Portal de Periódicos da CAPES

Characterization of a Novel Radiolabeled Peptide Selective for a Subpopulation of Voltage-gated Potassium Channels in Mammalian Brain

2002; Elsevier BV; Volume: 277; Issue: 6 Linguagem: Inglês

10.1074/jbc.m109886200

1083-351X

Judith Racapé, Alain Lecoq, Régine Romi‐Lebrun, Jessica Liu, Martin Köhler, María L. García, Andre Ménèz, Sylvaine Gasparini,

Neuroscience and Neuropharmacology Research

BgK, a 37-amino acid voltage-gated potassium (Kv) 1 channel blocker isolated from the sea anemone Bunodosoma granulifera, can be modified at certain positions to alter its pharmacological profile (Alessandri-Haber, N., Lecoq, A., Gasparini, S., Grangier-Macmath, G., Jacquet, G., Harvey, A. L., de Medeiros, C., Rowan, E. G., Gola, M., Ménez, A., and Crest, M. (1999) J. Biol. Chem. 274, 35653–35661). In the present study, we report the design of two BgK analogs that have been radiolabeled with 125INa. Whereas BgK(W5Y/Y26F) and its radiolabeled derivative, 125I-BgK(W5Y/Y26F), bind to Kv1.1, Kv1.2, and Kv1.6 channels with potencies similar to those for the parent peptide, BgK, BgK(W5Y/F6A/Y26F) and its monoiodo-tyrosine derivative, 125I-BgK(W5Y/F6A/Y26F), display a distinctive and unique pharmacological profile; they bind with high affinity to homomultimeric Kv1.1 and Kv1.6 channels, but not to Kv1.2 channels. Interaction of BgK(W5Y/F6A/Y26F) with potassium channels depends on the nature of a residue in the mouth of the channel, at a position that determines channel sensitivity to external tetraethylammonium. In native brain tissue, 125I-BgK(W5Y/F6A/Y26F) binds to a population of Kv1 channels that appear to consist of at least two sensitive (Kv1.1 and/or Kv1.6) subunits, in adjacent position. Given its unique pharmacological properties,125I-BgK(W5Y/F6A/Y26F) represents a new tool for studying subpopulations of Kv1 channels in native tissues. BgK, a 37-amino acid voltage-gated potassium (Kv) 1 channel blocker isolated from the sea anemone Bunodosoma granulifera, can be modified at certain positions to alter its pharmacological profile (Alessandri-Haber, N., Lecoq, A., Gasparini, S., Grangier-Macmath, G., Jacquet, G., Harvey, A. L., de Medeiros, C., Rowan, E. G., Gola, M., Ménez, A., and Crest, M. (1999) J. Biol. Chem. 274, 35653–35661). In the present study, we report the design of two BgK analogs that have been radiolabeled with 125INa. Whereas BgK(W5Y/Y26F) and its radiolabeled derivative, 125I-BgK(W5Y/Y26F), bind to Kv1.1, Kv1.2, and Kv1.6 channels with potencies similar to those for the parent peptide, BgK, BgK(W5Y/F6A/Y26F) and its monoiodo-tyrosine derivative, 125I-BgK(W5Y/F6A/Y26F), display a distinctive and unique pharmacological profile; they bind with high affinity to homomultimeric Kv1.1 and Kv1.6 channels, but not to Kv1.2 channels. Interaction of BgK(W5Y/F6A/Y26F) with potassium channels depends on the nature of a residue in the mouth of the channel, at a position that determines channel sensitivity to external tetraethylammonium. In native brain tissue, 125I-BgK(W5Y/F6A/Y26F) binds to a population of Kv1 channels that appear to consist of at least two sensitive (Kv1.1 and/or Kv1.6) subunits, in adjacent position. Given its unique pharmacological properties,125I-BgK(W5Y/F6A/Y26F) represents a new tool for studying subpopulations of Kv1 channels in native tissues. voltage-gated potassium (channel) α-dendrotoxin charybdotoxin dendrotoxin K human embryonic kidney hongotoxin1 monoiodotyrosine BgK(W5Y/Y26F) monoiodotyrosine BgK(W5Y/F6A/Y26F) monoiodo-αDTX monoiodotyrosine hongotoxin1(A19Y/Y37F) Voltage-gated potassium (Kv)1 channels regulate numerous cellular processes by controlling plasma membrane potential and electrical excitability (1Hille B. Ionic Channels of Excitable Membranes. Sinauer Associates, Inc., Sunderland, MA1992Google Scholar). The existence of a large number of pore-forming subunit genes contributes to the large diversity of potassium channels found in native tissues (2Gutman G.A. Chandy K.G. Semin. Neurosci. 1993; 5: 101-106Crossref Scopus (54) Google Scholar, 3Pongs O. FEBS Lett. 1999; 452: 31-35Crossref PubMed Scopus (155) Google Scholar). Because potassium channels are tetrameric structures (4MacKinnon R. Nature. 1991; 350: 232-235Crossref PubMed Scopus (768) Google Scholar) made up by the association of four identical or closely related subunits (5Isacoff E.Y. Jan Y.N. Jan L.Y. Nature. 1990; 345: 530-534Crossref PubMed Scopus (379) Google Scholar, 6Ruppersberg J.P. Schröter K.H. Sakmann B. Stocker M. Sewing S. Pongs O. Nature. 1990; 345: 535-537Crossref PubMed Scopus (343) Google Scholar, 7Sheng M. Liao Y.J. Jan Y.N. Jan L.Y. Nature. 1993; 365: 72-75Crossref PubMed Scopus (293) Google Scholar, 8Wang H. Kunkel D.D. Martin T.M. Schwartzkroin P.A. Tempel B.L. Nature. 1993; 365: 75-79Crossref PubMed Scopus (520) Google Scholar, 9Veh R.W. Lichtinghagen R. Sewing S. Wunder F. Grumbach I.M. Pongs O. Eur. J. Neurosci. 1995; 7: 2189-2205Crossref PubMed Scopus (287) Google Scholar, 10Shamotienko O. Parcej D.N. Dolly J.O. Biochemistry. 1997; 36: 8195-8201Crossref PubMed Scopus (122) Google Scholar, 11Coleman S.K. Newcombe J. Pryke J. Dolly J.O. J. Neurochem. 1999; 73: 849-858Crossref PubMed Scopus (131) Google Scholar), it is difficult to determine the subunit composition of a given channel in vivobased on the biophysical properties of the resultant proteins. A number of peptides isolated from scorpion, snake, and sea anemone venoms have been characterized and shown to block Kv1 channels by binding to residues located in the external vestibule of the channel (12Kaczorowski G.J. Garcia M.L. Curr. Opin. Chem. Biol. 1999; 3: 448-458Crossref PubMed Scopus (131) Google Scholar). Despite their limited selectivity for a given Kv1 subtype, these peptides represent unique pharmacological tools for studying the structure-function relationship of Kv1 channels and have proved to be important for: 1) defining the physiological role that channels play in native tissue, 2) purifying channels from native tissues and determining their subunit composition, and 3) developing the pharmacology of potassium channels (4MacKinnon R. Nature. 1991; 350: 232-235Crossref PubMed Scopus (768) Google Scholar, 12Kaczorowski G.J. Garcia M.L. Curr. Opin. Chem. Biol. 1999; 3: 448-458Crossref PubMed Scopus (131) Google Scholar, 13Parcej D.N. Scott V.E.S. Dolly J.O. Biochemistry. 1992; 31: 11084-11088Crossref PubMed Scopus (120) Google Scholar, 14Scott V.E.S. Muniz Z.M. Sewing S. Lichtinghagen R. Parcej D.N. Pongs O. Dolly J.O. Biochemistry. 1994; 33: 1617-1623Crossref PubMed Scopus (133) Google Scholar, 15Knaus H.G. Koch R.O.A. Eberhart A. Kaczorowski G.J. Garcia M.L. Slaughter R.S. Biochemistry. 1995; 34: 13627-13634Crossref PubMed Scopus (65) Google Scholar, 16Dolly J.O. Parcej D.N. J. Bioenerg. Biomembr. 1996; 28: 231-253Crossref PubMed Scopus (99) Google Scholar, 17Koch R.O. Wanner S.G. Koschak A. Hanner M. Schwarzer C. Kaczorowski G.J. Slaughter R.S. Garcia M.L. Knaus H.G. J. Biol. Chem. 1997; 272: 27577-27581Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 18Koschak A. Bugianesi R.M. Mitterdorfer J. Kaczorowski G.J. Garcia M.L. Knaus H.G. J. Biol. Chem. 1998; 273: 2639-2644Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 19Wang F.C. Parcej D.N. Dolly J.O. Eur. J. Biochem. 1999; 263: 230-237Crossref PubMed Scopus (69) Google Scholar, 20Suarez-Kurtz G. Vianna-Jorge R. Pereira B.F. Garcia M.L. Kaczorowski G.J. J. Pharmacol. Exp. Ther. 1999; 289: 1517-1522PubMed Google Scholar). Design of peptides with new pharmacological profiles should help to develop our understanding of both structure and function of Kv channels. In a previous study (21Alessandri-Haber N. Lecoq A. Gasparini S. Grangier-Macmath G. Jacquet G. Harvey A.L. de Medeiros C. Rowan E.G. Gola M. Ménez A. Crest M. J. Biol. Chem. 1999; 274: 35653-35661Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar), it was shown that the pharmacological profile of BgK, a 37-amino acid peptide from the sea anemone Bunodosoma granulifera (22Aneiros A. Garcia I. Martinez J.R. Harvey A.L. Anderson A.J. Marshall D.L. Engström Å. Hellman U. Karlsson E. Biochim. Biophys. Acta. 1993; 1157: 86-92Crossref PubMed Scopus (91) Google Scholar, 23Cotton J. Crest M. Bouet F. Alessandri N. Gola M. Forest E. Karlsson E. Castaneda O. Harvey A.L. Vita C. Ménez A. Eur. J. Biochem. 1997; 244: 192-202Crossref PubMed Scopus (97) Google Scholar, 24Dauplais M. Lecoq A. Song J. Cotton J. Jamin N. Gilquin B. Roumestand C. Vita C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1997; 272: 4302-4309Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar), can be modified by substituting certain residues. In the present study, we report the design and characterization of two novel radioligands derived from BgK,125I-BgK(W5Y/Y26F) and125I-BgK(W5Y/F6A/Y26F).125I-BgK(W5Y/Y26F) displays the same affinity and specificity toward Kv1 channel subtypes as BgK, whereas125I-BgK(W5Y/F6A/Y26F) displays a different and unique selectivity profile. In native brain tissue,125I-BgK(W5Y/F6A/Y26F) binds to a subpopulation of125I-BgK(W5Y/Y26F) receptors that appear to contain at least two sensitive, Kv1.1 and/or Kv1.6, subunits in adjacent position. Given its unique binding properties, 125I-BgK(W5Y/F6A/Y26F) represents a new pharmacological tool for studying subpopulations of Kv1 channels in native tissues. Plasmids were amplified in Escherichia coli XL1Blue or DH5α and purified using the plasmid purification kit from Qiagen (maxi protocol). cDNA encoding hKv1.2 in pGEMA was provided by Prof. Stephan Grissmer (Department of Applied Physiology, University of Ulm, Ulm, Germany). After introduction of two cloning sites by PCR (5′ BamHI and 3′ XbaI), the cDNA was cloned into the mammalian expression vector pcDNA3.1/HisC (Invitrogen). The resulting construct, whose integrity was assessed by nucleotide sequencing, encodes a channel with an N-terminal polyhistidine tag/epitope. To construct a cDNA coding for a Kv1.1-Kv1.2 dimer, human Kv1.1 and Kv1.2 DNAs were amplified from linearized plasmids with the primers CGATAGCTAGCACGCCACCATGACGGTGATGTCTGGGGAAG/CGATGGATCCCTGTTGCTGTTGCTGTTGCTGTTGCTGTTGAACATCGGTCAGTAGCTTGCTCTTATTAAC (hKv1.1), and GCATGGATCCATGACAGTGGCCACCGGAGACC/GCATCTCGAGTCAGACATCAGTTAACATTTTGG (hKv1.2), respectively. The resulting PCR fragment for Kv1.1 had a unique restriction site 5′ to ATG. The stop codon at the 3′ end was replaced by a glutamine codon, followed by a stretch of nine additional glutamine codons. After the last glutamine codon, a uniqueBamHI site was introduced, which added two additional amino acids (Gly, Ser) to the linker between Kv1.1 and Kv1.2. The PCR fragment for Kv1.2 had a BamHI site immediately before the ATG codon and a unique restriction site at the 3′ end. PCR products were generated by using Stratagene Pfu polymerase and standard protocols for this enzyme. The PCR fragments were restriction-digested, gel-purified, and ligated into the pCI-neo vector (Promega). The ligation reaction was transformed in XL1Blue bacteria. From the resulting colonies, DNA was prepared and analyzed by restriction digest and sequencing. cDNAs encoding hKv1.1, hKv1.3, and hKv1.3(H399Y) were cloned into the mammalian expression vector pCI-neo (Promega). cDNA encoding hKv1.6 was cloned into the mammalian expression vector pcDNA3 (Invitrogen), and was kindly provided by Prof. Olaf Pongs (Zentrum für Molekulare Neurobiologie, Hamburg, Germany). Native BgK, BgK analogs and αDTX were synthesized as described previously (24Dauplais M. Lecoq A. Song J. Cotton J. Jamin N. Gilquin B. Roumestand C. Vita C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1997; 272: 4302-4309Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar, 25Gasparini S. Danse J.M. Lecoq A. Pinkasfeld S. Zinn-Justin S. Young L.C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1998; 273: 25393-25403Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). DTX-K (26Strydom D.J. Nat. New Biol. 1973; 243: 88-89Crossref PubMed Scopus (24) Google Scholar) was synthesized using the same procedure as for αDTX (25Gasparini S. Danse J.M. Lecoq A. Pinkasfeld S. Zinn-Justin S. Young L.C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1998; 273: 25393-25403Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Synthetic charybdotoxin (ChTX) was purchased from Latoxan (Valence, France). 0.5 nmol of BgK, BgK(W5Y/Y26F), BgK(W5Y/F6A/Y26F), or αDTX were incubated with 80 μl of 75 mm sodium phosphate, pH 7.4, containing 1 mCi of125INa (Amersham Biosciences, Inc.), in the presence of 1 unit (7.5 μg) of bovine milk lactoperoxidase (Sigma). Two additions of 10 μl of a 50,000-fold dilution of 30% hydrogen peroxide (w/w) were carried out, at 1-min intervals. At the end of the 2-min incubation period, the reaction was stopped by addition of 0.1% trifluoroacetic acid, and the reaction mixture was injected onto a C18 column (Vydac, 4.6 × 250 mm) equilibrated with 20% solvent B (50% acetonitrile, 0.085% trifluoroacetic acid) in solvent A (0.1% trifluoroacetic acid). A 40-min linear gradient of either 20–40% (BgK) or 25–60% (αDTX) solvent B in solvent A, at a flow rate of 1 ml/min, led to the isolation of one nonradioactive and two radioactive species. Using nonradioactive iodine, these species were characterized by mass spectrometry. The first peak corresponds to native peptide, whereas the second and third peak represent the monoiodo- and diodo-derivatives of the peptide, respectively. Monoiodinated peptides (2000 Ci/mmol) were stored at 4 °C in the presence of 1 mg/ml bovine serum albumin. Hongotoxin1(A19Y/Y37F) (HgTX1(A19Y/Y37F)) was iodinated as described previously (18Koschak A. Bugianesi R.M. Mitterdorfer J. Kaczorowski G.J. Garcia M.L. Knaus H.G. J. Biol. Chem. 1998; 273: 2639-2644Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). HEK-293 or tsA-201 cells were maintained in minimal essential medium (Sigma) supplemented with 10% fetal calf serum (Sigma), 100 units/ml penicillin (Sigma), 2 mm l-glutamine (Invitrogen), 10 mg/ml streptomycin (Sigma) in a humidified 5% CO2 incubator at 37 °C. Cells were transfected using the calcium phosphate method (15 μg of DNA/10-cm diameter dish) at 50–60% confluence, and the medium was changed 24 h after transfection. Cells were collected 48 h after transfection using phosphate-buffered saline, 5 mmEDTA, and washed with phosphate-buffered saline. After centrifugation, cell pellets were frozen in liquid nitrogen. For membrane preparation, cell pellets were thawed in 10 mm Tris-HCl, pH 7.4, 1 mm EDTA (2 ml/dish) and homogenized using a glass-Teflon homogenizer. Material was subjected to centrifugation (3,000 ×g, 10 min, 4 °C), and the pellet was homogenized and processed as indicated above. Supernatants were combined, and membranes were collected by centrifugation (40,000 × g, 40 min, 4 °C), and resuspended in 10 mm Tris-HCl, pH 7.4. Membranes derived from HEK-293 cells stably transfected with Kv1.3 were prepared as described previously (27Helms L.M. Felix J.P. Bugianesi R.M. Garcia M.L. Stevens S. Leonard R.J. Knaus H.G. Koch R. Wanner S.G. Kaczorowski G.J. Slaughter R.S. Biochemistry. 1997; 36: 3737-3744Crossref PubMed Scopus (50) Google Scholar). Transient transfection of tsA-201 cells with Kv1.3(H399Y), and membrane preparations were carried out as described previously (28Hanner M. Schmalhofer W.A. Green B. Bordallo C. Liu J. Slaughter R.S. Kaczorowski G.J. Garcia M.L. J. Biol. Chem. 1999; 274: 25237-25244Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Rat brain synaptosomal membranes were prepared as described in Ref. 25Gasparini S. Danse J.M. Lecoq A. Pinkasfeld S. Zinn-Justin S. Young L.C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1998; 273: 25393-25403Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar. Protein concentration was determined according to Lowry, using bovine serum albumin as a standard. All binding assays were carried out at room temperature in a medium consisting of 20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 5 mm KCl, 0.1% bovine serum albumin. Incubations with 125I-αDTX and125I-BgK(W5Y/F6A/Y26F) were carried out for 2 h. At the end of the incubation period, samples (0.25–8 ml) were filtered through Whatman GF/C glass-fiber filters presoaked with 0.5% (w/v) polyethylenimine (Sigma). Filters were rinsed three time with 3 ml of ice-cold buffer (20 mm Tris-HCl, pH 7.4, 150 mmNaCl). Duplicate samples were run for each experimental point, and the data were averaged. Incubation of125I-HgTX1(A19Y/Y37F) with either Kv1.3 or Kv1.3(H399Y) channels was carried for 20 h, in a total volume of 6 ml. Nonspecific binding was determined in the presence of 2 nm margatoxin. At the end of the incubation period, samples were diluted with 4 ml of ice-cold 100 mm NaCl, 20 mm Tris-HCl, pH 7.4, filtered through Whatman GF/C glass-fiber filters presoaked with 0.5% polyethylenimine and rinsed twice with 4 ml of ice-cold buffer. Triplicate samples were run for each experimental point, and the data were averaged. Standard deviation of the mean was typically less than 5%. Radioactivity associated with filters was determined in a γ counter. Data from saturation experiments were analyzed according to Equation 1, where Beq is the amount of ligand bound at equilibrium, Bmaxthe maximum receptor concentration, Kd the ligand dissociation constant, and L* the free ligand concentration. Beq=(Bmax·L*)/(Kd+L*)Equation 1 Competition experiments were analyzed according to the Hill equation in Equation 2, where Beq is the amount of ligand bound at equilibrium, Bmax the amount of radioligand bound in the absence of inhibitor, I the inhibitor concentration, and nH the Hill coefficient.Beq=Bmax/(1+(I/IC50)nH)Equation 2 Ki values were calculated from IC50 values using the Cheng and Prusoff relationship (29Cheng Y.C. Prusoff W.H. Biochem. Pharmacol. 1973; 223099Crossref PubMed Scopus (12288) Google Scholar).Ki=IC50/[1+(L*/Kd)]Equation 3 Data from Fig. 4C were analyzed using either the Hill equation for a single-site model or the following equation for a two-site model, where IC501 =Ki·(1 + (L*/Kd)), andKi = 229 pm, L* = 0.77 pm, and Kd = 4.5 pm.Beq=[(20%·Bmax)/(1+(I/IC501)]+[(80%·Bmax)/(1+(I/IC502)]Equation 4 To develop new pharmacological tools for studying Kv1 channels, two analogs of BgK, a Kv1 channel blocker isolated from the sea anemone, B. granulifera (22Aneiros A. Garcia I. Martinez J.R. Harvey A.L. Anderson A.J. Marshall D.L. Engström Å. Hellman U. Karlsson E. Biochim. Biophys. Acta. 1993; 1157: 86-92Crossref PubMed Scopus (91) Google Scholar, 23Cotton J. Crest M. Bouet F. Alessandri N. Gola M. Forest E. Karlsson E. Castaneda O. Harvey A.L. Vita C. Ménez A. Eur. J. Biochem. 1997; 244: 192-202Crossref PubMed Scopus (97) Google Scholar), have been radiolabeled and used to characterize Kv1 channels. Direct iodination of BgK leads to a peptide that lacks biological activity, as inferred from its failure to bind to rat brain synaptosomal membranes. This finding is consistent with the observation that the only Tyr residue of BgK, Tyr26, is critical for conferring high affinity interaction of the peptide to either homomultimeric or native Kv1 channels (21Alessandri-Haber N. Lecoq A. Gasparini S. Grangier-Macmath G. Jacquet G. Harvey A.L. de Medeiros C. Rowan E.G. Gola M. Ménez A. Crest M. J. Biol. Chem. 1999; 274: 35653-35661Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 24Dauplais M. Lecoq A. Song J. Cotton J. Jamin N. Gilquin B. Roumestand C. Vita C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1997; 272: 4302-4309Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar, 30Racapé J. Recherche et Analyse des Éléments Moléculaires par Lesquels les Toxines Animales Lı̀ent les Canaux Kv1. Université Paris-Sud, Paris2001Google Scholar). Substitution of Phe at Tyr26 and Tyr at Trp5 led to a peptide, (BgK(W5Y/Y26F)), that can be radiolabeled without loss of biological activity. Moreover, a substitution that has been shown previously to modify the pharmacological profile of BgK for homomultimeric Kv1 channels (21Alessandri-Haber N. Lecoq A. Gasparini S. Grangier-Macmath G. Jacquet G. Harvey A.L. de Medeiros C. Rowan E.G. Gola M. Ménez A. Crest M. J. Biol. Chem. 1999; 274: 35653-35661Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 30Racapé J. Recherche et Analyse des Éléments Moléculaires par Lesquels les Toxines Animales Lı̀ent les Canaux Kv1. Université Paris-Sud, Paris2001Google Scholar) was introduced to yield BgK(W5Y/F6A/Y26F). The two BgK analogs were radiolabeled with 125INa and their monoiodo-derivatives used in radioligand binding studies using either heterologous expressed channels or channels present in native tissues. The ability of BgK peptides to interact with homomultimeric Kv1 channels was determined in radioligand binding studies using 125I-αDTX or125I-HgTX1(A19Y/Y37F) (18Koschak A. Bugianesi R.M. Mitterdorfer J. Kaczorowski G.J. Garcia M.L. Knaus H.G. J. Biol. Chem. 1998; 273: 2639-2644Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar) as radiolabeled tracers. 125I-αDTX binds to Kv1.1, Kv1.2, and Kv1.6 channels with dissociation constants (Kd) of 24 ± 9 pm (n = 4), 12 ± 2 pm (n = 3), and 36.5 ± 5 pm (n = 4), respectively. Under identical experimental conditions, 125I-HgTX1(A19Y/Y37F) binds to Kv1.3 channels with a Kd of 0.3 ± 0.04 pm (n = 3). TableI presents the results of competition experiments in which BgK analogs were evaluated for their ability to inhibit binding of these radioligands to homomultimeric Kv1.1, Kv1.2, Kv1.3, or Kv1.6 channels. BgK(W5Y/Y26F) inhibits binding of125I-αDTX to Kv1.1, Kv1.2, or Kv1.6 channels withKi values of 104 ± 6, 369 ± 17, and 14 ± 8 pm, respectively. These values are similar to those obtained with native BgK. Likewise, the potency of BgK(W5Y/Y26F) as an inhibitor of 125I-HgTX1(A19Y/Y37F) binding to Kv1.3 channels is not significantly different from that of native BgK. However, both BgK and BgK(W5Y/Y26F) display lower affinity for Kv1.3 channels than for the other Kv1 channels investigated (Table I).Table IBinding of BgK, BgK analogs, ChTX, DTX-K, 125I-BgK(W5Y/Y26F), and 125I-BgK(W5Y/F6A/Y26F) to homomultimeric Kv1 channelsA.Ki*Ki**Kv1.1Kv1.2Kv1.6Kv1.3Kv1.3(H399Y)pmpmBgK wild type34 ± 466 ± 1613 ± 1777 ± 3323.5 ± 1.9BgK(W5Y/Y26F)104 ± 6369 ± 1714 ± 81,809 ± 8244 ± 4BgK(W5Y/F6A/Y26F)215 ± 11289,200 ± 11,200162 ± 74134,400 ± 200171 ± 5ChTX101,150 ± 18,000110 ± 57NDNDNDDTX-K1.5 ± 0.52,930 ± 445394 ± 52NDNDB.KdKv1.1Kv1.2Kv1.6Kv1.3(H399Y)pm125I-BgK(W5Y/Y26F)35 ± 1877 ± 184 ± 140 ± 3125I-BgK(W5Y/F6A/Y26F)88 ± 3270 ± 27NDA, inhibition of 125I-αDTX (*) or125I-HgTx1(A19Y/Y37F) (**) binding to membranes derived from HEK-293 or tsA-201 cells expressing either homomultimeric Kv1.1, Kv1.2, Kv1.6, Kv1.3, or Kv1.3(H399Y) channels. B, binding of125I-BgK(W5Y/Y26F) and 125I-BgK(W5Y/F6A/Y26F) to membranes derived from HEK-293 or tsA-201 cells expressing either homomultimeric Kv1.1, Kv1.2, Kv1.6, or Kv1.3(H399Y) channels. ND, not determined. Open table in a new tab A, inhibition of 125I-αDTX (*) or125I-HgTx1(A19Y/Y37F) (**) binding to membranes derived from HEK-293 or tsA-201 cells expressing either homomultimeric Kv1.1, Kv1.2, Kv1.6, Kv1.3, or Kv1.3(H399Y) channels. B, binding of125I-BgK(W5Y/Y26F) and 125I-BgK(W5Y/F6A/Y26F) to membranes derived from HEK-293 or tsA-201 cells expressing either homomultimeric Kv1.1, Kv1.2, Kv1.6, or Kv1.3(H399Y) channels. ND, not determined. Iodination of BgK(W5Y/Y26F) results in a peptide,125I-BgK(W5Y/Y26F), that displays a binding capacity of 87–89% as determined in an analysis of specific bindingversus protein concentration using rat brain synaptosomal membranes (data not shown). 25I-BgK(W5Y/Y26F) binds with picomolar affinities to Kv1.1 (Kd = 35 ± 18 pm (n = 3)), Kv1.2 (Kd = 77 ± 18 pm(n = 3)), and Kv1.6 channels (Kd = 4 ± 1 pm (n = 3)) (Table I), but no specific binding was detected with homomultimeric Kv1.3 channels. Consistent with previous results using BgK(F6A) (21Alessandri-Haber N. Lecoq A. Gasparini S. Grangier-Macmath G. Jacquet G. Harvey A.L. de Medeiros C. Rowan E.G. Gola M. Ménez A. Crest M. J. Biol. Chem. 1999; 274: 35653-35661Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar), BgK(W5Y/F6A/Y26F) displays much lower affinity for Kv1.2 and Kv1.3 channels than BgK(W5Y/Y26F). The affinity of BgK(W5Y/F6A/Y26F) for Kv1.6 and Kv1.1 channels is, however, not much different from that of BgK(W5Y/Y26F). As a consequence, the potency of BgK(W5Y/F6A/Y26F) for either Kv1.1 or Kv1.6 channels (Ki values of 215 ± 11 and 162 ± 74 pm, respectively) is 3 orders of magnitude higher than for Kv1.2 and Kv1.3 channels (289,200 ± 11,200 and 134,400 ± 200 pm, respectively). Iodination of BgK(W5Y/F6A/Y26F) yields a peptide,125I-BgK(W5Y/F6A/Y26F), that displays a binding capacity of 87% as determined using the same procedure described above for 125I-BgK(W5Y/Y26F) (data not shown).125I-BgK(W5Y/F6A/Y26F) binds to Kv1.1 and Kv1.6 channels with Kd values of 88 ± 32 pm(n = 3), or 70 ± 27 pm(n = 3), respectively (Fig.1, Table I), but no specific binding of the ligand can be detected with either Kv1.2 or Kv1.3 channels. It has recently been shown that substitution of Ala at position 6 alters the affinity of BgK for a Kv1.1 channel in which Tyr379, the residue that confers high sensitivity to inhibition by extracellular tetraethylammonium ion, is replaced by His, the corresponding residue present in Kv1.3 (30Racapé J. Recherche et Analyse des Éléments Moléculaires par Lesquels les Toxines Animales Lı̀ent les Canaux Kv1. Université Paris-Sud, Paris2001Google Scholar). These data suggest that the nature of the residue at that position could be a major determinant in the interaction of BgK(W5Y/F6A/Y26F) with Kv1 channels. To examine this in further detail, we determined the ability of BgK and its analogs to inhibit 125I-HgTX1(A19Y/Y37F) binding to a Kv1.3 mutant, Kv1.3(H399Y), in which His was replaced by the corresponding residue, Tyr, present in Kv1.1. Results of these experiments are presented in Table I and Fig.2 (A and B). Modification of this single residue in Kv1.3 is sufficient for enhancing the affinity of both BgK and BgK(W5Y/Y26F) by 30–40-fold (Ki values of 23.5 ± 1.9 and 44 ± 4 pm, respectively). These values are similar to those of Kv1.1 channels (Table I). Moreover, the difference in affinity between BgK(W5Y/F6A/Y26F) and BgK(W5Y/Y26F) for Kv1.3(H399Y) is 3–4-fold (Ki values of 171 ± 5 and 44 ± 4 pm, respectively), whereas it is 75-fold for Kv1.3. A double-mutant cycle analysis (31Hidalgo P. MacKinnon R. Science. 1995; 268: 307-310Crossref PubMed Scopus (425) Google Scholar) of the effects of the two substitutions, F6A in BgK (W5Y/Y26F) and H399Y in Kv1.3, yields a coupling coefficient, Ω = 19.1, corresponding to a coupling energy of 1.74 kcal/mol (Fig. 2C). This finding indicates that the two positions are not independent; the effect of F6A substitution in BgK (W5Y/Y26F) depends on the nature of the residue at the position that determines sensitivity of the channel to external tetraethylammonium. These results are consistent with data that indicate that the affinity of BgK(W5Y/F6A/Y26F) for Kv1.6, which also possesses a Tyr residue at the equivalent position, is only 10-fold lower than that of BgK(W5Y/Y26F), but is much more reduced for Kv1.2, which possesses a valine residue at that position (Table I). In contrast to results obtained with Kv1.3 channels,125I-BgK(W5Y/Y26F) binds to Kv1.3(H399Y) with aKd of 40 ± 3 pm (n= 4) (Fig. 2D, Table I). The affinity of125I-BgK(W5Y/F6A/Y26F) for Kv1.3(H399Y) could not be accurately measured because of high levels of nonspecific binding. Given that BgK(W5Y/Y26F) and BgK(W5Y/F6A/Y26F) differ in their pharmacological profile toward homomultimeric Kv1 channel subtypes, we then evaluated the effects of these peptides on heteromeric channels present in rat brain synaptic membranes. 125I-BgK(W5Y/Y26F) binds to a single class of sites with a Kd of 4.5 ± 1 pm and a Bmax of 2.7 ± 0.3 pmol/mg of protein (n = 4) (Fig.3A). Using the same membrane preparation, and under the same experimental conditions,125I-αDTX binds to a single class of sites (Bmax value of 2.6 ± 0.7 pmol/mg of protein) with a Kd of 3.5 ± 1.7 pm(n = 5), a value virtually identical to that published previously (25Gasparini S. Danse J.M. Lecoq A. Pinkasfeld S. Zinn-Justin S. Young L.C. de Medeiros C.L.C. Rowan E.G. Harvey A.L. Ménez A. J. Biol. Chem. 1998; 273: 25393-25403Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Binding of both 125I-BgK(W5Y/Y26F) and125I-αDTX to brain membranes is sensitive to inhibition by αDTX, BgK, BgK(W5Y/Y26F), and BgK(W5Y/F6A/Y26F), andKi values for these peptides are similar regardless of the radioligand used (Table II). These data indicate that the concentration of binding sites labeled by both125I-BgK(W5Y/Y26F) and 125I-αDTX, as well as the affinities of these sites for αDTX, BgK, BgK(W5Y/Y26F), and BgK(W5Y/F6A/Y26F) are similar and suggest that both radioligands bind to the same receptor population in rat brain membranes. DTX-K inhibits binding of 125I-BgK(W5Y/Y26F) (Fig.4A) and125I-αDTX (data not shown) with Hill coefficients lower than 1, indicating that this peptide distinguishes between several subpopulations of these receptors. These data are consistent with previous observations suggesting that 125I-αDTX receptors do not form a homogeneous population (14Scott V.E.S. Muniz Z.M. Sewing S. Lichtinghagen R. Parcej D.N. Pongs O. Dolly J.O. Biochemistry. 1994; 33: 1617-1623Crossref PubMed Scopus (133) Google Scholar).Table IIBinding of 125I-BgK(W5Y/Y26F) and125I-BgK(W5Y/F6A/Y26F) to heteromeric Kv1 channels: effect of ChTX, αDTX, BgK, and BgK analogsA.KdRat brain Kv1 channelsHeteromeric Kv1.1–Kv1.2 channelspm125I-BgK(W5Y/Y26F)4.5 ± 18.6 ± 1.8125I-BgK(W5Y/F6A/Y26F)71 ± 252-a125I-BgK(W5Y/F6A/Y26F) binds to 18 ± 6% of the receptors recognized by125I-BgK(W5Y/Y26F) in rat brain and to 44 ± 14% of the heteromeric Kv1.1