios Y. et al.Vitamin D receptor gene polymorphisms, bone mass, bone loss and prevalence of vertebral fracture: Differences in postmenopausal women and men.Osteoporos Int. 1999; 10: 175-182Crossref PubMed Scopus (50) Google Scholar, but no effect was observed in men. No association between fractures and the three VDR gene polymorphisms separately analyzed was found9.Langdahl B.L. Gravholt C.H. Brixen K. Eriksen E.F. Polymorphisms in the vitamin D receptor gene and bone mass, bone turnover and osteoporotic fractures.Eur J Clin Invest. 2000; 30: 608-617Crossref PubMed Scopus (97) Google Scholar. However, when the polymorphisms were grouped into haplotypes, the bAT haplotype was associated with vertebral fractures. Other authors using bone mass rather than fractures26.Uitterlinden A.G. Pols H.A. Burger H. et al.A large-scale population-based study of the association of vitamin D receptor gene polymorphisms with bone mineral density.J Bone Miner Res. 1996; 11: 1241-1248Crossref PubMed Scopus (219) Google Scholar found, similar to us, that the bAT haplotype was associated with a reduced BMD. The small frequency of people in the normal population with the unfavorable "ss" genotype could be a limitation in this study. However, the wide proportion between fractured patients with this genotype compared with the other genotypes and the fact that this association was also found in a group of women that participated in the same study, would exclude a casual finding. In summary, although none of the VDR gene polymorphisms separately analyzed (ApaI, BsmI, and TaqI) showed any relationship with fractures, the utilization of haplotypes could be employed in order to find osteoporotic fractures in men. In males, the "ss" genotype of COLIA1 polymorphism could be the best osteoporotic fracture risk genetic predictor, independent of bone mass values. It would be of interest to know if the same findings could be applied to our recently published results concerning male dialysis patients the same age as the general population27.Rodríguez-García M. Gómez C. Díaz López J.B. et al.Prevalencia de fracturas vertebrales y calcificaciones aórticas en pacientes en hemodiálisis: Comparación con una población de la misma edad y sexo.Nefrologia. 2003Google Scholar. This study has been supported in part by European Vertebral Osteoporosis Study (EVOS); European Community (1.991-1.993), by European Prospective Osteoporosis Study (EPOS); European Community, BIOMED 93-95; BMHI-CT 092-0182 (1.993-1.997) by Fondo de Investigaciones Sanitarias (FIS 94/1901-E), and by Fundación Renal Iñigo Alvarez de Toledo (Spain). Daniel Álvarez-Hernández was supported by the Fundación Renal Íñigo Álvarez de Toledo, Instituto Reina Sofía de Investigación, and by the FICYT (Fundación para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología). Dr. Íñigo Santamaría is a recipient of a Research Contract from Fondo Investigaciones Sanitarias (FIS 00/3161). The authors wish to thank Dr. J.R. Jiménez Blanco (Department of Radiology) for technical support and language consultants Covadonga Díaz Díaz and Francesca Pieraccini.