A DNA Aptamer Prevents Influenza Infection by Blocking the Receptor Binding Region of the Viral Hemagglutinin
2004; Elsevier BV; Volume: 279; Issue: 46 Linguagem: Inglês
10.1074/jbc.m409059200
ISSN1083-351X
AutoresSung Ho Jeon, Başak Kayhan, Tamar Ben-Yedidia, Ruth Arnon,
Tópico(s)RNA and protein synthesis mechanisms
ResumoInfluenza A virus infection is a major source of morbidity and mortality worldwide. Current means of control for influenza are based on prophylaxis by vaccines and on treatment by the available specific influenza neuraminidase inhibitor drugs. The approach taken in the present study is to prevent and/or ameliorate influenza infection by site-specific blocking of the viral binding to host cell receptors. We describe a novel oligonucleotide, known also as an aptamer, which has been designed to complement the receptor-binding region of the influenza hemagglutinin molecule. It was constructed by screening a DNA library and processing by the selective evolution of ligands by exponential enrichment (SELEX) procedure. We show that this DNA aptamer is indeed capable of inhibiting the hemagglutinin capacity of the virus, as well as in the prevention of viral infectivity in vitro, in tissue culture. Furthermore, it inhibits viral infection by different influenza strains in an animal model, as manifested by 90-99% reduction of virus burden in the lungs of treated mice. The mode of action of this aptamer is by blocking the binding of influenza virus to target cell receptors and consequently prevention of the virus invasion into the host cells. Influenza A virus infection is a major source of morbidity and mortality worldwide. Current means of control for influenza are based on prophylaxis by vaccines and on treatment by the available specific influenza neuraminidase inhibitor drugs. The approach taken in the present study is to prevent and/or ameliorate influenza infection by site-specific blocking of the viral binding to host cell receptors. We describe a novel oligonucleotide, known also as an aptamer, which has been designed to complement the receptor-binding region of the influenza hemagglutinin molecule. It was constructed by screening a DNA library and processing by the selective evolution of ligands by exponential enrichment (SELEX) procedure. We show that this DNA aptamer is indeed capable of inhibiting the hemagglutinin capacity of the virus, as well as in the prevention of viral infectivity in vitro, in tissue culture. Furthermore, it inhibits viral infection by different influenza strains in an animal model, as manifested by 90-99% reduction of virus burden in the lungs of treated mice. The mode of action of this aptamer is by blocking the binding of influenza virus to target cell receptors and consequently prevention of the virus invasion into the host cells. Influenza infections remain an important cause of morbidity and mortality, particularly in the elderly population, and carry the risk of pandemics; they also impose a considerable economic burden worldwide. Present means of prevention and therapy are not entirely satisfactory, as the current vaccines do not provide a complete solution because of their limited efficacy and the frequent genetic variations of the virus, and anti-viral drugs are only marginally effective (1Demicheli V. Jefferson T. Rivetti D. Deeks J. Vaccine. 2000; 18: 957-1030Crossref PubMed Scopus (198) Google Scholar, 2Couch R.B. N. Engl. J. Med. 2000; 343: 1778-1787Crossref PubMed Scopus (183) Google Scholar, 3Gravenstein S. Davidson H.E. Clin. Infect. Dis. 2000; 35: 729-737Crossref Scopus (48) Google Scholar). The more recently developed specific anti-influenza drugs consisting of neuraminidase inhibitors, comprising analogues of N-acetylneuraminic acid (e.g. oseltamivir and zanamivir), provide a limited beneficial effect, reducing the duration of infection by 1 day, from 7 to 6 days (2Couch R.B. N. Engl. J. Med. 2000; 343: 1778-1787Crossref PubMed Scopus (183) Google Scholar, 4Cooper N.J. Sutton A.J. Abrams K.R. Wailoo A. Turner D. Nicholson K.G. BMJ. 2003; 326: 1235-1241Crossref PubMed Google Scholar).The influenza virus envelope carries two major immunogenic surface glycoproteins: hemagglutinin (HA) 1The abbreviations used are: HA, hemagglutinin; SELEX, selective evolution of ligands by exponential enrichment; ssDNA, single-stranded DNA; Ni-NTA, nickel-nitrilotriacetic acid; MDCK, Madin-Darby canine kidney; PBS, phosphate-buffered saline; HAU, hemagglutination units; ELISA, enzyme-linked immunosorbent assay; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; DAPI, 4′,6-diamidino-2-phenylindole.1The abbreviations used are: HA, hemagglutinin; SELEX, selective evolution of ligands by exponential enrichment; ssDNA, single-stranded DNA; Ni-NTA, nickel-nitrilotriacetic acid; MDCK, Madin-Darby canine kidney; PBS, phosphate-buffered saline; HAU, hemagglutination units; ELISA, enzyme-linked immunosorbent assay; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; DAPI, 4′,6-diamidino-2-phenylindole. and neuraminidase. The HA plays a key role in initiating viral infection by binding to sialic acid-containing receptors on host cells and thus mediating the subsequent viral entry and membrane fusion (5Skehel J.J. Wiley D.C. Annu. Rev. Biochem. 2000; 69: 531-569Crossref PubMed Scopus (2203) Google Scholar, 6Skehel J.J. Cross K. Steinhauer D. Wiley D.C. Biochem. Soc. Trans. 2001; 29: 623-626Crossref PubMed Scopus (61) Google Scholar, 7Eckert D.M. Kim P.S. Annu. Rev. Biochem. 2001; 70: 777-810Crossref PubMed Scopus (1136) Google Scholar). It exists in the viral membrane as homotrimeric spikes, each monomer containing a globular domain with a conserved sialic acid-binding pocket surrounded by antigenically variable antibody-binding sites (8Wilson I.A. Skehel J.J. Wiley D.C. Nature. 1981; 289: 366-373Crossref PubMed Scopus (1967) Google Scholar). The receptor-binding site within the HA is probably not exposed to the immune system because of the conformational restriction of the trimeric form of HA in native conditions. Nonetheless, as we recently demonstrated (9Jeon S.H. Arnon R. Viral Immunol. 2002; 15: 165-176Crossref PubMed Scopus (19) Google Scholar), the recombinant globular region HA-(91-261) is capable of inducing both humoral and cellular immune responses against the intact virus, leading to a partial protection of the immunized mice against infection. This region includes one of the major conserved antigenic epitopes (HA-(91-108)) of all H3 strains (10Muller G.M. Shapira M. Arnon R. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 569-573Crossref PubMed Scopus (128) Google Scholar, 11Arnon R. Horwitz R.J. Curr. Opin. Immunol. 1992; 4: 449-453Crossref PubMed Scopus (65) Google Scholar), as well as the region of HA1 (HA-(116-261)) encompassing the receptor-binding pocket (8Wilson I.A. Skehel J.J. Wiley D.C. Nature. 1981; 289: 366-373Crossref PubMed Scopus (1967) Google Scholar). Because infection by the influenza virus is initiated by the binding of the virus to host cell receptors, the approach taken in the present study was to try and prevent infection by the blocking of this binding. Using the above mentioned conserved region of the HA molecule as a template, we designed a novel molecule aptamer, which would bind directly to the virus HA receptor-binding region and eventually prevent its interaction with the host cells.An aptamer is a DNA or RNA oligonucleotide that has been selected in vitro for specific binding to a target molecule. The process through which these molecules are isolated is called selective evolution of ligands by exponential enrichment (SELEX) (12Tuerk C. Gold L. Science. 1990; 249: 505-510Crossref PubMed Scopus (7823) Google Scholar). It starts with a pool of DNA oligonucleotides containing a region of randomized nucleotides (usually 30-100 nucleotides) flanked by conserved sequences that contain primer-binding sites for use in the PCR (polymerase chain reaction). An iterative process involving the binding of the DNA oligonucleotides to a target molecule, isolation of the tightest binders, followed by their PCR amplification is used to isolate those molecules that conform best to the selection criteria (13Klug S.J. Famulok M. Mol. Biol. Rep. 1994; 20: 97-107Crossref PubMed Scopus (223) Google Scholar). In the past few years, aptamers have been evolved to bind proteins that are associated with a number of disease states (14Pan W. Craven R.C. Qiu Q. Wilson C.B. Wills J.W. Golovine S. Wang J.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11509-11513Crossref PubMed Scopus (108) Google Scholar, 15Morris K.N. Jensen K.B. Julin C.M. Weil M. Gold L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2902-2907Crossref PubMed Scopus (286) Google Scholar, 16Sekkai D. Dausse E. Di Primo C. Darfeuille F. Boiziau C. Toulme J.J. Antisense Nucleic Acid Drug Dev. 2002; 12: 265-274Crossref PubMed Scopus (20) Google Scholar), thus yielding powerful antagonists of such proteins. In the present study, using this SELEX procedure, an aptamer was selected for its binding to the globular region of influenza HA, HA-(91-261). We demonstrated that this aptamer was capable of blocking the binding of the virus to host cells and consequently preventing viral infection both in vitro and in vivo.EXPERIMENTAL PROCEDURESSELEX—Preparation and selection of the aptamer were performed by a modification of the method used by Morris et al. (15Morris K.N. Jensen K.B. Julin C.M. Weil M. Gold L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2902-2907Crossref PubMed Scopus (286) Google Scholar). The aptamer library containing a central, randomized sequence of 30 nucleotides flanked by common primers 5′-AAT TAACCCTCACTAAAGGG-(N)30-TATGGTCGAATAAGTTAA-3′ was synthesized in a 380B DNA synthesizer (Applied Biosystems). The ssDNA aptamer library was denatured at 80 °C for 10 min and then cooled on ice for 10 min. For the selection process, 30 nmol of this product were mixed with 25 μg of the recombinant His-tagged HA-(91-261) peptide (9Jeon S.H. Arnon R. Viral Immunol. 2002; 15: 165-176Crossref PubMed Scopus (19) Google Scholar) in 500 μl of selection buffer (50 mm Tris-HCl, pH 7.4, 5 mm KCl, 100 mm NaCl, 1 mm MgCl2, 100 μg tRNA, 0.2% bovine serum albumin) at 37 °C for 30 min. The bound aptamer·HA-(91-261) complex was purified by adding 25 μl of Ni-NTA superflow (Qiagen). After washing three times with 1 ml of selection buffer, the complex was resuspended in 40 μl of 10 mm Tris buffer and amplified by PCR using the above 5′ primer (denoted T3 primer) 5′-AATTAACCCTCACTAAAGGG-3′ and the 3′ primer 5′-TTAACTTATTCGACCATA-3′ under the conditions of 70 pmol/primer, 2 μl of 10 mm deoxy-NTP, in a final volume 50 μl at 46 °C, for 30 cycles. After three repeats of this SELEX procedure, amplified nucleotides were cloned by inserting the PCR product into pGEM-T vector and transformed into Escherichia coli.Oligonucleotides—The three oligonucleotides used in this study, synthesized in the 380B DNA synthesizer (Applied Biosystems) had the following sequences: A22, 5′AATTAACCCTCACTAAAGGGCTGAGTCTCAAAACCGCAATACACTGGTTGTATGGTCGAATAAGTTAA-3′; A21, 5′-AATTAACCCTCACTAAAGGGCGCTTATTTGTTCAGGTTGGGTCTTCCTATTATGGTCGAATAAGTTAA-3′; and NP-(147-158), 5′-ACTTATCAGCGGACCCGTGCCTTTAGTTCGTACTGGTGAT-3′.Mice—BALB/c mice at the age of 10-12 weeks old were purchased from Harlan Laboratories (Rehovot, Israel). In each experiment 5-10 mice were employed/group, and 2-3 repetitive experiments were conducted.Viruses—Influenza strains A/Port Chalmers/1/73 (H3N2), A/Texas/1/77 (H3N2), A/PR/8/34 (H1N1), and A/Japan/57 (H2N2) were grown in the allantoic cavity of 11-day-old embryonated hen eggs (Bar On Hatchery, Hod Hasharon, Israel). Virus growth and purification were performed according to standard methods as described by Barret and Inglis (30Barret T. Inglis S.C. Mahy W.J. Growth Purification and Titration Influenza Viruses in Virology: A Practical Approach. IRL Press, Washington, D. C.1985: 119-151Google Scholar). The titer of virus used for infection was evaluated by the infection of Madin-Darby canine kidney (MDCK) cells (31Levi R. Beear-Tzahar T. Arnon R. J. Virol. Methods. 1995; 52: 55-64Crossref PubMed Scopus (24) Google Scholar), and hence, virus titer was expressed as the tissue culture infective doses leading to 50% infected cells (TCID50).Cells—MDCK cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with heat-inactivated 10% fetal calf serum (Biological Industries). Chicken blood for red blood cell preparation was obtained from the Faculty of Agriculture, Hebrew University (Rehovot, Israel).Hemagglutination Assay—Chicken red blood cells were suspended in Alsever solution, and the concentration was brought to 0.5% in PBS. Assay was performed in micro-titer plates with 50 μl of sample containing the influenza virus and 50 μl of 0.5% chicken red blood cells. Wells were inspected for agglutination, and the results were evaluated as hemagglutination units (HAU). For hemagglutination inhibition assay, a serial dilution of either the aptamer or lung homogenate extracts were added to the virus prior to the addition of chicken red blood cells.Immunization of Mice with HA-(91-261) Peptide—The recombinant fragment HA-(91-261) was prepared as described previously (9Jeon S.H. Arnon R. Viral Immunol. 2002; 15: 165-176Crossref PubMed Scopus (19) Google Scholar). Briefly, cDNA encoding the globular region of HA protein (91-261 amino acid residues) was expressed in E. coli and purified in Ni-NTA column (Qiagen, Beer-Sheva, Israel) using their N-terminal histidine tag. For the intranasal immunization, each mouse was administered with a droplet of 50 μl of recombinant peptide solution containing 1 μg/μl HA-(91-261) in PBS. The mice were boosted twice at 3-week intervals, using the same amount of antigen used for the initial immunization. The mice were bled 1 week after the last immunization.Enzyme-linked Immunosorbent Assay (ELISA)—High binding capacity ELISA plates (Immunoplate, Nunc, Denmark) were coated with 100 μl of purified virus containing 100 HAU/ml of various influenza viral strains diluted in PBS by incubating at 4 °C overnight. After several washings, the wells were blocked with PBS containing 1% bovine serum albumin, 100 μl of serial-diluted serum samples were added to each well, and the plates were incubated at 37 °C for 2 h. After washing five times with PBS-T (PBS containing 0.05% (v/v) Tween 20), the bound antibodies were detected by peroxidase-labeled goat anti-mouse IgG conjugates (Jackson Immunoresearch Laboratories). Reaction was revealed by incubating with 3,3′,5,5′-tetramethyl benzidine (Sigma) solution for 30 min at room temperature. After stopping the reaction with 50 μl of 2 m H2SO4, the plates were read with a multichannel ELISA reader (Titertek, Multiskan MCC/340 MK II; Helsinki, Finland) at 450 nm.Reverse Screening of Aptamer—Biotinylated ssDNA of each plasmid from individual clones was synthesized using the B-T3 20-mer, which has the same sequence as the 5′ primer (T3 primer) in the aptamer. The biotinylated 5′ primer, B-T3 20-mer, was purchased from Stratagene (La Jolla, CA). The solid phase ELISA plate was prepared by coating with 100 μl/well of 100 μg/ml streptavidin diluted in 0.1 m NaHCO3 and incubated overnight at 37 °C. After washing four times with PBS, the wells were blocked with 200 μl of PBS containing 1% bovine serum albumin by incubating at room temperature for 2 h followed by washing three times with PBS-T. After washing, 100 μl of 2.5 pmol/100 μl of the individual biotinylated ssDNA (expectant oligonucleotides) and, as negative control, B-T3 primer were added to the wells and incubated at 37 °C for 2 h followed by washing four times with PBS-T. After this step, 100 μl/well of 10 HAU/well virus or 2 μg/well histidine-labeled HA-(91-261) peptide were added and incubated at 37 °C for 2 h. After washing the wells four times with PBS-T, anti-His antibody or anti-virus serum were added to the corresponding wells. Reverse screening assay was completed by following the procedures of ELISA after this step.Viability of MDCK Cells (MTT Assay)—MDCK cells were laid on 96-well plates (7 × 104/well) 1 day before the experiments, as such or infected with influenza virus, in the presence or absence of aptamer. They were incubated in maintaining medium (Dulbecco's modified Eagle's medium supplemented with 2% fetal calf serum) at 37 °C for 72 h. The viability assay was performed according to Levi et al. (31Levi R. Beear-Tzahar T. Arnon R. J. Virol. Methods. 1995; 52: 55-64Crossref PubMed Scopus (24) Google Scholar) by adding 4 mg/ml MTT (Sigma) dissolved in PBS to the cell cultures and incubating at 37 °C for 3 h. The plates were then centrifuged at 800 × g for 10 min. The supernatants were aspirated, and the formazan dye was dissolved in 150 μl/well isopropyl alcohol (Merck). The optical density values were quantitated using an ELISA reader at 540 nm.Immunostaining—For immunostaining, 5 × 105 MDCK cells were laid on glass coverslips. After 24 h, influenza virus (Port Chalmers/1/73, H3N2) was added with or without 1 h of preincubation with A22. After 48 h, the cells were permeabilized with 3% paraformaldehyde containing 0.5% Triton X-100, and subsequently, the cultures were fixed with freshly prepared 3% paraformaldehyde. Influenza surface antigen HA was detected by incubating the cultures with a mouse monoclonal antibody specific for influenza HA (diluted 1:100) (Santa Cruz Biotechnology). All antibody incubations were carried out for 1 h at room temperature in a humidified chamber, followed by three washes in PBS. Primary antibodies were detected with Cy3-conjugated goat anti-mouse immunoglobulin (Jackson Immunoresearch Laboratories) secondary antibodies. Nuclei were visualized by staining with 2 μg/ml DAPI (Sigma). Immunofluorescence microscopy was performed using a Nikon Eclipse E600 microscope. Photographs were taken using the Spot software program. Images were processed with Adobe Photoshop (Adobe Systems, Mountain View, CA).Infection of Mice with Influenza Virus—The mice were inoculated intranasally with a sublethal dose of infectious allantoic fluid containing 2.5 × 103 TCID50. Preliminary experiments for the evaluation of this viral dose on BALB/c mice revealed that it is equivalent to 0.3 lethal doses 50 (LD50). The mice were sacrificed 6 days after the inoculation (the peak of virus titer), and the lungs were removed and homogenized in PBS containing 0.1% bovine serum albumin (10% w/v). After homogenization, the samples were centrifuged to remove debris and stored at -70 °C. In the day of the assay, after thawing the lung homogenates (a process which releases the virus from the cells), they were injected (100 μl of 10-fold serial dilution) into the allantoic cavity of 9-11-day-old embryonated eggs. Following incubation for 48 h at 37 °C and overnight at 4 °C, allantoic fluid was removed, and virus presence was determined by hemagglutination assay as described above. The results of these assays were presented as log egg infection doses 50% (30Barret T. Inglis S.C. Mahy W.J. Growth Purification and Titration Influenza Viruses in Virology: A Practical Approach. IRL Press, Washington, D. C.1985: 119-151Google Scholar).Histology—For histological analysis of lungs, mice were sacrificed 6 days after infection, and pieces of the lungs were put into 10% neutral buffered formalin (pH 7.0), sectioned, and stained with hematoxylin and eosin. All slides were analyzed and evaluated by a uninformed observer.Statistical Analysis—The p values were calculated by Student's t test, and p < 0.05 was considered significant according to the Statistical Package for the Social Sciences version 10.0 software program.RESULTSCross Reactivity of HA-(91-261) Fragment with Different Viral Strains—The globular region of HA has been chosen for the aptamer selection, because it encompasses the conserved receptor-binding site, which is not exposed in the intact HA molecule or in its trimeric spikes on the virus. Hence, antibodies induced by this globular region are expected to react with different strains that share this structure. To induce such antibodies, we have cloned the peptide comprising the HA-(91-261) region that includes the binding zone to the oligosaccharide receptor of target cells. We have shown previously (9Jeon S.H. Arnon R. Viral Immunol. 2002; 15: 165-176Crossref PubMed Scopus (19) Google Scholar) that this protein fragment (denoted HA-(91-261) peptide) induced significant levels of IgG antibodies that recognized and neutralized the intact influenza virus A/Texas/1/77 (H3N2). As shown in Fig. 1, A-D, these anti-HA-(91-261) antibodies react with different influenza viral strains, including H1N1 (A/PR/8/34) and H2N2 (A/Japan/57), at a comparable level to their reactivity with the H3N2 (A/Texas/1/77 and A/Port Chalmers/1/73) viruses. This is in contrast to the strain-specific immune response induced by the intact A/Texas/1/77 virus (Fig. 1E). These results indicate that the HA-(91-261) globular region of the HA molecule may lead to broad spectrum neutralizing activity.Selection and Construction of the Aptamer—Using this HA-(91-261) peptide, we attempted to design novel molecules that can bind directly to the virus HA and eventually prevent the interaction of the virus with the host cells. To this end, recourse was taken to the development of aptamers, namely oligonucleotides derived from an in vitro evolution process called SELEX, in which the peptide is used as a template. According to the described procedure (12Tuerk C. Gold L. Science. 1990; 249: 505-510Crossref PubMed Scopus (7823) Google Scholar), a nucleotide library was synthesized containing a random segment of 30 nucleotides flanked by 5′ and 3′ common primers as conserved linkers to amplify the selection process. This random library was hybridized with the HA-(91-261) peptide in a selection buffer and purified by Ni-NTA resin. After purification, the ssDNAs were amplified by PCR using the linker sequences. The SELEX process was repeated three times followed by the cloning of the final PCR product and transformation into E. coli. For the screening of oligonucleotides, biotinylated ssDNA from individual clones were screened by reverse ELISA for their binding to the HA-(91-261) fragment and the intact influenza virus, respectively. The two oligonucleotides with the highest binding activity were selected from the library and denoted “A21” and “A22,” respectively. As illustrated in Fig. 2A, in their binding levels to the HA-(91-261) fragment, they were similar and showed highly significant differences from the control ssDNA (p = 0.042 and p = 0.0008, respectively). On the other hand, there was a significant difference between A21 and A22 in binding to the intact virus, where A22 showed higher binding than A21 (p = 0.017), and both showed significant binding compared with the control (Fig. 2B). The two oligonucleotides A21 and A22 were isolated and sequenced. Their sequences and the proposed secondary structures, as determined by using the DNA draw program (18Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10091) Google Scholar), are illustrated in Fig. 2, C and D. The secondary structure of an additional oligonucleotide, NP-(147-158), which served as a negative control in the in vivo experiments, is shown in Fig. 2E. The aptamers were then synthesized and evaluated as described in the following.Fig. 2Properties of aptamers. Binding levels of aptamers A21 and A22, as well as control ssDNA (unselected random nucleotides) to the HA-(91-261) peptide (A) and to the virus (B) as measured by ELISA. C, proposed secondary structure of the aptamer A22 comprising the oligonucleotide sequence 5′-AATTAACCCTCACTAAAGGGCTGAGTCTCAAAACCGCAATACACTGGTTGTATGGTCGAATAAGTTAA-3′, as drawn by the DNAdraw software program. D, proposed structure of A21. E, proposed structure of the control oligonucleotide, coding for the NP-(147-158) region of influenza nucleoprotein. The sequences are listed under “Experimental Procedures.” O.D., optical density.View Large Image Figure ViewerDownload (PPT)Inhibitory Effect of A22 Aptamer on the in Vitro Influenza Infectivity—The first evaluated parameter is the capacity to inhibit the hemagglutination activity of the virus, namely the capacity to agglutinate chicken red blood cells. The aptamer A22, which evinced the higher binding capacity to the virus, indeed demonstrated hemagglutination inhibition. Thus, at a 12.5-pmol concentration, it inhibited completely the hemagglutination by 4 HAU of the A/Texas/1/77 (H3N2) virus, and at a concentration of 20 pmol, it inhibited the hemagglutination by 10 HAU of influenza A/Japan/57 (H2N2) and 15 HAU of A/Port Chalmers/1/73 (H3N2), respectively. The capacity of A22 to inhibit viral infectivity was then investigated in vitro by measuring the viability of MDCK cells exposed to influenza virus (A/Port Chalmers/1/73, H3N2). Fig. 3A demonstrates the effect of A22 in preventing cell death and illustrates its dose-dependent nature. As shown, exposure of the MDCK cells to 5 × 102 TCID50 of the virus led to almost total cell death. The cell viability increased as a function of the concentration of the A22 added to the cell culture and reached its peak between 50 and 100 pmol of A22 (r = 0.972, p = 0.028). The slight decline in effectivity at the highest concentration is possibly because of some detrimental effect to the uninfected cells caused by high concentration of A22. Accordingly, a concentration of 50 pmol was selected to determine the effect of A22 on the infection of MDCK cells by another strain of influenza, A/Japan/57 (H2N2), in comparison to the inhibition of infection by the A/Port Chalmers/1/73 (H3N2) strain. The results (Fig. 3B) demonstrate that A22 had a comparable inhibitory effect on the MDCK death caused by the two viral strains. It led to a reduction of 80% in the cell mortality caused by A/Port Chalmers and 70% reduction of mortality caused by the A/Japan, two influenza strains that differ in their HA. Interestingly, as also shown in Fig. 3B, the less reactive aptamer A21 was also capable of reducing the in vitro infectivity of the viruses, although less effectively than A22. The inhibition of viral infectivity of the MDCK is specific, because a nonrelevant DNA (coding for the region NP-(147-158) of influenza nucleoprotein) did not lead to any change in cell mortality caused by the viral infection.Fig. 3The effect of A22 on the viability of MDCK cells infected by 5 × 102 TCID50 of influenza virus in tissue culture. The viability was measured by the MTT method in the presence ofincreasingconcentrationsofA22.A,dose-dependent inhibition of cell death caused by infection with the Port Chalmers strain of influenza. The highest protective effect was achieved by A22 at the concentration range of 50-100 pmol. B, comparison of the protective effect of A22 (50 pmol), A21 (50 pmol), and control DNA (NP-(147-158)) (50 pmol) in the prevention of MDCK cell death infected with two strains of influenza, Port Chalmers (H3N2) and Japan/57 (H2N2).View Large Image Figure ViewerDownload (PPT)The effect of A22 in preventing viral binding and entry to cells was demonstrated also by microscopic analysis. As seen in the upper part of Fig. 4, using light microscopy, the whole structure of the MDCK cells was damaged by the viral infection (Fig. 4A). In comparison, in the presence of A22, destruction was inhibited, and the cell structure was largely conserved (Fig. 4B). Furthermore, the mere treatment with A22 did not affect the structure of the cells (Fig. 4C), indicating that the damage was caused only by the viral infection. These findings are corroborated in the fluorescence microscopy images in the lower part of Fig. 4. Here the presence of the virus was detected with Cy3-labeled specific anti-HA monoclonal antibodies. As shown, although viral presence is clearly manifested in the infected cells (Fig. 4D), it is almost entirely prevented by the addition of A22 (Fig. 4E). Untreated cells appeared identical to the cells treated with A22 (Fig. 4F).Fig. 4Microscopic analysis of the effect of A22 on influenza infection of cells.Upper panels, light microscope views of MDCK cells after infection with 5 × 102 TCID50 influenza virus (A) and after pre-treatment with 50 pmol A22, with (B) or without (C) infection. Lower panels, immunofluorescence images of MDCK cells after 2 days of incubation with influenza virus (D), with influenza virus and A22 (E), or treatment with A22 alone (F). The cells were fixed with 3% paraformaldehyde and permeabilized in paraformaldehyde containing 0.5% Triton X-100. The cells were immunostained for the presence of virus using mouse anti-HA antibodies and goat anti-mouse IgG conjugated to Cy3 as a secondary antibody. Nuclei were visualized by staining with DAPI. HA and nuclei are shown in red and blue, respectively.View Large Image Figure ViewerDownload (PPT)Mode of Action of A22 Evidence for Aptamer-Virus Interaction—To eliminate the possibility that the prevention of infection is due to binding of the aptamer to the target cells rather than to the virus, a pre-incubation experiment was performed. Before infection with 2.5 × 102 TCID50 of A/Port Chalmers/1/73 (H3N2) virus, the MDCK cells were incubated with 50 pmol of A22 for 30 or 60 min followed by repeated washing (twice) to remove unbound aptamer. Assessment of their viability (Fig. 5A) revealed no significant difference between the survival level of the nontreated and the A22-treated cells, nor any difference between the two times of exposure of the cells to A22. In all cases, cell survival is very low, because infection is not hindered. These results indicate that the effect of A22 in preventing the cell infection and mortality, as demonstrated in Fig. 3, is not by direct blocking of the sialic acid-containing receptors on host cells.Fig. 5Mode of action of the aptamer
Referência(s)