Cre Induces an Asymmetric DNA Bend in Its Target loxP Site
2003; Elsevier BV; Volume: 278; Issue: 25 Linguagem: Inglês
10.1074/jbc.m302272200
ISSN1083-351X
AutoresLinda Lee, Linda C. Chu, Paul D. Sadowski,
Tópico(s)RNA Interference and Gene Delivery
ResumoCre initiates recombination by preferentially exchanging the bottom strands of the loxP site to form a Holliday intermediate, which is then resolved on the top strands. We previously found that the scissile AT and GC base pairs immediately 5′ to the scissile phosphodiester bonds are critical in determining this order of strand exchange. We report here that the scissile base pairs also influence the Cre-induced DNA bends, the position of which correlates with the initial site of strand exchange. The binding of one Cre molecule to a loxP site induces a ∼35° asymmetric bend adjacent to the scissile GC base pair. The binding of two Cre molecules to a loxP site induces a ∼55° asymmetric bend near the center of the spacer region with a slight bias toward the scissile A. Lys-86, which contacts the scissile nucleotides, is important for establishing the bend near the scissile GC base pair when one Cre molecule is bound but has little role in positioning the bend when two Cre molecules are bound to a loxP site. We present a model relating the position of the Cre-induced bends to the order of strand exchange in the Cre-catalyzed recombination reaction. Cre initiates recombination by preferentially exchanging the bottom strands of the loxP site to form a Holliday intermediate, which is then resolved on the top strands. We previously found that the scissile AT and GC base pairs immediately 5′ to the scissile phosphodiester bonds are critical in determining this order of strand exchange. We report here that the scissile base pairs also influence the Cre-induced DNA bends, the position of which correlates with the initial site of strand exchange. The binding of one Cre molecule to a loxP site induces a ∼35° asymmetric bend adjacent to the scissile GC base pair. The binding of two Cre molecules to a loxP site induces a ∼55° asymmetric bend near the center of the spacer region with a slight bias toward the scissile A. Lys-86, which contacts the scissile nucleotides, is important for establishing the bend near the scissile GC base pair when one Cre molecule is bound but has little role in positioning the bend when two Cre molecules are bound to a loxP site. We present a model relating the position of the Cre-induced bends to the order of strand exchange in the Cre-catalyzed recombination reaction. The Cre recombinase of bacteriophage P1 assists in the efficient segregation of the low copy P1 plasmid by resolving dimeric lysogenic P1 plasmids into monomeric units (1Austin S. Ziese M. Sternberg N. Cell. 1981; 25: 729-736Abstract Full Text PDF PubMed Scopus (220) Google Scholar). Cre is a member of the λ integrase or tyrosine recombinase family of conservative site-specific recombinases (2Hoess R.H. Abremski K. Eckstein F. Lilley D.M.J. Nucleic Acids and Molecular Biology. 4. Springer-Verlag, Berlin1990: 99-109Google Scholar, 3Sadowski P.D. FASEB J. 1993; 7: 760-767Crossref PubMed Scopus (104) Google Scholar, 4Landy A. Curr. Opin. Genet. Dev. 1993; 3: 699-707Crossref PubMed Scopus (85) Google Scholar, 5Jayaram M. Tribble G. Grainge I. Craig N.L. Craigie R. Gellert M. Lambowitz A.M. Mobile DNA II. ASM Press, Washington, D. C.2002: 192-218Crossref Google Scholar). The tyrosine recombinases share a common mechanism of catalysis. A conserved tyrosine (Tyr-324 in Cre) serves as the catalytic nucleophile that cleaves a specific phosphodiester bond in the DNA target sequence and attaches the recombinase to the DNA via a 3′-phosphotyrosine bond (see Fig. 1a below) (3Sadowski P.D. FASEB J. 1993; 7: 760-767Crossref PubMed Scopus (104) Google Scholar, 4Landy A. Curr. Opin. Genet. Dev. 1993; 3: 699-707Crossref PubMed Scopus (85) Google Scholar, 5Jayaram M. Tribble G. Grainge I. Craig N.L. Craigie R. Gellert M. Lambowitz A.M. Mobile DNA II. ASM Press, Washington, D. C.2002: 192-218Crossref Google Scholar, 6Argos P. Landy A. Abremski K. Egan J.B. Haggard L.E. Hoess R.H. Kahn M.L. Kalionis B. Narayana S.V. Pierson L.d. Sternberg N. Leong J.M. EMBO J. 1986; 5: 433-440Crossref PubMed Scopus (374) Google Scholar, 7Abremski K.E. Hoess R.H. Protein Engineering. 1992; 5: 87-91Crossref PubMed Scopus (153) Google Scholar, 8Nash H. Neidhardt F. Curtiss R. Ingraham J. Lin E. Low K. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. ASM Press, Washington, D. C.1996: 2363-2376Google Scholar, 9Nunes-Düby S.E. Kwon H.J. Tirumalai R.S. Ellenberger T. Landy A. Nucleic Acids Res. 1998; 26: 391-406Crossref PubMed Scopus (365) Google Scholar). Recombination proceeds via two sequential strand exchanges, forming a four-armed Holliday structure as an intermediate (10Holliday R. Genet. Res. 1964; 5: 282-304Crossref Scopus (1261) Google Scholar, 11Hoess R. Wierzbicki A. Abremski K. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6840-6844Crossref PubMed Scopus (131) Google Scholar, 12Nunes-Düby S. Matsumoto L. Landy A. Cell. 1987; 50: 779-788Abstract Full Text PDF PubMed Scopus (185) Google Scholar, 13Kitts P.A. Nash H.A. Nature. 1987; 329: 346-348Crossref PubMed Scopus (127) Google Scholar, 14Kitts P.A. Nash H.A. Nucleic Acids Res. 1988; 16: 6839-6856Crossref PubMed Scopus (47) Google Scholar, 15Meyer-Leon L. Huang L.C. Umlauf S.W. Cox M.M. Inman R.B. Mol. Cell. Biol. 1988; 8: 3784-3796Crossref PubMed Scopus (43) Google Scholar, 16Jayaram M. Crain K.L. Parsons R.L. Harshey R.M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7902-7906Crossref PubMed Scopus (58) Google Scholar, 17Arciszewska L.K. Sherratt D.J. EMBO J. 1995; 14: 2112-2120Crossref PubMed Scopus (72) Google Scholar).The DNA target sequence for the Cre protein is called loxP (Fig. 1b) and consists of two identical 13-bp inverted symmetry elements surrounding an 8-bp asymmetric sequence (18Hoess R.H. Ziese M. Sternberg N. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 3398-3402Crossref PubMed Scopus (236) Google Scholar). This 8-bp sequence defines the orientation of the loxP site, and we refer to it as the “spacer” region. Each symmetry element serves as a site for sequence-specific binding of a Cre monomer (19Hoess R. Abremski K. Sternberg N. Cold Spring Harbor Symp. Quant. Biol. 1984; 49: 761-768Crossref PubMed Scopus (36) Google Scholar, 20Hoess R. Abremski K. Irwin S. Kendall M. Mack A. J. Mol. Biol. 1990; 216: 873-882Crossref PubMed Scopus (47) Google Scholar, 21Van Duyne G.D. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 87-104Crossref PubMed Scopus (191) Google Scholar). The scissile phosphodiester bonds are 6 bp apart, and the Cre protein attaches covalently to the 3′-phosphoryl A residue on the top strand and the 3′-phosphoryl G residue on the bottom strand (22Hoess R.H. Abremski K. J. Mol. Biol. 1985; 181: 351-362Crossref PubMed Scopus (168) Google Scholar). We refer to these nucleotides as the “scissile A” and “scissile G,” respectively.Several crystal structures of the Cre-lox complexes have provided remarkable insights into the conformations of the various intermediates in the Cre-lox reaction (21Van Duyne G.D. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 87-104Crossref PubMed Scopus (191) Google Scholar, 23Guo F. Gopaul D.N. van Duyne G.D. Nature. 1997; 389: 40-46Crossref PubMed Scopus (476) Google Scholar, 24Gopaul D.N. Guo F. Van Duyne G.D. EMBO J. 1998; 17: 4175-4187Crossref PubMed Scopus (222) Google Scholar, 25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar, 26Gopaul D.N. Van Duyne G.D. Curr. Opin. Struct. Biol. 1999; 9: 14-20Crossref PubMed Scopus (68) Google Scholar, 27Martin S.S. Pulido E. Chu V.C. Lechner T.S. Baldwin E.P. J. Mol. Biol. 2002; 319: 107-127Crossref PubMed Scopus (46) Google Scholar). Two Cre-bound loxP sites are brought together by a cyclic network of protein-protein interactions to form an approximately square-planar synaptic complex (Fig. 1a) (21Van Duyne G.D. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 87-104Crossref PubMed Scopus (191) Google Scholar, 23Guo F. Gopaul D.N. van Duyne G.D. Nature. 1997; 389: 40-46Crossref PubMed Scopus (476) Google Scholar, 24Gopaul D.N. Guo F. Van Duyne G.D. EMBO J. 1998; 17: 4175-4187Crossref PubMed Scopus (222) Google Scholar, 25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar, 26Gopaul D.N. Van Duyne G.D. Curr. Opin. Struct. Biol. 1999; 9: 14-20Crossref PubMed Scopus (68) Google Scholar, 27Martin S.S. Pulido E. Chu V.C. Lechner T.S. Baldwin E.P. J. Mol. Biol. 2002; 319: 107-127Crossref PubMed Scopus (46) Google Scholar, 28Hamilton D.L. Abremski K. J. Mol. Biol. 1984; 178: 481-486Crossref PubMed Scopus (97) Google Scholar, 29Hoess R.H. Wierzbicki A. Abremski K. Sarma R.H. Sarma M.H. Structure & Methods Vol. 1: Human Genome Initiative & DNA Recombination. Adenine Press, Guilderland, NY1990: 203-213Google Scholar, 30Shaikh A.C. Sadowski P.D. J. Biol. Chem. 2000; 275: 30186-30195Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar). The two Cre molecules bound to a lox site are conformationally and functionally different: one is poised to cleave the DNA (“cleaving” subunit), and the other is in an inactive conformation (“non-cleaving” subunit; see Fig. 1a) (21Van Duyne G.D. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 87-104Crossref PubMed Scopus (191) Google Scholar, 23Guo F. Gopaul D.N. van Duyne G.D. Nature. 1997; 389: 40-46Crossref PubMed Scopus (476) Google Scholar, 24Gopaul D.N. Guo F. Van Duyne G.D. EMBO J. 1998; 17: 4175-4187Crossref PubMed Scopus (222) Google Scholar, 25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar, 26Gopaul D.N. Van Duyne G.D. Curr. Opin. Struct. Biol. 1999; 9: 14-20Crossref PubMed Scopus (68) Google Scholar, 27Martin S.S. Pulido E. Chu V.C. Lechner T.S. Baldwin E.P. J. Mol. Biol. 2002; 319: 107-127Crossref PubMed Scopus (46) Google Scholar).Cre catalyzes recombination with a defined order of strand exchange (see Fig. 1, a and b): it first cleaves and exchanges the two bottom strands adjacent to the scissile G nucleotide to form the Holliday intermediate (11Hoess R. Wierzbicki A. Abremski K. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6840-6844Crossref PubMed Scopus (131) Google Scholar, 29Hoess R.H. Wierzbicki A. Abremski K. Sarma R.H. Sarma M.H. Structure & Methods Vol. 1: Human Genome Initiative & DNA Recombination. Adenine Press, Guilderland, NY1990: 203-213Google Scholar, 30Shaikh A.C. Sadowski P.D. J. Biol. Chem. 2000; 275: 30186-30195Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar, 31Lee G. Saito I. Gene (Amst.). 1998; 216: 55-65Crossref PubMed Scopus (252) Google Scholar, 32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar) that is then resolved preferentially on the top strand adjacent to the scissile A nucleotide to generate reciprocal recombinant products (11Hoess R. Wierzbicki A. Abremski K. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 6840-6844Crossref PubMed Scopus (131) Google Scholar, 31Lee G. Saito I. Gene (Amst.). 1998; 216: 55-65Crossref PubMed Scopus (252) Google Scholar, 32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar, 33Lee L. Sadowski P.D. J. Biol. Chem. 2001; 276: 31092-31098Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). We found previously that the order of strand exchange was dictated primarily by the scissile base pairs at positions 4′ and 4 in the loxP site (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar, 33Lee L. Sadowski P.D. J. Biol. Chem. 2001; 276: 31092-31098Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). The order of strand exchange was reversed when the scissile base pairs were interchanged in the mutated lox4 site (see Fig. 1c). Furthermore, we found that Lys-86, which contacts the scissile nucleotides (21Van Duyne G.D. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 87-104Crossref PubMed Scopus (191) Google Scholar, 23Guo F. Gopaul D.N. van Duyne G.D. Nature. 1997; 389: 40-46Crossref PubMed Scopus (476) Google Scholar, 24Gopaul D.N. Guo F. Van Duyne G.D. EMBO J. 1998; 17: 4175-4187Crossref PubMed Scopus (222) Google Scholar, 25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar, 26Gopaul D.N. Van Duyne G.D. Curr. Opin. Struct. Biol. 1999; 9: 14-20Crossref PubMed Scopus (68) Google Scholar, 27Martin S.S. Pulido E. Chu V.C. Lechner T.S. Baldwin E.P. J. Mol. Biol. 2002; 319: 107-127Crossref PubMed Scopus (46) Google Scholar), is important for establishing the strand selectivity in the resolution of the loxP-Holliday intermediate but not in the initiation of recombination between the loxP sites (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar, 33Lee L. Sadowski P.D. J. Biol. Chem. 2001; 276: 31092-31098Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar).The crystal structure of the Cre-lox synaptic complex reveals the presence of an asymmetric DNA bend in the lox spacer region, positioned 5 bp away from the activated cleavage site (25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar). Guo et al. (25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar) proposed that the position and/or direction of the DNA bend dictate the site of initial strand exchange. In this report we have further characterized the roles of the scissile base pairs and the Lys-86 residue in the Cre-induced DNA bending to better understand the basis for the order of strand exchange. We find that Cre induces asymmetric bends in the loxP site, and the position of the bends is dictated by the scissile base pairs: the binding of one Cre molecule (complex I, cI) 1The abbreviations used are: cI, complex I; cII, complex II; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift assay; OP-Cu, 1,10-phenanthroline-copper; Wt, wild type. 1The abbreviations used are: cI, complex I; cII, complex II; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift assay; OP-Cu, 1,10-phenanthroline-copper; Wt, wild type. induces a bend near the margin of the spacer region adjacent to the scissile G nucleotide, whereas the binding of two Cre molecules (complex II, cII) induces a bend near the center of the spacer region with a slight bias toward the scissile A (see Fig. 1, b and c). Lys-86 has a role in positioning the Cre-induced bend in the loxP cI, but not in the loxP cII. Changes in the Cre-induced DNA bends within cII correlate with the site of initial strand exchange as originally proposed by Guo et al. (25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar). We present a model relating the position of the Cre-induced bends to the order of strand exchange in the Cre-catalyzed recombination reaction.EXPERIMENTAL PROCEDURESOligonucleotides, DNA Constructs, and Proteins—The S82 substrates used in the chemical footprinting experiments were constructed by annealing two 82-nucleotide complementary oligonucleotides, 5′-GATCCAGACTGCAGCG(lox)GCTAATCGATCAGAATCTGGCTATGACGATCC-3′/3′-CTAGGTCTGACGTCGC(lox)CGATTAGCTAGTCTTAGACCGATACTGCTAGG-5′, where (lox) is the lox sequence of interest (see Table I).Table IThe sequence of the lox sites studied in this reportloxSequence (top strand; 5′ →3′)aThe spacer region is in boldface type, and the vertical lines denote the middle of the spacer region. Residues in the spacer region that were mutated relative to the wild type loxP site are underlined and non-lox sequences are in lowercase.17′4′ 1′1 417loxPATAACTTCGTATAATGTATGCTATACGAAGTTATlox4ATAACTTCGTATAGTGTATGTTATACGAAGTTATloxSAATAACTTCGTATAATGTACATTATACGAAGTTATloxSBATAACTTCGTATAGCATATGCTATACGAAGTTATse aATAACTTCGTATAATGTATGCatcgacctgagctse batcgacctgagctATGTATGCTATACGAAGTTATa The spacer region is in boldface type, and the vertical lines denote the middle of the spacer region. Residues in the spacer region that were mutated relative to the wild type loxP site are underlined and non-lox sequences are in lowercase. Open table in a new tab The circularly permuted plasmids were constructed by ligating the 40 bp of annealed, complementary oligonucleotides 5′-tcgac(lox)g-3′/3′-g(lox)cagct-5′, containing the lox sequence of interest (Table I) flanked by SalI ends, into SalI-digested pBend2 (34Zwieb C. Kim J. Adhya S. Genes & Dev. 1989; 3: 606-611Crossref PubMed Scopus (73) Google Scholar). This results in the insertion of the lox site between two tandemly repeated sets of restriction enzyme sites. The circularly permuted DNA substrates were obtained by digestion of the plasmid with EcoRV, SmaI, NruI, SspI, BamHI, MluI, BglII, NheI, and SpeI, and isolation of the 162-bp digested fragments.The phasing plasmids were constructed by excising the 156-bp BamHI-BamHI DNA fragment from the plasmids pK10, pK12, pK14, pK16, pK18, and pK20 (35Zinkel S.S. Crothers D.M. Nature. 1987; 328: 178-181Crossref PubMed Scopus (221) Google Scholar) and ligating in the 90-bp annealed, complementary oligonucleotides: 5′-GATCCACGATCAGACTGCAGCCATGGCACG(lox)GCTAAGATCTCAGAATCTGGCTATCG-3′/3′-GTGCTAGTCTGACGTCGGTACCGTGC(lox)CGATTCTAGAGTCTTAGACCGATAGCCTAG-5′ containing the lox sequence of interest (Table I). Constructs containing the lox site inserted in the forward and reverse orientations were isolated. Phasing substrates were obtained by isolating the 347- to 357-bp RsaI-PvuII fragments. The loxSA site introduced a novel RsaI site in the symmetric spacer region and so the loxSA phasing substrates were obtained by PCR using the primers RsaI2959F (5′-ACATATTGTCGTTAGAACGCG-3′) and PvuII270R (5′-CTGGCTTATCGAAATTAATAC-3′). ∼0.2 μg of the loxSA phasing plasmid was amplified in 50 μl of 3 mm MgCl2, 0.4 mm of each dNTPs, 1 mm of each primers, 2.5 units of Taq polymerase (Invitrogen) for 35 PCR cycles of heating at 95 °C for 45 s, 55 °C for 1 min, and 72 °C for 1 min. The 347- to 357-bp PCR products were purified on a preparative 4% native PAGE. Note that the S182 substrates used in the recombination assays previously described (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar) were 182-bp SacI-PvuII fragments isolated from the phasing plasmids pK10LPA and pK10L4A, which are pK10-derived plasmids with the loxP and lox4 sites, respectively, inserted in the forward orientation.All oligonucleotides were synthesized by Invitrogen. The procedures for the purification of the oligonucleotides, annealing, and 5′-32P labeling the DNA substrates were as described previously (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar, 33Lee L. Sadowski P.D. J. Biol. Chem. 2001; 276: 31092-31098Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). The restriction enzymes and T4 polynucleotide kinase were from New England BioLabs. The Cre proteins were purified from an induced Escherichia coli BL21(DE3 pLysS) culture as described previously (33Lee L. Sadowski P.D. J. Biol. Chem. 2001; 276: 31092-31098Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 36Shaikh A.C. Sadowski P.D. J. Biol. Chem. 1997; 272: 5695-5702Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar).DMS Methylation Protection Analysis—2 nm S82 substrate (5′-32P-labeled on either the top or the bottom strand) was incubated with 0.5 μm Cre in 50 μl of 50 mm sodium cacodylate, pH 8, 30 mm NaCl, and 0.05 mg/ml denatured calf thymus DNA at room temperature for 15 min. The reaction was then treated with 3.3 μl of 10% DMS (v/v, diluted in ethanol, Aldrich) at room temperature for 6 min (37Beatty L.G. Sadowski P.D. J. Mol. Biol. 1988; 204: 283-294Crossref PubMed Scopus (23) Google Scholar). Analysis of a 5-μl aliquot of the DMS-treated reaction on a native 6% polyacrylamide gel showed that cII was the predominant species with some unbound substrate, cI, and higher order complexes present (data not shown) (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar). The DMS reaction was quenched as described previously (38Funnell B.E. Gagnier L. J. Biol. Chem. 1993; 268: 3616-3624Abstract Full Text PDF PubMed Google Scholar). The modified DNA was cleaved at methylated G > A residues in alkali as described by Craig and Nash (39Craig N.L. Nash H.A. Cell. 1984; 39: 707-716Abstract Full Text PDF PubMed Scopus (293) Google Scholar) and concentrated by ethanol precipitation. The cleaved DNA was analyzed by 8% denaturing PAGE (Diamed SequaGel).Dried gels were scanned using a Amersham Biosciences Phosphor-Imager and quantified using the ImageQuaNT 5.0 software program. The peak intensity of each band was expressed relative to the total intensity in the lane and then normalized to the relative intensity of the band corresponding to nucleotide “25 G” on the top strand or “19′ G” on the bottom strand (Fig. 2, a and b). The extent of protection or enhancement was calculated as a ratio of the normalized relative band intensities in the presence or absence of Cre (+ to – Cre ratio).Fig. 2DMS methylation protection of loxP and lox4 by wild type and K86A Cre proteins. A 82-bp DNA (S82) containing either the loxP site (lanes 1–4)orthe lox4 site (lanes 5–8) was 5′-radioactively labeled on the top strand (a) or the bottom strand (b).2nm DNA was incubated without (lanes 1 and 5) or with 0.5 μm of wild type (Wt), His-tagged wild type (HisWt) or HisK86A Cre protein, then treated with DMS as described under “Experimental Procedures.” The DMS-treated DNA was cleaved at methylated G and A residues with alkali and analyzed on an 8% denaturing polyacrylamide gel. Representative autoradiograms are shown. The loxP sequence corresponding to the cleaved bands are indicated to the left of the audioradiogram. The residues mutated to create lox4 are indicated in parentheses. The symmetry elements (normal type) are represented by vertical arrows, and the spacer region (boldface type)is boxed with the small arrow denoting the cleavage site. The band intensities were quantified as described under “Experimental Procedures.” The average ratios (from at least three experiments) of the normalized band intensities in the presence to absence of Cre (+ to – Cre ratio) are represented graphically on a log scale to the right of the autoradiogram. The nucleotides are numbered from the center of the lox site as shown in Fig. 1b, with the nucleotides in the spacer in boldface type and the flanking non-lox sequences in lowercase. The dotted vertical lines indicate 1.5-fold protection or enhancement (hypermethylation). Solid blue bars, loxP plus Wt Cre (non-tagged and His-tagged); striped blue bars, loxP plus K86A; solid red bars, lox4 plus Wt Cre; striped red bars, lox4 plus K86A. c, summary of the DMS footprints of the loxP and lox4 spacer region and proximal nucleotides by wild type (Wt) and K86A. Sites of protection (green diamonds) and enhancement (yellow triangles) greater than 1.5-fold are indicated. Although the scissile G at position 4′ in lox4 was protected by wild type Cre by slightly less than 1.5-fold, the protection was reproducible.View Large Image Figure ViewerDownload (PPT)OP-Cu Footprinting—2nm S82 substrate (5′-32P labeled on either the top or the bottom strand) was incubated with 1 μm Cre in 20 μl of Cre reaction buffer (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar) for 30 min at room temperature. The OP-Cu footprinting (Supplementary Data, Fig. S1) was performed as described by Sigman et al. (40Sigman D.S. Kuwabara M.D. Chen C.B. Bruice T.W. Methods Enzymol. 1991; 208: 414-433Crossref PubMed Scopus (134) Google Scholar). The chemicals used in the OP-Cu reactions (1,10-phenanthroline and 3-mercaptopropionic acid) were from Sigma. The OP-Cu reaction was quenched with 1 μl of 28 mm neocuproine (Sigma) and 100 μl of 10 mm Tris-HCl (pH 8.0), 1 mm EDTA, 0.3 m sodium acetate, 20 μg/ml yeast tRNA, followed by phenol/chloroform extraction and ethanol precipitation. The DNA was analyzed by 8% denaturing PAGE (Diamed SequaGel).Circular Permutation Analysis—The binding assay was performed by electrophoretic mobility shift assay (EMSA) as described previously (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar) with the following modifications. 2 nm 5′-32P-labeled circular permutation substrates (obtained by digestion with various restriction enzymes as described above) was incubated with 0.05 μm Cre, and the reaction was analyzed on a 5% polyacrylamide gel. Determination of the bend centers and angles by circular permutation is described in detail in the Supplementary Data (Fig. S2).Phasing Analysis—The binding assay was performed by EMSA as described previously (32Lee L. Sadowski P.D. J. Mol. Biol. 2003; 326: 397-412Crossref PubMed Scopus (33) Google Scholar) with the following modifications. 2 nm 5′-32P-labeled phasing substrates was incubated with 0.05 μm Cre, and the reaction was analyzed on a 4% polyacrylamide gel. Dried gels were scanned using an Amersham Biosciences PhosphorImager and analyzed using the ImageQuaNT 5.0 software program. The marker M bands in each lane were aligned. The phasing analysis was conducted according to the method of Zinkel and Crothers (35Zinkel S.S. Crothers D.M. Nature. 1987; 328: 178-181Crossref PubMed Scopus (221) Google Scholar) as follows. The relative electrophoretic mobility (μ) of a protein-DNA complex was calculated as the mobility of the complex divided by the mobility of the unbound substrate to correct for small variations in the mobility of the unbound substrate. The relative mobility was then normalized to the average relative mobility (μave) of the particular complex from all six phasing substrates (μ/μave). The normalized relative mobilities were plotted as a function of the linker length. The linker length is defined as the distance (bp) between the center of the kinetoplast DNA that contains the A-tracts (35Zinkel S.S. Crothers D.M. Nature. 1987; 328: 178-181Crossref PubMed Scopus (221) Google Scholar) and the middle of the lox site. The curve was plotted to the best fit polynomial curve (Microsoft Excel).RESULTSGuo and colleagues (25Guo F. Gopaul D.N. Van Duyne G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7143-7148Crossref PubMed Scopus (150) Google Scholar) have proposed that the position and/or direction of the asymmetric DNA bend in the lox spacer region revealed in the crystal structure of the Cre-lox synaptic complex determine the site of initial strand exchange. We therefore investigated whether the scissile base pairs and Lys-86 dictate the order of strand exchange by affecting the Cre-induced DNA bending. We have probed the DNA conformation of the loxP and lox4 sites (Fig. 1) bound to Cre using chemical footprinting, circular permutation, and phase-sensitive analyses.Cre Increases the Sensitivity to DMS Methylation in the loxP and lox4 Spacer Region on the Strand Containing the Scissile G—DNA footprinting provides information about protein-DNA contacts and distortions in the DNA conformation such as bending and unwinding (40Sigman D.S. Kuwabara M.D. Chen C.B. Bruice T.W. Methods Enzymol. 1991; 208: 414-433Crossref PubMed Scopus (134) Google Scholar, 41Wissmann A. Hillen W. Methods Enzymol. 1991; 208: 365-379Crossref PubMed Scopus (62) Google Scholar, 42Tullius T.D. Dombroski B.A. Churchill M.E.A. Kam L. Methods Enzymol. 1987; 155: 537-558Crossref PubMed Scopus (285) Google Scholar, 43Dixon W.J. Hayes J.J. Levin J.R. Weidner M.F. Dombroski B.A. Tullius T.D. Methods Enzymol. 1991; 208: 380-413Crossref PubMed Scopus (214) Google Scholar, 44Price M.A. Tullius T.D. Methods Enzymol. 1992; 212: 194-219Crossref PubMed Scopus (100) Google Scholar). To detect subtle changes in the DNA conformation, we probed the Cre-bound DNA using small chemical compounds. We first analyzed the sensitivity of guanine and adenine residues in the loxP and lox4 sites to methylation by dimethyl sulfate (DMS). DMS methylates the N7 group of guanine in the major groove of DNA and, to a lesser extent, the N3 group of adenine in the minor groove (41Wissmann A. Hillen W. Methods Enzymol. 1991; 208: 365-379Crossref PubMed Scopus (62) Google Scholar).An 82-bp DNA substrate (S82) containing either the wild type loxP or the mutated lox4 site was treated with DMS in the absence and presence of the wild type Cre protein (Fig. 2). The DMS footprints for the top and bottom strands are shown in Fig. 2 (a and b) and summarized in Fig. 2c. The two strands of the loxP and lox4 sites differed in the sensitivity of their spacer region to DMS modification upon binding to Cre, and the differences were dependent on the location of the scissile G. The scissile G at position 4 on the bottom strand of loxP (Fig. 2b, lane 2) was protected by the wild type Cre protein, and this protection was dependent on Lys-86 (see below). Bases 3′ to the scissile G on the bottom strand of loxP (most notably position 3′A) exhibited enhanced reactivity to DMS upon binding to Cre. These enhanced sensitivities suggested that Cre causes structural alterations in the lox spacer region, possibly due to DNA bending (see “Discussion”).Cre also protected the scissile G and enhanced the DMS methylation of downstream bases (2′G, 1A, 3G, and 5T) on the top strand of lox4 (Fig. 2a, lane 6). The increased sensitivity to DMS was stronger on the top strand of lox4 than on the bottom strand of loxP. Because T residues are normally
Referência(s)