Molecular Evolution of the Thermosensitive PAb1620 Epitope of Human p53 by DNA Shuffling
1999; Elsevier BV; Volume: 274; Issue: 39 Linguagem: Inglês
10.1074/jbc.274.39.28042
ISSN1083-351X
AutoresDimitris P. Xirodimas, David P. Lane,
Tópico(s)Epigenetics and DNA Methylation
ResumoConformational stability of the p53 protein is an absolute necessity for its physiological function as a tumor suppressor. Recent in vitro studies have shown that wild-type p53 is a highly temperature-sensitive protein at the structural and functional levels. Upon heat treatment at 37 °C, p53 loses its wild-type (PAb1620+) conformation and its ability to bind DNA, but can be stabilized by different classes of ligands. To further investigate the thermal instability of p53, we isolated p53 mutants resistant to heat denaturation. For this purpose, we applied a recently developed random mutagenesis technique called DNA shuffling and screened for p53 variants that could retain reactivity to the native conformation-specific anti-p53 antibody PAb1620 upon thermal treatment. After three rounds of mutagenesis and screening, mutants were isolated with the desired phenotype. The isolated mutants were translated in vitro in either Escherichia colior rabbit reticulocyte lysate and characterized biochemically. Mutational analysis identified 20 amino acid residues in the core domain of p53 (amino acids 101–120) responsible for the thermostable phenotype. Furthermore, the thermostable mutants could partially protect the PAb1620+ conformation of tumor-derived p53 mutants from thermal unfolding, providing a novel approach for restoration of wild-type structure and possibly function to a subset of p53 mutants in tumor cells. Conformational stability of the p53 protein is an absolute necessity for its physiological function as a tumor suppressor. Recent in vitro studies have shown that wild-type p53 is a highly temperature-sensitive protein at the structural and functional levels. Upon heat treatment at 37 °C, p53 loses its wild-type (PAb1620+) conformation and its ability to bind DNA, but can be stabilized by different classes of ligands. To further investigate the thermal instability of p53, we isolated p53 mutants resistant to heat denaturation. For this purpose, we applied a recently developed random mutagenesis technique called DNA shuffling and screened for p53 variants that could retain reactivity to the native conformation-specific anti-p53 antibody PAb1620 upon thermal treatment. After three rounds of mutagenesis and screening, mutants were isolated with the desired phenotype. The isolated mutants were translated in vitro in either Escherichia colior rabbit reticulocyte lysate and characterized biochemically. Mutational analysis identified 20 amino acid residues in the core domain of p53 (amino acids 101–120) responsible for the thermostable phenotype. Furthermore, the thermostable mutants could partially protect the PAb1620+ conformation of tumor-derived p53 mutants from thermal unfolding, providing a novel approach for restoration of wild-type structure and possibly function to a subset of p53 mutants in tumor cells. Activation of the p53 tumor suppressor protein appears to be an integrating mechanism in response to cellular stresses such as DNA damage and oxidative stress (1Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar, 2Kastan M.B. Zhan Q. el Deiry W.S. Carrier F. Jacks T. Walsh W.V. Plunkett B.S. Vogelstein B. Fornace Jr., A.J. Cell. 1992; 71: 587-597Abstract Full Text PDF PubMed Scopus (2930) Google Scholar, 3Hall P.A. Meek D. Lane D.P. J. Pathol. 1996; 180: 1-5Crossref PubMed Google Scholar). This leads to activation of growth arrest or apoptotic pathways (4Levine A.J. Cell. 1997; 88: 323-331Abstract Full Text Full Text PDF PubMed Scopus (6740) Google Scholar, 5Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2292) Google Scholar), conferring maintenance of genomic stability (6Lane D.P. Nature. 1992; 358: 15-16Crossref PubMed Scopus (4503) Google Scholar, 7Lane D.P. Nature. 1993; 362: 786-787Crossref PubMed Scopus (348) Google Scholar). Three separate functional domains at p53 have been identified. In the N terminus (amino acids 1–43) lies the transcriptional transactivation activity of the protein (8Fields S. Jang S.K. Science. 1990; 249: 1046-1049Crossref PubMed Scopus (658) Google Scholar, 9Raycroft L. Wu H.Y. Lozano G. Science. 1990; 249: 1049-1051Crossref PubMed Scopus (497) Google Scholar, 10Scharer E. Iggo R. Nucleic Acids Res. 1992; 20: 1539-1545Crossref PubMed Scopus (162) Google Scholar, 11Unger T. Nau M.M. Segal S. Minna J.D. EMBO J. 1992; 11: 1383-1390Crossref PubMed Scopus (227) Google Scholar), whereas amino acids 100–290 form a protease-resistant hydrophobic core that is responsible for the sequence-specific DNA-binding activity (12Bargonetti J. Manfredi J.J. Chen X. Marshak D.R. Prives C. Genes Dev. 1993; 7: 2565-2574Crossref PubMed Scopus (248) Google Scholar,13Wang Y. Schwedes J.F. Parks D. Mann K. Tegtmeyer P. Mol. Cell. Biol. 1995; 15: 2157-2165Crossref PubMed Scopus (146) Google Scholar). The C terminus is composed of an oligomerization domain (amino acids 319–360) and a region that negatively regulates the sequence-specific DNA-binding activity of p53 (14Hupp T.R. Meek D.W. Midgley C.A. Lane D.P. Cell. 1992; 71: 875-886Abstract Full Text PDF PubMed Scopus (865) Google Scholar, 15Halazonetis T.D. Kandil A.N. EMBO J. 1993; 12: 5057-5064Crossref PubMed Google Scholar, 16Wang Y. Prives C. Nature. 1995; 376: 88-91Crossref PubMed Scopus (326) Google Scholar). Point mutations in the p53 gene have been identified in 50% of human tumors, indicating that p53 inactivation is an important step in tumor progression (17Hollstein M. Sidransky D. Vogelstein B. Harris C.C. Science. 1991; 253: 49-53Crossref PubMed Scopus (7461) Google Scholar, 18Hollstein M. Marion M.J. Lehman T. Welsh J. Harris C.C. Martel Planche G. Kusters I. Montesano R. Carcinogenesis ( Lond. ). 1994; 15: 1-3Crossref PubMed Scopus (198) Google Scholar, 19Nigro J.M. Baker S.J. Preisinger A.C. Jessup J.M. Hostetter R. Cleary K. Bigner S.H. Davidson N. Baylin S. Devilee P. Glover T. Collins F.S. Weston A. Modali R. Harris C.C. Vogelstein B. Nature. 1989; 342: 705-708Crossref PubMed Scopus (2572) Google Scholar). The majority of these mutations (>90%) cluster in the central core domain of the protein and are responsible for the loss of the biological activity of p53 (20Pavletich N.P. Chambers K.A. Pabo C.O. Genes Dev. 1993; 7: 2556-2564Crossref PubMed Scopus (445) Google Scholar, 21Cho Y. Gorina S. Jeffrey P.D. Pavletich N.P. Science. 1994; 265: 346-355Crossref PubMed Scopus (2150) Google Scholar). More specifically, these mutations involve either residues that make direct contact with DNA (“contact mutants”) or residues that provide structural stability and proper positioning of the DNA contact residues (“structural mutants”). Examples of contact mutants include Arg-248 and Arg-273, and those of structural mutants include Arg-175, Gly-245, Arg-249, and Arg-282 (22Arrowsmith C.H. Morin P. Oncogene. 1996; 12: 1379-1385PubMed Google Scholar). Interestingly, many of the point mutations identified in the core domain of p53 produce a change in the global conformation of the protein, which can be monitored by a set of anti-p53 monoclonal antibodies. More specifically, PAb1620 (human and mouse p53-specific) (23Milner J. Cook A. Sheldon M. Oncogene. 1987; 1: 453-455PubMed Google Scholar) and PAb246 (mouse p53-specific) (24Yewdell J.W. Gannon J.V. Lane D.P. J. Virol. 1986; 59: 444-452Crossref PubMed Google Scholar) recognize the wild-type native conformation of p53, but fail to react with most mutants found in tumors. These mutants react with PAb240 (25Gannon J.V. Greaves R. Iggo R. Lane D.P. EMBO J. 1990; 9: 1595-1602Crossref PubMed Scopus (943) Google Scholar), which recognizes denatured, but not wild-type, p53. The definition of distinct p53 conformers is simplistic, however, since it appears that p53 is a dynamic protein, adopting different conformations in vitroand in vivo. In support of this statement, Milner and Medcalf (26Milner J. Medcalf E.A. Cell. 1991; 65: 765-774Abstract Full Text PDF PubMed Scopus (535) Google Scholar) demonstrated that formation of hetero-oligomers of wild-type and mutant p53 proteins could drive the conformation of the wild-type protein into a mutant state. Furthermore, upon binding to DNA, p53 appears to switch from a PAb1620+/PAb240− to a PAb1620−/PAb240+ conformation (27Halazonetis T.D. Davis L.J. Kandil A.N. EMBO J. 1993; 12: 1021-1028Crossref PubMed Scopus (182) Google Scholar). Since these two conformations of p53 dictate the biological status of the protein, one could suggest that the balance between these two alternate states might determine the biological activity of p53 in cells. Identification of the mechanisms that govern this equilibrium could provide new insights into p53 structure/function. In vitro studies on purified wild-type p53 have shown that the native conformation of the protein is very temperature-sensitive. Incubation of p53 at physiological temperatures (37 °C) causes an irreversible transition from PAb1620+ to PAb1620− conformation and loss of the ability of p53 to act as a sequence-specific DNA-binding protein. However, p53-interacting proteins such as human HSP70, Escherichia coli DnaK, or N-terminal antibodies (DO-1, PAb1801) can protect p53 from temperature-induced denaturation, stabilizing to a certain degree the PAb1620+ conformation of the protein (28Hansen S. Hupp T.R. Lane D.P. J. Biol. Chem. 1996; 271: 3917-3924Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Similar studies have been performed on tumor-derived p53 mutants, which appear to be even less thermostable than wild-type p53, but again, N-terminal anti-p53 antibodies can partially protect these mutants from temperature-induced unfolding (29Friedlander P. Legros Y. Soussi T. Prives C. J. Biol. Chem. 1996; 271: 25468-25478Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Recently, a more quantitative approach regarding the stability of p53 has been performed using differential scanning calorimetry, where the core domains of wild-type p53 and several tumor-derived p53 mutants were subjected to urea-mediated denaturation (30Bullock A.N. Henckel J. DeDecker B.S. Johnson C.M. Nikolova P.V. Proctor M.R. Lane D.P. Fersht A.R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14338-14342Crossref PubMed Scopus (354) Google Scholar). The results of this study demonstrated that the core domain of p53 is of moderate thermodynamic stability, with all the tested mutant core domains being less stable than the wild type. All these observations provide evidence that p53 is a thermosensitive flexible protein switching between alternate conformations that can be modulated by different classes of ligands. A subset of the p53 mutations found in tumors destabilize the folded state of the protein, affecting the normal biological function of p53. To further investigate the implications of the thermosensitive phenotype of p53 regarding its biological function, we created p53 mutants able to resist temperature-dependent unfolding. For this purpose, we applied a random polymerase chain reaction (PCR) 1The abbreviations used are:PCRpolymerase chain reactionELISAenzyme-linked immunosorbent assayPBSphosphate-buffered salinePAGEpolyacrylamide gel electrophoresis-based mutagenesis technique called DNA shuffling (31Stemmer W.P.C. Nature. 1994; 370: 389-391Crossref PubMed Scopus (1624) Google Scholar, 32Matsumura I. Ellington A.D. Nat. Biotechnol. 1996; 14: 366Crossref PubMed Scopus (8) Google Scholar) and selected for p53 mutants that could resist temperature-dependent loss of PAb1620 reactivity. DNA shuffling involves random fragmentation of PCR-amplified related genes, followed by reassembly in a primerless PCR. Therefore, beneficial mutations existing in different genes can be united by homologous recombination in the same gene, mimicking the process by which proteins evolve in nature. Selected genes can then be pooled and used as a template for a new round of recombination and selection. DNA shuffling has been successfully applied for the molecular evolution of single gene products with enhanced activity (33Stemmer W.P.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10747-10751Crossref PubMed Scopus (1084) Google Scholar), improved protein folding (34Crameri A. Whitehorn E.A. Tate E. Stemmer W.P.C. Nature Biotechnol. 1996; 14: 315-319Crossref PubMed Scopus (1060) Google Scholar), or altered substrate specificity (35Zhang J.H. Dawes G. Stemmer W.P.C. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4504-4509Crossref PubMed Scopus (228) Google Scholar). polymerase chain reaction enzyme-linked immunosorbent assay phosphate-buffered saline polyacrylamide gel electrophoresis After three rounds of DNA shuffling, we isolated p53 mutants that retain PAb1620 reactivity at temperatures where wild-type p53 is completely unreactive. Sequencing and mutational analysis of the selected mutant identified a region of 20 amino acid residues in the core domain of p53 (amino acids 101–120) that is responsible for the observed thermostable phenotype. Furthermore, the thermostable mutants can partially protect the PAb1620+ conformation of tumor-derived p53 mutants from thermal unfolding, providing a novel approach to reactivate or enhance wild-type p53 activity in tumor cells. Anti-human p53 monoclonal antibodies were used in two-site ELISA or immunoprecipitations. DO-1 interacts with amino acids 20–25 (36Stephen C.W. Helminen P. Lane D.P. J. Mol. Biol. 1995; 248: 58-78Crossref PubMed Scopus (184) Google Scholar); PAb1801 interacts with amino acids 46–55 (37Banks L. Matlashewski G. Crawford L. Eur. J. Biochem. 1986; 159: 529-534Crossref PubMed Scopus (486) Google Scholar); PAb240 recognizes an epitope in the core of p53 (amino acids 213–217) (38Stephen C.W. Lane D.P. J. Mol. Biol. 1992; 225: 577-583Crossref PubMed Scopus (220) Google Scholar); and PAb421 reacts within the C terminus of p53 (amino acids 371–380) (36Stephen C.W. Helminen P. Lane D.P. J. Mol. Biol. 1995; 248: 58-78Crossref PubMed Scopus (184) Google Scholar). The cDNA encoding wild-type human p53 (1.2 kilobases) was obtained by PCR from human p53 pT7-7 (39Midgley C.A. Fisher C.J. Bartek J. Vojtesek B. Lane D. Barnes D.M. J. Cell. Sci. 1992; 101: 183-189Crossref PubMed Google Scholar) withSfiI (GGCCCAGCCGGCCATGGCCATGGAGGAGCCGCAGTCAGA) andNotI (GCGGCCGCGTCTGAGTCAGGCCCTTCTGT) primers and purified from a 1% low-melting-point agarose gel using the Wizard PCR prep DNA purification system (Promega). 2–3 μg of the purified PCR product was digested with 0.15 units of DNase I (Sigma) for 10 min at room temperature in 100 μl of 50 mm Tris-HCl (pH 7.4) and 1 mm MgCl2. The reaction was stopped by addition of 1 mm EDTA and 0.1% SDS and incubation at 65 °C for 10 min. Fragments of 100–300 base pairs were purified from a 2% low-melting-point agarose gel using the QIAEX II gel extraction kit (QIAGEN Inc.). The purified fragments were resuspended in a primerless 25-μl PCR (0.2 mm each dNTP, 2.2 mmMgCl2, 50 mm KCl, 10 mm Tris-HCl (pH 8.8), 0.1% Triton X-100, and 2.5 units of AmpliTaq (Perkin-Elmer)) at 20–30 ng/μl. A PCR program of 94 °C for 2 min and 40 cycles of 94 °C for 40 s, 53 °C for 40 s, and 72 °C for 40 s was followed in a Perkin-Elmer DNA thermal cycler. The product of this reaction was diluted 40-fold in a 50-μl PCR (0.2 mm each dNTP, 2.2 mm MgCl2, 50 mm KCl, 10 mm Tris-HCl (pH 8.8), 0.1% Triton X-100, and 5 units of AmpliTaq) with the inclusion ofSfiI/NotI primers at 0.2 pmol/μl, followed by a PCR program of 94 °C for 3 min and 25 cycles of 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 2 min. The correctly sized band (1.2 kilobases) was purified and digested withSfiI/NotI enzymes before being cloned into the pCANTAB5E phagemid vector. The in vitro recombined p53 library was transformed into HB2151 cells, plated on LB plates containing 100 μg/ml ampicillin and 2% glucose, and grown overnight at 30 °C. For each round of DNA shuffling, ∼10,000 colonies transformed with the mutated p53 library were blotted on nitrocellulose filters, and protein expression was induced overnight at room temperature on LB plates containing 100 μg/ml ampicillin and 1 mmisopropyl-β-d-thiogalactopyranoside. At this stage, the master plates were kept at 4 °C until further use. Bacterial lysis was performed by incubating the colony blot filters in PBS, 1 mm EDTA, and 0.1% Triton X-100 for 15 min at room temperature. Under these lysis conditions, the PAb1620+conformation of expressed p53 was detectable. The filters were then washed twice for 15 min with PBS containing 0.1% Tween-20 (PBST) to remove the cell debris. Subsequently, the filters were subjected to heat treatment: incubation for 15 min at 37 °C in the first round of DNA shuffling and selection and at 42 °C in the second and third rounds. After heat treatment, the filters were blocked in PBST containing 5% (w/w) Marvel (PBSTM) for 2 h and probed with PAb1620 at 2.5 μg/ml in PBSTM for 1 h before incubation with alkaline phosphatase-conjugated rabbit anti-mouse IgG (Dako D314) diluted 1:1000 in PBSTM for 1 h. Color development was performed by placing the filters in 10 ml of alkaline phosphatase buffer containing 44 μl of nitro blue tetrazolium chloride (75 mg/ml in 70% dimethylformamide) and 33 μl of 5-bromo-4-chloro-3-indolyl phosphate p-toluidine salt (50 mg/ml in dimethylformamide) and incubating for 7 min. All steps were carried out at room temperature, and the filters were washed twice for 15 min with PBST between each incubation step. For the first and second rounds, the 30 colonies from the master plates corresponding to the strongest signals were selected, pooled, and used as a template for a PCR of a new cycle of recombination and selection. After the third round, the best mutant was further characterized. The mutant cDNA after the third round of selection was subcloned into the pT7-7 prokaryotic expression vector and transformed into BL21(DE3) bacteria. Protein expression and purification on a heparin-Sepharose column (Amersham Pharmacia Biotech) were performed as described (14Hupp T.R. Meek D.W. Midgley C.A. Lane D.P. Cell. 1992; 71: 875-886Abstract Full Text PDF PubMed Scopus (865) Google Scholar), and samples were used in thermostability experiments. Equal amounts of protein were incubated at different temperatures for various periods of time. After heat treatment, the samples were transferred on ice, and serial dilutions were prepared for two-site ELISA as described below. Wild-type human p53 and p53 mutants were translated in vitro using the TnT®-coupled reticulocyte lysate system (Promega). 1 μg of p53 pT7-7 plasmids was used in 50-μl reactions together with 350 μCi of [35S]methionine, and translation was performed at 30 °C for 90 min according to the manufacturer's instructions. Further protein synthesis was blocked by adding cycloheximide at 100 μg/ml, and aliquots were used in thermostability experiments as described above. After heat treatment, the samples were transferred on ice and immunoprecipitated with 1 μg of PAb1620 in 100 μl of immunoprecipitation buffer (50 mm Tris-HCl (pH 8), 150 mm NaCl, 5 mm EDTA (pH 8), 1% Nonidet P-40, 2 mm dithiothreitol, and 2 mmphenylmethylsulfonyl fluoride) for 2 h on ice. The samples were then incubated with 20 μl of protein G beads for 45 min at 4 °C and washed three times with 200 μl of immunoprecipitation buffer. The35S-labeled immunoprecipitates were separated by 12% SDS-PAGE, and the gel was dried and exposed to x-ray film. 96-well flat-bottomed plates (Falcon 3912) were coated with 50 μl/well of purified anti-p53 monoclonal antibodies at 5 μg/ml in 0.1 mCO3/HCO3 (pH 9) at 4 °C overnight. The wells were blocked for 2 h with 200 μl of PBSTM before adding 50 μl/well of p53 samples mixed in a 1:1 ratio with PBSTM for 2 h. Detection of p53 was performed by adding 50 μl/well of anti-p53 rabbit polyclonal serum CM-1 (1:1000 in PBSTM for 1 h), followed by a 1-h incubation with 50 μl/well of horseradish peroxidase-conjugated swine anti-rabbit IgG (Dako P217; 1:1000 in PBSTM), and visualizing with 50 μl/well of TMB/H2O2 substrate (3,3′,5,5′-tetramethylbenzidine; Sigma T 2885). All steps were carried out at room temperature, and the plates were washed four times with 200 μl of PBST between each incubation step. For each protein concentration, duplicates were performed, and each experiment was repeated three times. S.D. values were derived from arithmetic means. Deletion mutants were created using the mutagenesis method described by Imai et al. (40Imai Y. Matsushima Y. Sugimura T. Terada M. Nucleic Acids Res. 1991; 19: 2785Crossref PubMed Scopus (314) Google Scholar). The sequences of the mutants were confirmed by automated sequencing performed in an ABI Prism 377 DNA sequencer. DNA shuffling was used to randomly mutagenize the human p53 cDNA and to select for mutants that retain the wild-type native conformation at temperatures where wild-type p53 becomes unfolded. For this purpose, we used, as a screening probe, the anti-p53 monoclonal antibody PAb1620, which is specific for the wild-type folded form of p53. The mutated p53 library was transformed into bacteria, and protein expression was induced on nitrocellulose filters. After cell lysis, the filters were incubated for 15 min at 37 °C in the first round of mutagenesis and screening and at 42 °C in the second and third rounds, before being probed with PAb1620 for the identification of clones expressing thermostable p53. Fig.1 shows filters from all three rounds of shuffling and screening. Wild-type human p53 was used as a control in each round, and it failed to be recognized by PAb1620 after only a 15-min incubation of the filters at 37 °C, whereas there was a clear reactivity in untreated filters. After the third cycle, we isolated single clones expressing p53 detected by PAb1620 after heat treatment. The strongest positive mutant protein (TR p53) was expressed initially in bacteria and purified through a 5-ml heparin-Sepharose column as described by Hupp et al. (14Hupp T.R. Meek D.W. Midgley C.A. Lane D.P. Cell. 1992; 71: 875-886Abstract Full Text PDF PubMed Scopus (865) Google Scholar). Purified p53 mutant protein was then analyzed by two-site ELISA for epitope availability. A panel of anti-p53 monoclonal antibodies was used to capture p53, and antibody-associated p53 protein was then detected by the anti-p53 rabbit polyclonal serum CM-1 (Fig.2, A and B). The DO-1 and PAb421 monoclonal antibodies recognize linear epitopes at the N and C termini, respectively, whereas PAb240 recognizes a linear epitope in the core domain of p53 that is cryptic in the wild-type folded core of the protein, but exposed only in point-mutated or denatured p53 (see “Experimental Procedures” and Fig.2 A). It appears that the isolated mutant protein displays decreased basal reactivity toward PAb1620 compared with wild-type p53, whereas it displayed very similar reactivity to all the other anti-p53 antibodies used (Fig. 2 C). We then addressed the question of the effect of temperature on epitope availability. Equal amounts of purified wild-type and TR p53 proteins were incubated at different temperatures for varying periods of time as described under “Experimental Procedures” before being serially diluted and added to ELISA wells precoated with anti-p53 monoclonal antibodies. As shown in Fig. 3, whereas there was no effect of temperature on the epitopes recognized by DO-1 and PAb421 (Fig. 3,A and B) for either wild-type p53 or the TR mutant, we observed profound differences in the reactivity toward the conformation-dependent antibodies, PAb1620 and PAb240 (Fig.3, C and D). Heat treatment resulted in the gradual loss of PAb1620 recognition of wild-type p53, consistent with previous reports demonstrating that p53 is a thermosensitive protein (28Hansen S. Hupp T.R. Lane D.P. J. Biol. Chem. 1996; 271: 3917-3924Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). The TR mutant, however, displayed a different phenotype; temperature stress resulted in a reproducible 30–40% increase in PAb1620 reactivity, with a concurrent 30% decrease in the PAb240 epitope availability. Maximum resistance to temperature-dependent unfolding was achieved at 42 °C since further increase in temperature up to 60 °C resulted in a progressive loss of the PAb1620-reactive epitope (data not shown).Figure 3Effect of temperature on epitope availability for the TR mutant and wild-type p53. A two-site ELISA was used to monitor the effect of temperature on linear (A andB) and conformational (C and D) epitopes of the TR mutant and wild-type human p53. Equal amounts of protein (200 ng) were incubated at different temperatures for varying periods of time. The samples were cooled on ice, and serial dilutions were prepared and added to ELISA wells precoated with anti-p53 monoclonal antibodies. As before, detection of p53-antibody interaction was performed with the anti-p53 polyclonal antibody CM-1. Shown are the means ± S.D. of three independent experiments (two wells/condition). ■, 4 °C; ⋄, 37 °C for 20 min; ○, 37 °C for 45 min; ▵, 42 °C for 45 min.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We then used thein vitro transcription/translation reticulocyte lysate system to investigate the thermostability of the isolated mutant in an alternative eukaryotic expression system. Wild-type human p53 and the TR mutant were expressed as described under “Experimental Procedures” at 30 °C for 90 min, and further transcription was inhibited by addition of cycloheximide. Equal amounts of protein were subjected to thermal treatment as described above and then immunoprecipitated with PAb1620. Fig.4 A shows that the amount of wild-type p53 recognized by PAb1620 progressively decreased after heat treatment, whereas an increasing amount of TR mutant p53 was immunoprecipitated by PAb1620, consistent with the thermostable phenotype observed using bacterially expressed protein in the ELISA. Reticulocyte lysates have recently been shown to contain Mdm2-like proteins, present in p53·DNA complexes (41Hall A.R. Milner J. Oncogene. 1997; 14: 1371-1376Crossref PubMed Scopus (10) Google Scholar). Mdm2-p53 interaction appears to be crucial for the stability of p53 in cells since Mdm2 can target p53 for rapid degradation (42Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3722) Google Scholar, 43Kubbutat M.H.G. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2847) Google Scholar, 44Bottger A. Bottger V. Sparks A. Liu W.L. Howard S.F. Lane D.P. Curr. Biol. 1997; 7: 860-869Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar). We were interested to see whether there was p53 proteolysis in our heat treatment experiments, which could lead to decreased protein levels. Fig. 4 B shows that heat treatment did not affect the overall protein levels of either wild-type or TR mutant p53. Therefore, the temperature-induced decrease in PAb1620 reactivity of wild-type p53 must be due to conformational changes and loss of native structure, which were resisted by TR mutant p53. The biochemical behavior of the thermostable mutant was consistent in both expression systems, i.e. decreased PAb1620 reactivity that is resistant to heat treatment. An interesting observation that arose from these experiments is that the isolated thermostable mutant has a much faster rate of migration compared with wild-type p53 on SDS-PAGE (Fig. 4, A and B). The explanation for this phenomenon lies in the sequence of the TR mutant described below. Sequencing of the isolated TR mutant after the third cycle revealed 14 point mutations throughout the p53 cDNA sequence resulting in 12 amino acid substitutions. Interestingly, there were also three nucleotide deletions at positions 179, 196, and 359 of the p53 cDNA sequence. During translation of the TR mutant, the coding sequence is out of frame after the first two deletions, but is back in frame after the third deletion. Therefore, the amino acid sequence from positions 60 to 120 has been replaced by a non-p53 peptide encoded by an alternative reading frame. The mutant is therefore one amino acid residue smaller than wild-type p53, which nevertheless creates a dramatic change in the migration on SDS-PAGE. We carried out mutational analysis to identify the region in the TR mutant responsible for the observed phenotype. For this purpose, we recombined different parts of the mutant cDNA onto a wild-type background. Fig. 5 shows the derived mutants and their phenotype, designated either as + or − depending on whether they behave as the thermostable TR mutant (+) or as wild-type thermosensitive p53 (−). The classifying criterion was resistance to temperature-dependent loss of PAb1620 reactivity. It appears that the region between amino acids 60 and 120 is responsible for the thermostable phenotype (mutant 6AB/3). We then created deletions in this region, which demonstrated that deletion of 20 amino acid residues (positions 101–120) in the core of p53 (mutant 6b) was necessary and sufficient for the original thermostable phenotype we observed. This phenomenon is specific for this particular region of p53 since deletion of 20 amino acid residues at the C-terminal end of the core domain of p53 (amino acids 281–300) created a mutant with wild-type thermosensitive properties (mutant 8b). It has been previously shown that N-terminal anti-p53 monoclonal antibodies can protect wild-type p53 from temperature-dependent unfolding (28Hansen S. Hupp T.R. Lane D.P. J. Biol. Chem. 1996; 271: 3917-3924Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 29Friedlander P. Legros Y. Soussi T. Prives C. J. Biol. Chem. 1996; 271: 25468-25478Abstract Full Text Full Text PDF PubMed Scopus (96) Google Schol
Referência(s)