PARP-2, A Novel Mammalian DNA Damage-dependent Poly(ADP-ribose) Polymerase
1999; Elsevier BV; Volume: 274; Issue: 25 Linguagem: Inglês
10.1074/jbc.274.25.17860
ISSN1083-351X
AutoresJean‐Christophe Amé, Véronique Rolli, Valérie Schreiber, Claude Niedergang, Françoise Apiou, Patrice Decker, Sylviane Muller, T. H. Hoger, Josiane Ménissier‐de Murcia, Gilbert de Murcia,
Tópico(s)Toxin Mechanisms and Immunotoxins
ResumoPoly(ADP-ribosylation) is a post-translational modification of nuclear proteins in response to DNA damage that activates the base excision repair machinery. Poly(ADP-ribose) polymerase which we will now call PARP-1, has been the only known enzyme of this type for over 30 years. Here, we describe a cDNA encoding a 62-kDa protein that shares considerable homology with the catalytic domain of PARP-1 and also contains a basic DNA-binding domain. We propose to call this enzyme poly(ADP-ribose) polymerase 2 (PARP-2). The PARP-2 gene maps to chromosome 14C1 and 14q11.2 in mouse and human, respectively. Purified recombinant mouse PARP-2 is a damaged DNA-binding protein in vitro and catalyzes the formation of poly(ADP-ribose) polymers in a DNA-dependent manner. PARP-2 displays automodification properties similar to PARP-1. The protein is localized in the nucleusin vivo and may account for the residual poly(ADP-ribose) synthesis observed in PARP-1-deficient cells, treated with alkylating agents or hydrogen peroxide. Poly(ADP-ribosylation) is a post-translational modification of nuclear proteins in response to DNA damage that activates the base excision repair machinery. Poly(ADP-ribose) polymerase which we will now call PARP-1, has been the only known enzyme of this type for over 30 years. Here, we describe a cDNA encoding a 62-kDa protein that shares considerable homology with the catalytic domain of PARP-1 and also contains a basic DNA-binding domain. We propose to call this enzyme poly(ADP-ribose) polymerase 2 (PARP-2). The PARP-2 gene maps to chromosome 14C1 and 14q11.2 in mouse and human, respectively. Purified recombinant mouse PARP-2 is a damaged DNA-binding protein in vitro and catalyzes the formation of poly(ADP-ribose) polymers in a DNA-dependent manner. PARP-2 displays automodification properties similar to PARP-1. The protein is localized in the nucleusin vivo and may account for the residual poly(ADP-ribose) synthesis observed in PARP-1-deficient cells, treated with alkylating agents or hydrogen peroxide. In response to DNA-strand breaks introduced either directly by ionizing radiation or indirectly following enzymatic incision at a DNA lesion, the immediate poly(ADP-ribosylation) of nuclear proteins converts the DNA ends into intracellular signals that modulate DNA repair and cell survival programs. At the sites of DNA breakage, poly(ADP-ribose) polymerase (PARP) 1The abbreviations used are: PARP, poly(ADP-ribose) polymerase; MMS, methylmethanesulfonate; EST, expressed sequence tags; FISH, fluorescence in situhybridization; PAGE, polyacrylamide gel electrophoresis; wt, wild type; aa, amino acid(s); PCR, polymerase chain reaction; bp, base pair(s); GST, glutathione S-transferase; GFP, green fluorescent protein; DAPI, 4,6-diamidino-2-phenylindole. (EC 2.4.2.30) catalyzes the transfer of the ADP-ribose moiety from its substrate NAD+, to a limited number of proteins involved in chromatin architecture, DNA repair, or in DNA metabolism including PARP itself (1Althaus F.R. Richter C. Mol. Biol. Biochem. Biophys. 1987; 37: 1-237PubMed Google Scholar, 2Lautier D. Hoflack J.C. Kirkland J.B. Poirier D. Poirier G.G. Biochim. Biophys. Acta. 1994; 1221: 215-220Crossref PubMed Scopus (18) Google Scholar, 3de Murcia G. Ménissier-de Murcia J. Trends Biochem. Sci. 1994; 19: 172-176Abstract Full Text PDF PubMed Scopus (772) Google Scholar, 4Oei S.L. Griesenbeck J. Schweiger M. Rev. Physiol. Biochem. Pharmacol. 1997; 131: 127-173PubMed Google Scholar). Recently, the generation of PARP-deficient mice by homologous recombination (5Ménissier-de Murcia J. Niedergang C. Trucco C. Ricoul M. Dutrillaux B. Mark M. Oliver F.J. Masson M. Dierich A. LeMeur M. Walztinger C. Chambon P. de Murcia G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7303-7307Crossref PubMed Scopus (978) Google Scholar, 6Wang Z.-Q. Stingl L. Morrison C. Jantsch M. Los M. Schulze-Osthoff K. Wagner E.F. Genes Dev. 1997; 11: 2347-2358Crossref PubMed Scopus (523) Google Scholar) has clearly demonstrated the involvement of PARP in the maintenance of the genomic integrity due to its role during base excision repair (7Molinete M. Vermeulen W. Burkle A. Ménissier-de Murcia J. Kupper J.-H. Hoeijmakers J.H.J. de Murcia G. EMBO J. 1993; 12: 2109-2117Crossref PubMed Scopus (226) Google Scholar, 8Masson M. Niedergang C. Schreiber V. Muller S. Ménissier-de Murcia J. de Murcia G. Mol. Cell. Biol. 1998; 18: 3563-3571Crossref PubMed Scopus (841) Google Scholar, 9Dantzer F. Schreiber V. Niedergang C. Trucco C. Flatter E. de la Rubia G. Oliver J. Rolli V. Ménissier-de Murcia J. de Murcia G. Biochimie (Paris). 1999; 81: 69-75Crossref PubMed Scopus (310) Google Scholar). An substantial delay in DNA strand-break repair was observed following treatment of PARP-deficient cells with monofunctional alkylating agents (10Trucco C. Oliver F.J. de Murcia G. Ménissier-de Murcia J. Nucleic Acids Res. 1998; 26: 2644-2649Crossref PubMed Scopus (314) Google Scholar). This severe DNA repair defect appears to be the primary cause for the observed cytotoxicity ofN-methyl-N-nitrosourea, methylmethanesulfonate (MMS), or γ-rays leading to cell death occurring after a G2/M block (10Trucco C. Oliver F.J. de Murcia G. Ménissier-de Murcia J. Nucleic Acids Res. 1998; 26: 2644-2649Crossref PubMed Scopus (314) Google Scholar). It was assumed for many years that PARP activity was associated with a single protein displaying unique DNA damage detection and signaling properties. This assumption was challenged by the recent discovery inArabidopsis thaliana of a gene coding for a PARP-related polypeptide of a calculated molecular mass of 72 kDa (11Lepiniec L. Babiychuk E. Kushnir S. Van Montagu M. Inze D. FEBS Lett. 1995; 364: 103-108Crossref PubMed Scopus (58) Google Scholar). It then became evident that two structurally different PARP proteins, both possessing DNA-dependent poly(ADP-ribose) activities, were present in both A. thaliana as well as in maize (12Babiychuk E. Cottrill P.B. Storozhenko S. Fuangthong M. Chen Y. O'Farrell M.K. Van Montagu M. Inze D. Kushnir S. Plant J. 1998; 15: 635-645Crossref PubMed Google Scholar, 13O'Farrell M. Biochimie (Paris). 1995; 77: 486-491Crossref PubMed Scopus (13) Google Scholar, 14Mahajan P.B. Zuo Z. Plant Physiol. 1998; 118: 895-905Crossref PubMed Scopus (13) Google Scholar). 2M. Kazmaier, personal communication. Furthermore, it has been reported recently that mouse embryonic fibroblasts derived from PARP knockout are capable of synthesizing ADP-ribose polymers in response to DNA damage (15Shieh W.M. Amé J.-C. Wilson M.V. Wang Z.-Q. Koh D.W. Jacobson M.K. Jacobson E.K. J. Biol. Chem. 1998; 273: 30069-30072Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar), suggesting that in mammals, like in plants, at least one additional member of the PARP family may exist in addition to the classical zinc finger containing PARP. This work describes the cloning of a human and a murine cDNA coding for a new member of the PARP family, based on its similarity with theA. thaliana 72-kDa poly(ADP-ribose) polymerase (12Babiychuk E. Cottrill P.B. Storozhenko S. Fuangthong M. Chen Y. O'Farrell M.K. Van Montagu M. Inze D. Kushnir S. Plant J. 1998; 15: 635-645Crossref PubMed Google Scholar), which those authors named APP. We denote this new protein PARP-2, to differentiate from the classical PARP protein renamed PARP-1. We demonstrate that PARP-2 is a nuclear DNA-dependent poly(ADP-ribose) polymerase catalyzing the formation of ADP-ribose polymers in the presence of damaged DNA, thus suggesting a biological role in the cellular response to DNA damage. To determine poly(ADP-ribose) synthesizing activity in cells extracts, equal amounts of protein from various cell extracts were incubated in standard conditions with 200 μm[α-32P]NAD+ (30.0 nCi/nmol), 2 μg/ml histones, and 10 μg/ml DNA activated by DNase I at 25 °C for 10 min. Activity is expressed as the ratio between the radioactivity of the acid insoluble material produced by PARP-1+/+ and PARP-1−/− cell extracts. Sequence analyses were performed using the GCG sequence analysis package (Wisconsin package version 8.1, Genetic Computer Group, Madison, WI). The primary sequence of the A. thalianaPARP homologue (APP, GenBank 228 accession number Z48243) was used to search the complete EST data base (release 107/55 of GenBank 228 data base) using TBLASTN of the BLAST program (16Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (61160) Google Scholar). Two murine and one human EST (GenBank 228 accession numbers AA608364, AA529426, and AA595596, respectively) encoding APP homologues but distinct from the classical PARP-1 of 113 kDa were chosen and purchased from the IMAGE consortium (Research Genetics, Huntsville, AL). EST clone number AA529426contained the cDNA (1.2 kilobase) encoding the catalytic domain of mouse PARP-2 (aa 199–559) in the pCMV SPORT vector (Research Genetics, Huntsville, AL). In order to express the catalytic domain of PARP-2, aSmaI site and an ATG surrounded by the translation initiation sequence (17Kozac M. Nucleic Acids Res. 1987; 15: 8125-8147Crossref PubMed Scopus (4686) Google Scholar) of PARP-1 (18Jung S. Miranda E.A. Ménissier-de Murcia J. Niedergang C. Delarue M. Schulz G.E. de Murcia G.M. J. Mol. Biol. 1994; 244: 114-116Crossref PubMed Scopus (27) Google Scholar) were created by PCR, using the sense primer AGGCCCCGGGGGGAGGATGGCGACTTTGAAGCCTGAGTCTCAG and the reverse primer CCAGCAAGGTCATAGTATAGTCC. The PCR fragment (550 bp) was restricted with SmaI-AccI, and used to replace the wild type sequence in clone AA529426. The entire catalytic fragment (homologous to domain F in Fig. 3) was thereafter excised withSmaI-NotI and cloned in the baculovirus recombination vector pVL 1393, giving pVL-mPARP-2-F. In order to generate a full-length mPARP-2 cDNA, aSalI-NotI fragment of AA529426 was used to screen a random-primed λ ZAP II cDNA library (kindly provided by J. M. Garnier, IGBMC, Illkirch, France) established from 10-day-old mouse embryos. One of the positive clones selected contained part of the murine PARP-2 cDNA, starting 45 bp upstream of the ATG and encoded aa 1 to 527 of the protein. In order to obtain good expression in the baculovirus expression system, the region around the ATG was replaced. A SmaI site and an ATG surrounded by the translation initiation sequence of PARP-1 were introduced by PCR. The primers used were, sense primer: AGGCCCCGGGGGGAGGATGGCGCCGCGGCGGCAGAGATCAGGCTCTGG, reverse primer: ATCATCATTTCTTCCATGG. After purification, the PCR product (712 bp) was restricted by SmaI-NcoI and cloned in pVL-mPARP-2-F, to generate the full-length mPARP-2 baculovirus recombination vector pVL-mPARP-2 vector. The amplified fragments were sequenced to ensure that no mutation has been introduced by the PCR. A human PARP-2 EST clone was identified in the LifeSeqTMdata base of Incyte Pharmaceuticals using the human PARP-1 sequence for a data base search. The clone (2286233) was ordered and analyzed. It started 608 bp downstream of the start codon and ended 130 bp downstream of the stop codon. A digoxigenin-labeled probe (digoxigenin labeling kit, Roche Molecular Biochemicals, Mannheim, Germany) derived from this clone was used to screen a human total brain cDNA library (CLONTECH, Palo Alto, CA). Several overlapping positive clones were isolated and sequenced. One of them had an insert length of 857 bp starting 2 nucleotides upstream of the start codon and covering 855 bp of the human PARP-2 open reading frame. These clones were used to construct a full-length human PARP-2 cDNA. Human chromosomes were prepared from human peripheral blood lymphocytes immediately after incorporation of bromodeoxyuridine. Mouse chromosomes were prepared from normal mouse fibroblast cultures. The mousePARP-1 gene was identified with a 5-kilobase clone (of the mouse PARP-1 gene), which was labeled by nick-translation with biotin-11-dUTP (Sigma, France). The PARP-2 gene was identified in the mouse by a probe biotinylated by PCR consisting of the full-length gene; and in the human by a 1.3-kilobase clone of human PARP-2 cDNA, namely, EST AA595596, which was labeled by nick-translation with biotin-11-dUTP (Sigma, France). A standard hybridization procedure was used as described previously (19Apiou F. Flagiello D. Cillo C. Malfoy B. Poupon M.F. Dutrillaux B. Cytogenet. Cell Genet. 1996; 73: 114-115Crossref PubMed Scopus (104) Google Scholar). The mouse PARP-1 probe was used at a concentration of 15 ng/ml in the presence of a 100-fold excess of mouse Cot-1 DNA; the human PARP-2 probe was used at a concentration of 20 ng/ml and the PCR probe of mouse PARP-2 at a concentration of 1 ng/ml in presence of 600-fold excess of mouse Cot-1 DNA, in 15 ml of hybridization buffer for each slide. Direct banding of bromodeoxyuridine-substituted human chromosomes was obtained by incubation in an alkaline solution ofp-phenylenediamine (PPD11) (20Lemieux N. Dutrillaux B. Viegas-Pequignot E. Cytogenet. Cell Genet. 1992; 59: 311-312Crossref PubMed Scopus (297) Google Scholar) and staining with propidium iodide. Mouse chromosomes were stained with DAPI and identified by computer-generated reverse DAPI banding. Immunochemical detection of hybridization was performed using goat anti-biotin antibodies (Vector laboratories, Burlingame, CA) and rabbit FITC-conjugated anti-goat antibodies (Biosys, Compiègne, France). Metaphases were observed under a fluorescent microscope (DMRB, Leica, Germany). Images were captured using a cooled photometrics CCD camera and Quips-smart capture software (Vysis). Poly(A)+ mRNA was purified from PARP-1+/+ and PARP-1−/− 3T3 cells using the messenger RNA isolation kit from Stratagene (La Jolla, CA). Total mouse tissues RNA was purchased from Ambion (Austin, TX). Two micrograms of poly(A)+ mRNA and 10 μg of total RNA were fractionated on 1% agarose, 2.2 m formaldehyde gels and transferred to Hybond N nylon membrane (Amersham). The murine PARP-2 probe corresponded to the 800-bp internal EcoRI fragment. The blot was hybridized for 16 h with probe labeled by the random priming method (1 × 106 cpm/ml) (21Feinberg A.P. Vogelstein B. Anal. Biochem. 1983; 132: 6-13Crossref PubMed Scopus (18880) Google Scholar) in ExpressHyb mixture (CLONTECH, Palo Alto, CA), washed, and autoradiographed at −80 °C for 48 h. Two rabbits were immunized by intramuscular injections of 200 μg of purified mPARP-2 catalytic domain (aa 204–559) in the presence of complete Freund's adjuvant for the first inoculation (day 0) and incomplete Freund's adjuvant for subsequent inoculations on days 15, 30, 45, and 60. The rabbits were bled every fortnight until week 14, beginning a week after the second injection. This antibody named YUC, raised against the PARP-2 catalytic domain, recognizes both human and murine PARP-2, but not PARP-1. Immortalized mouse embryonic fibroblasts (3T3 cells) derived from PARP-1−/− and PARP-1+/+ mice (5Ménissier-de Murcia J. Niedergang C. Trucco C. Ricoul M. Dutrillaux B. Mark M. Oliver F.J. Masson M. Dierich A. LeMeur M. Walztinger C. Chambon P. de Murcia G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7303-7307Crossref PubMed Scopus (978) Google Scholar) and HeLa cells were grown on coverslips. For PARP activity experiments, cells were exposed either to 1 mm hydrogen peroxide (Sigma) for 10 min or 1 mmMMS (Aldrich) for 30 min and fixed with methanol/acetone (1/1, v/v) for 10 min at 4 °C and washed three times with phosphate-buffered saline supplemented with Tween 0.1% (v/v). Cells were incubated overnight at 4 °C with a monoclonal anti-poly(ADP-ribose) antibody (H10) (1:200 dilution) or with the anti-PARP-2 polyclonal antibody (1:1000 dilution). After washing, the cells were incubated for 4 h at room temperature with a 1:400 dilution of FITC-conjugated anti-mouse or Texas Red-conjugated anti-rabbit antiserum. Immunofluorescence was evaluated using a Zeiss Axioplan equipped with a C5985 chilled CCD camera (Hamamatsu). A 180-bp EcoRI-EcoRI fragment corresponding to aa 1–69 of mouse PARP-2, and named mouse Nter-PARP-2, was generated by PCR from pVL-mPARP-2-F with the 5′-oligonucleotide GGATCCCGGGAATTCGGATGGCGCCGCGGCGGC and the 3′-oligonucleotide GGCTTTGCCCGAATTCTTTAACAGCAAGGTCT and cloned either into pGEX-2T expression vector or into pEGFP-C3 in-frame with the GST or GFP reading frame, respectively. The GST fusion protein was overexpressed and purified using glutathione-Sepharose 4B (Pharmacia Biotech Inc.) according to the specifications of the manufacturer. The pEGFP-Nter-PARP-2 construction was used to transfect HeLa cells, and transient expression of the GFP-Nter-PARP-2 fusion was monitored by fluorescence microscopy, 24–48 h after transfection. pVL PARP-2 and the Baculogold 228 linearized baculovirus DNA (Pharmingen) were co-transfected into Sf9 cells according to the manufacturer's instructions. Cell propagation and protein production was performed as described previously (22Miranda E.A. de Murcia G. Ménissier-de Murcia J. Braz. J. Med. Biol. Res. 1997; 30: 923-928Crossref PubMed Scopus (6) Google Scholar). The identity of the purified protein was confirmed by Western blot with the polyclonal antibody against PARP-2 (1:2000 dilution). Purification of PARP-2 was performed as described previously (23Giner H. Simonin F. de Murcia G. Ménissier-de Murcia J. Gene (Amst.). 1992; 114: 279-283Crossref PubMed Scopus (62) Google Scholar) for the purification of chicken PARP-1 catalytic domain with some modifications. Briefly, the cell pellet (1.5 × 109 cells) was homogenized in 75 ml of 100 mm Tris-HCl, pH 7.5, 0.2% Tween 20, 0.2% Nonidet P-40, 14 mm β-mercaptoethanol, 10 mmEDTA, 1 mm phenylmethylsulfonyl fluoride, 1 mNaCl and an anti-protease mixture (complete 228, Mini, Roche Molecular Biochemicals). After sonication, (1 min at 30% of the maximum output using a Branson SONIFIER large probe), the cell lysate was cleared by centrifugation at 50,000 × g for 90 min. After precipitation with protamine sulfate (1 mg/ml), and clarification by centrifugation at 50,000 × g for 25 min, the proteins precipitating at 35% ammonium sulfate saturation were eliminated by centrifugation (20,000 × g for 20 min). Further ammonium sulfate was added to the supernatant to 70% saturation and the pellet was collected after a 20-min centrifugation at 20,000 × g. The proteins were resuspended in 150 ml of 100 mm Tris-HCl, pH 7.5, 14 mm β-mercaptoethanol, 10 mm EDTA, 1 mm phenylmethylsulfonyl fluoride containing the antiprotease mixture. This sample was subjected to a 3-aminobenzamide Affi-Gel 10 column chromatography. The elution was performed with 3-methoxybenzamide and fractions containing the polypeptide were concentrated on an ultrafiltration membrane Diaflo YM30 (Amicon, Inc.). A sample of each step of the purification was stored for further analysis on SDS-PAGE and quantification of proteins by the method of Bradford (24Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (225068) Google Scholar). Immunoblots and Southwestern blot were carried out as described previously (25Mazen A. Ménissier-de Murcia J. Molinete M. Simonin F. Gradwohl G. Poirier G. de Murcia G. Nucleic Acids Res. 1989; 17: 4689-4698Crossref PubMed Scopus (98) Google Scholar). The number of PARP-2 molecules per cell was estimated in a Western blot experiment by comparing the intensity of the immunoreaction of anti-PARP-2 antibody on PARP-2 (YUC) from 400,000 HeLa cells with increasing amounts of purified PARP-2. Samples were incubated for 10 min at 25 °C in assay buffer (100 μl) consisting of 50 mm Tris-HCl, pH 8.0, 4 mm MgCl2, 0.2 mm dithiothreitol, with or without 200 ng of calf thymus DNA previously treated with DNase I and 400 μm[α-32P]NAD+ (100 nCi/nmol). The reaction was stopped by the addition of 5% (w/v) trichloroacetic acid containing 1% (w/v) inorganic phosphate, and the acid-insoluble radioactivity was washed 3 times in the same solution and once in 95% EtOH and the radioactivity was measured. The stimulation of PARP activity by DNA treated with DNase I was expressed as the ratio of the activity of PARP with activated DNA to the activity of PARP without DNA. 800 ng of purified PARP-2 was incubated with 200 ng of calf thymus DNA previously treated with DNase I or without DNA, in 100 μl containing 100 mmTris-HCl, pH 8.0, 10 mm MgCl2, 10 mm dithiothreitol, and 800 nm[α-32P]NAD+ (100 nCi/nmol) (26Mendoza-Alvarez H. Alvarez-Gonzalez R. J. Biol. Chem. 1993; 268: 22575-22580Abstract Full Text PDF PubMed Google Scholar). After the indicated time of incubation at 25 °C, the reaction was stopped with ice-cold acetone (80% v/v) and incubated for 30 min at −20 °C. Insoluble material was pelleted by centrifugation for 20 min at 4 °C, washed once with 100% acetone, once with water-saturated ether, and dried. The pellet was resolubilized in 50 μl of 1 × Laemmli buffer and analyzed on 8% SDS-PAGE. Gels were stained with Coomassie Blue, destained, dried, and autoradiographed on Kodak Bio-Max MS film. To analyze the polymer synthesized by either PARP-1 or PARP-2, samples were incubated in a standard enzymatic assay with 400 μm[α-32P]NAD+. Radioactive proteins were treated with 100 mm NaOH, 20 mm EDTA for 1 h at 60 °C (27Alvarez-Gonzalez R. Jacobson M.K. Biochemistry. 1987; 26: 3218-3224Crossref PubMed Scopus (200) Google Scholar). The solution was then neutralized with 100 mm HCl. One volume of phenol/chloroform (1:1) was added and remaining traces of phenol/chloroform were extracted from the aqueous layer three times with diethyl ether. The polymer was then precipitated twice with ethanol and the pellets were dissolved in water. The polymer was either analyzed on a sequencing gel or treated with snake venom phosphodiesterase and analyzed by two-dimensional thin-layer chromatography according to Keith et al. (28Keith G. Desgres J. de Murcia G. Anal. Biochem. 1990; 191: 309-313Crossref PubMed Scopus (39) Google Scholar). The radioactive spots on the TLC were scraped from the thin layer and32P label was determined by scintillation counting. The average polymer size and the branching frequency were calculated according to Miwa and Sugimura (29Miwa M. Sugimura T. Princess Takamatsu Symp. 1982; 12: 205-212PubMed Google Scholar). Samples were incubated for 10 min at 25 °C in assay buffer (100 μl) consisting of 50 mm Tris-HCl, pH 8.0, 4 mm MgCl2, 200 μm dithiothreitol, 200 ng of calf thymus DNA previously treated with DNase I and various concentrations of [α-32P]NAD+ (100 nCi/nmol). The reaction was stopped by the addition of 5% (w/v) trichloroacetic acid, containing 1% inorganic phosphate, and the acid-insoluble radioactivity was washed 3 times in the same solution and once in 95% EtOH and the radioactivity measured. In a previous paper (5Ménissier-de Murcia J. Niedergang C. Trucco C. Ricoul M. Dutrillaux B. Mark M. Oliver F.J. Masson M. Dierich A. LeMeur M. Walztinger C. Chambon P. de Murcia G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7303-7307Crossref PubMed Scopus (978) Google Scholar) we described the inactivation of the PARP-1 gene, in mouse by homologous recombination. Gene disruption was assessed by Southern blotting and by Western blotting using a panel of specific monoclonal and polyclonal antibodies that failed to detect the full-length PARP-1 or any of its functional NH2-terminal or COOH-terminal domains. Using low doses of damaging agents (H2O2 or MMS) that are known to trigger PARP-1 activity in wild-type (wt) cells, no ADP-ribose polymers were detected in PARP-1−/− cells (data not shown). However, high doses of damaging agents were able to trigger poly(ADP-ribose) synthesis in PARP-1+/+ cells (Fig.1, G) as well as in PARP-1-deficient cells (Fig. 1, C and E), as shown by immunofluorescence. This result suggests that there is a poly(ADP-ribose) polymerase activity distinct from PARP-1, that is activated by DNA damage. To confirm that poly(ADP-ribose) polymerase activity was present in PARP-1−/− cells and evaluate its contribution, a quantitative and qualitative analysis of the reaction products was performed. Whole cell extracts were prepared from spleen, testis, primary or 3T3 embryonic fibroblasts of PARP-1+/+ and PARP-1−/− mice, and tested for PARP activity. The results displayed in Fig. 2 A show that all PARP-1−/− cells tested display 5 to 10% of total PARP activity stimulated by DNA strand breaks, compared with wt cells. This residual activity is inhibited by 2 mm3-aminobenzamide supporting the idea of a new PARP enzyme activity. The reaction products synthesized in the presence of [α-32P]NAD+ were characterized by removing the radiolabeled material from the acceptor proteins and fractionating by electrophoresis on long 20% denaturating polyacrylamide gels. The distribution of ADP-ribose polymers synthesized in wt and PARP-1−/− cells are similar (Fig. 2 B). The reaction products were further characterized by two-dimensional TLC after polymer hydrolysis by snake venom phosphodiesterase (28Keith G. Desgres J. de Murcia G. Anal. Biochem. 1990; 191: 309-313Crossref PubMed Scopus (39) Google Scholar). No significant differences were observed in the products, PRAMP, (PR)2AMP, and AMP synthesized by each cell genotype (data not shown). These results demonstrate that PARP-1−/−cells exhibit a bona fide poly(ADP-ribose) polymerase activity presumably associated with novel PARP protein(s), confirming a previous report by Shieh et al. (15Shieh W.M. Amé J.-C. Wilson M.V. Wang Z.-Q. Koh D.W. Jacobson M.K. Jacobson E.K. J. Biol. Chem. 1998; 273: 30069-30072Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar). In plant cell nuclei, PARP activity has been reported to be associated with a protein of approximately 113 kDa (30Chen Y.M. Shall S. O'Farrell M. Eur. J. Biochem. 1994; 224: 135-142Crossref PubMed Scopus (39) Google Scholar). However, in A. thaliana, the cloning of a PARP homologue (11Lepiniec L. Babiychuk E. Kushnir S. Van Montagu M. Inze D. FEBS Lett. 1995; 364: 103-108Crossref PubMed Scopus (58) Google Scholar) revealed a protein, called APP, with a theoretical M r of 72,000. This protein showed a high similarity (60%) to the catalytic domain of vertebrate PARP, but was completely divergent in its NH2-terminal extremity where it harbored a helix-loop-helix domain. The existence of two distinct PARP genes in plants was definitely confirmed by the cloning of two different maize genes coding for a classical PARP with zinc fingers of 110 kDa (ZAP) and a structurally non-classical PARP (NAP, homologous to APP) of 72 kDa, respectively (12Babiychuk E. Cottrill P.B. Storozhenko S. Fuangthong M. Chen Y. O'Farrell M.K. Van Montagu M. Inze D. Kushnir S. Plant J. 1998; 15: 635-645Crossref PubMed Google Scholar, 14Mahajan P.B. Zuo Z. Plant Physiol. 1998; 118: 895-905Crossref PubMed Scopus (13) Google Scholar). Therefore, we undertook a search for the mammalian equivalent of APP and NAP. Expressed sequence tags (EST) of the GenBank/EMBL data bases (dbEST) were screened with the APP primary sequence. Several EST from mouse and human were identified which shared homology with the catalytic domain of APP, while distinct from PARP-1. These sequences were candidates for a new mammalian PARP homologue, possibly responsible for the poly(ADP-ribosylation) activity detected in PARP-1−/− cells. The murine EST were used to screen a mouse ES cell cDNA library. We thus were able to construct the complete cDNA (GenBank™ accession number AJ007780). Simultaneously, the cloning of the homologous human cDNA (GenBank™ accession number AJ236912) was undertaken following a similar strategy. We propose to name this new gene poly(ADP-ribose) polymerase-2 (PARP-2). The chromosomal localization of the human PARP-2 gene was identified by FISH on human chromosomes using a human PARP-2 probe. Consistent signals on chromosome 14, band 14q11.2 were identified (Fig.3 A); 100% of 25 metaphases showed at least one signal on chromosome 14 at 14q11.2; 24% of the metaphases showed signals on both chromosomes 14 on the same position. Similarly, the murine PARP-2 gene was mapped using a murine PARP-2 probe. FISH on mouse chromosomes exhibited consistent signals on chromosome 14, band 14C1 (Fig. 3 B); 70% of 25 metaphases showed signals on 14C1; 10% had double signals on chromosome 14 band 14C1, and 20% showed signals on the two homologues at the same position. As a control, chromosomal localization of the murinePARP-1 gene was performed. FISH on mouse chromosomes exhibited consistent signals on chromosomes 1, band 1 H5 (Fig.3 C); 30 metaphases were observed, of which 74% showed signals in this position; 41% showed one signal on both chromosomes 1, 26% showed double signals on one of the two homologues. Altogether, these results confirm the existence of two distinct and unique genes coding for two different PARP molecules. A strict synteny was observed between man and mouse in the two chromosome regions containing thePARP-1 gene as well as those containing thePARP-2 gene. Northern blot analysis performed on poly(A)+ mRNAs of 3T3 cells derived from PARP-1+/+ and PARP-1−/− mice and on total RNAs from mouse tissues (Fig. 4) revealed a PARP-2 transcript at an apparent molecular size of 2.0 kilobase. The same amount of transcript was detectable in both PARP-1+/+and PARP-1−/− cell lines, indicating that there is no compensation for the PARP-1 deficiency in PARP-1−/− cells by up-regulation of PARP-2 gene expression. The tissue distribution of PARP-2 showed at least a basal expression in all tissues and higher expression in germline. Moreover, Northern blot analysis on total mRNA from HeLa cells treated or untreated with genotoxic agents such as UV-B (500 J/m2), UV-C (20 J/m2),N-methyl-N′nitro-N-nitrosoguanidine (50 μm), and H2O2 (0.5 mm) revealed that the level of PARP-2 mRNA is not increased following genotoxic stress (data not sh
Referência(s)