High Expression of the PAX3-FKHR Oncoprotein Is Required to Promote Tumorigenesis of Human Myoblasts
2009; Elsevier BV; Volume: 175; Issue: 6 Linguagem: Inglês
10.2353/ajpath.2009.090192
ISSN1525-2191
AutoresShujuan J. Xia, Dara Holder, Bruce Pawel, Chune Zhang, Frederic G. Barr,
Tópico(s)RNA Research and Splicing
ResumoPAX3-FKHR is a fusion oncoprotein generated by the 2;13 chromosomal translocation in alveolar rhabdomyosarcoma (ARMS), a cancer associated with the skeletal muscle lineage. Previous studies determined that high-level PAX3-FKHR expression is a consistent feature in ARMS tumors. To investigate the relationship between expression and phenotype in human myogenic cells, PAX3-FKHR was introduced into immortalized human myoblasts to produce a low overall PAX3-FKHR expression level. Although PAX3-FKHR alone failed to exert transforming activity, a combination of PAX3-FKHR and MYCN induced transforming activity in cell culture assays. Furthermore, myoblasts expressing PAX3-FKHR with or without MYCN formed tumors in SCID mice. These tumors demonstrated invasive features and expressed myogenic markers, consistent with rhabdomyosarcoma. Comparisons of tumor and parental cells revealed that only a subset of parental cells developed into tumors and that tumor cells expressed high PAX3-FKHR levels compared with transduced parental cells. Subcloning of parental PAX3-FKHR/MYCN-transduced myoblasts identified rare high PAX3-FKHR-expressing subclones with high transforming and tumorigenic activity; however, most subclones expressed low PAX3-FKHR and showed neither transforming nor tumorigenic activity. Finally, RNA interference experiments in myoblast-derived tumor and ARMS cells revealed that high PAX3-FKHR expression plays a crucial role in regulating proliferation, transformation, and differentiation. These findings support the premise that high PAX3-FKHR-expressing cells are selected during tumorigenesis. PAX3-FKHR is a fusion oncoprotein generated by the 2;13 chromosomal translocation in alveolar rhabdomyosarcoma (ARMS), a cancer associated with the skeletal muscle lineage. Previous studies determined that high-level PAX3-FKHR expression is a consistent feature in ARMS tumors. To investigate the relationship between expression and phenotype in human myogenic cells, PAX3-FKHR was introduced into immortalized human myoblasts to produce a low overall PAX3-FKHR expression level. Although PAX3-FKHR alone failed to exert transforming activity, a combination of PAX3-FKHR and MYCN induced transforming activity in cell culture assays. Furthermore, myoblasts expressing PAX3-FKHR with or without MYCN formed tumors in SCID mice. These tumors demonstrated invasive features and expressed myogenic markers, consistent with rhabdomyosarcoma. Comparisons of tumor and parental cells revealed that only a subset of parental cells developed into tumors and that tumor cells expressed high PAX3-FKHR levels compared with transduced parental cells. Subcloning of parental PAX3-FKHR/MYCN-transduced myoblasts identified rare high PAX3-FKHR-expressing subclones with high transforming and tumorigenic activity; however, most subclones expressed low PAX3-FKHR and showed neither transforming nor tumorigenic activity. Finally, RNA interference experiments in myoblast-derived tumor and ARMS cells revealed that high PAX3-FKHR expression plays a crucial role in regulating proliferation, transformation, and differentiation. These findings support the premise that high PAX3-FKHR-expressing cells are selected during tumorigenesis. Alveolar rhabdomyosarcoma (ARMS) is an aggressive pediatric soft tissue sarcoma associated with the skeletal muscle lineage. The most common cytogenetic feature of this cancer is a chromosomal translocation, t(2;13)(q35;q14), which generates a fusion between the PAX3 and FKHR (FOXO1) genes.1Barr FG Gene fusions involving PAX and FOX family members in alveolar rhabdomyosarcoma.Oncogene. 2001; 20: 5736-5746Crossref PubMed Scopus (306) Google Scholar In addition, a PAX7-FKHR fusion gene is generated by a variant translocation, t(1;13)(p36;q14), which occurs in a smaller subset of cases. The PAX3- or PAX7-FKHR fusion genes encode proteins, which contain the intact PAX3 or PAX7 DNA binding domain fused with the FKHR transcriptional activation domain. These fusion proteins have greater transcriptional activity than wild-type PAX3 or PAX7 and function as aberrant transcription factors, which deregulate downstream target genes2Davicioni E Finckenstein FG Shahbazian V Buckley JD Triche TJ Anderson MJ Identification of a PAX-FKHR gene expression signature that defines molecular classes and determines the prognosis of alveolar rhabdomyosarcomas.Cancer Res. 2006; 66: 6936-6946Crossref PubMed Scopus (259) Google Scholar, 3Ebauer M Wachtel M Niggli FK Schafer BW Comparative expression profiling identifies an in vivo target gene signature with TFAP2B as a mediator of the survival function of PAX3/FKHR.Oncogene. 2007; 26: 7267-7281Crossref PubMed Scopus (73) Google Scholar to contribute to tumorigenesis. A striking feature of the 2;13 translocation is the overexpression of PAX3-FKHR relative to wild-type PAX3, at both the RNA and protein levels.4Davis RJ Barr FG Fusion genes resulting from alternative chromosomal translocations are overexpressed by gene-specific mechanisms in alveolar rhabdomyosarcoma.Proc Natl Acad Sci USA. 1997; 94: 8047-8051Crossref PubMed Scopus (117) Google Scholar In a small subset of cases, the PAX3-FKHR fusion gene is amplified and the basis for overexpression is copy number-dependent. However, in the majority of cases, there are comparable numbers of PAX3-FKHR and PAX3 gene copies, and the basis for overexpression seems to be a copy number-independent increase in transcriptional rate. The consistent finding of high PAX3-FKHR expression in ARMS tumors suggests that the high fusion product level is needed to surpass a critical threshold for oncogenic activity. Of note, PAX7-FKHR is also consistently overexpressed in ARMS tumors with the 1;13 translocation although the underlying mechanism is usually gene amplification.4Davis RJ Barr FG Fusion genes resulting from alternative chromosomal translocations are overexpressed by gene-specific mechanisms in alveolar rhabdomyosarcoma.Proc Natl Acad Sci USA. 1997; 94: 8047-8051Crossref PubMed Scopus (117) Google Scholar Several phenotypic activities are attributed to the PAX3-FKHR protein. Oncogenic activity was demonstrated in chicken embryo and murine fibroblasts in the soft agar colony assay.5Scheidler S Fredericks WJ Rauscher 3rd, FJ Barr FG Vogt PK The hybrid PAX3-FKHR fusion protein of alveolar rhabdomyosarcoma transforms fibroblasts in culture.Proc Natl Acad Sci USA. 1996; 93: 9805-9809Crossref PubMed Scopus (109) Google Scholar, 6Lam PY Sublett JE Hollenbach AD Roussel MF The oncogenic potential of the Pax3-FKHR fusion protein requires the Pax3 homeodomain recognition helix but not the Pax3 paired-box DNA binding domain.Mol Cell Biol. 1999; 19: 594-601Crossref PubMed Scopus (96) Google Scholar However, our previous studies indicated that transformation of NIH3T3 fibroblasts is only optimal at low PAX3-FKHR levels.7Xia SJ Barr FG Analysis of the transforming and growth suppressive activities of the PAX3-FKHR oncoprotein.Oncogene. 2004; 23: 6864-6871Crossref PubMed Scopus (53) Google Scholar In contrast, at high PAX3-FKHR levels, comparable with the levels in human ARMS tumor cells, the predominant effect in several immortalized murine lines is growth suppression and/or cell death. Based on the ability of human ARMS cells to tolerate these high PAX3-FKHR levels, we hypothesize that additional collaborating alterations occur during ARMS tumorigenesis and permit these cells to tolerate high fusion protein expression. In this report, we now move our studies of PAX3-FKHR into a human myoblast system. Based on the association of ARMS with the skeletal muscle lineage and the frequent occurrence of ARMS in skeletal muscle, the human myoblast is postulated to be a potential cell of origin and an important cell type for investigating PAX3-FKHR action. For these reasons, we selected a human myoblast line that is immortalized with BMI1 and TERT.8Cudre-Mauroux C Occhiodoro T Konig S Salmon P Bernheim L Trono D Lentivector-mediated transfer of Bmi-1 and telomerase in muscle satellite cells yields a Duchenne myoblast cell line with long-term genotypic and phenotypic stability.Hum Gene Ther. 2003; 14: 1525-1533Crossref PubMed Scopus (81) Google Scholar BMI1 functions as a transcriptional repressor of the CDKN2A locus, and down-regulates both p16INK4a and p14ARF expression,9Jacobs JJ Scheijen B Voncken JW Kieboom K Berns A van Lohuizen M Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Myc-induced apoptosis via INK4a/ARF.Genes Dev. 1999; 13: 2678-2690Crossref PubMed Scopus (541) Google Scholar thereby disrupting the Rb and p53 pathways. These pathways are often inactivated by a variety of mechanisms in ARMS tumors.10Xia SJ Pressey JG Barr FG Molecular pathogenesis of rhabdomyosarcoma.Cancer Biol Ther. 2002; 1: 97-104PubMed Google Scholar TERT encodes the catalytic telomerase subunit and is required during immortalization to prevent senescence.11Masutomi K Possemato R Wong JM Currier JL Tothova Z Manola JB Ganesan S Lansdorp PM Collins K Hahn WC The telomerase reverse transcriptase regulates chromatin state and DNA damage responses.Proc Natl Acad Sci USA. 2005; 102: 8222-8227Crossref PubMed Scopus (288) Google Scholar In this human myoblast system, we investigate the role of PAX3-FKHR and oncogenic cofactors in regulating the phenotypic activities of proliferation, transformation, differentiation, and tumorigenicity. Furthermore, we evaluate the significance of PAX3-FKHR expression levels in these regulatory activities. Our findings highlight the importance of high PAX3-FKHR expression in ARMS oncogenesis and provide further evidence for a collaborating event associated with high PAX3-FKHR expression. A human DMD myoblast cell line, immortalized by transduction with TERT and BMI1, was obtained from Dr. D. Trono (University of Geneva).8Cudre-Mauroux C Occhiodoro T Konig S Salmon P Bernheim L Trono D Lentivector-mediated transfer of Bmi-1 and telomerase in muscle satellite cells yields a Duchenne myoblast cell line with long-term genotypic and phenotypic stability.Hum Gene Ther. 2003; 14: 1525-1533Crossref PubMed Scopus (81) Google Scholar This line was cultured in F10 medium (Gibco, Carlsbad, CA) with 15% fetal bovine serum (HyClone Laboratories, Logan, UT), 100 units/ml penicillin, 100 units/ml streptomycin, 0.25 μg/ml amphotericin B (Gibco), 1 mmol/L creatine, 100 ng/ml pyruvate, and 50 μg/ml uridine. For growth curves, 5 × 104 cells/well were seeded in six-well plates, and the cell number was counted every other day using the trypan blue exclusion method. To isolate subclones, myoblasts were diluted to 0.3 cell/well in 96-well plates, transferred to 12-well plates after 2 weeks, and then further expanded. The retroviral transduction protocol and retroviral constructs were described previously.7Xia SJ Barr FG Analysis of the transforming and growth suppressive activities of the PAX3-FKHR oncoprotein.Oncogene. 2004; 23: 6864-6871Crossref PubMed Scopus (53) Google Scholar, 12Xia SJ Rajput P Strzelecki DM Barr FG Analysis of genetic events that modulate the oncogenic and growth suppressive activities of the PAX3-FKHR fusion oncoprotein.Lab Invest. 2007; 87: 318-325PubMed Scopus (17) Google Scholar A pBabe-based retroviral construct was used to deliver PAX3-FKHR with puromycin selection (0.8 μg/ml) and a pK-hyg-based construct was used to deliver MYCN with hygromycin selection (120 μg/ml). The transduction efficiencies for these two constructs are ∼15 and ∼45%, respectively. A minidystrophin gene in a lentiviral vector was provided by Dr. J. Chamberlain (University of Washington).13Li S Kimura E Fall BM Reyes M Angello JC Welikson R Hauschka SD Chamberlain JS Stable transduction of myogenic cells with lentiviral vectors expressing a minidystrophin.Gene Ther. 2005; 12: 1099-1108Crossref PubMed Scopus (75) Google Scholar To target the PAX3-FKHR fusion point, a short hairpin RNA (shRNA) construct was designed with a 29-bp sequence (shown as underlined) corresponding to the PAX3-FKHR fusion point (5′-GATCCGCCTCTCACCTCAGAATTCAATTCGTCATTTCAAGAGAATGACGAATTGAATTCTGAGG TGAGAGGCTTTTTACGCGTG-3′). This shRNA construct was cloned into the retroviral vector pSIREN-RetroQ-ZsGreen (Clontech, Mountain View, CA) and transduced into cells based on our previously published protocol using FuGENE 6 reagent (Roche Applied Science, Indianapolis, IN) and 293T cells.7Xia SJ Barr FG Analysis of the transforming and growth suppressive activities of the PAX3-FKHR oncoprotein.Oncogene. 2004; 23: 6864-6871Crossref PubMed Scopus (53) Google Scholar, 12Xia SJ Rajput P Strzelecki DM Barr FG Analysis of genetic events that modulate the oncogenic and growth suppressive activities of the PAX3-FKHR fusion oncoprotein.Lab Invest. 2007; 87: 318-325PubMed Scopus (17) Google Scholar Cell lysates were prepared as described,7Xia SJ Barr FG Analysis of the transforming and growth suppressive activities of the PAX3-FKHR oncoprotein.Oncogene. 2004; 23: 6864-6871Crossref PubMed Scopus (53) Google Scholar and nuclear extracts were prepared using nuclear and cytoplasmic extraction reagents (Pierce, Rockford, IL). For Western blots, cell lysates (40 μg) or nuclear extracts (20 μg) were fractionated on 4 to 12% NuPAGE gels (Invitrogen, Carlsbad, CA) and transferred onto nitrocellulose membranes. Antibodies included anti-PAX3 rabbit polyclonal and anti-myosin heavy chain monoclonal (Abcam, Cambridge, MA), anti-MYCN rabbit polyclonal, anti-myogenin monoclonal, anti-ARF goat polyclonal, anti-Bmi1 rabbit polyclonal, anti-p16 rabbit polyclonal, anti-actin goat polyclonal, anti-dystrophin monoclonal, and anti-histone H1 rabbit polyclonal (Santa Cruz Biotechnology, Santa Cruz, CA). RNA was extracted from frozen tumors using RNA STAT-60 reagent (Tel-Test, Friendswood, TX). RNA was screened for PAX3-FKHR expression using reagents from a previously described quantitative (q) RT-PCR assay.14Barr FG Smith LM Lynch JC Strzelecki D Parham DM Qualman SJ Breitfeld PP Examination of gene fusion status in archival samples of alveolar rhabdomyosarcoma entered on the Intergroup Rhabdomyosarcoma Study-III trial: a report from the Children's Oncology Group.J Mol Diagn. 2006; 8: 202-208Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar For quantitation, a standard curve was prepared with RNA from the Rh30 ARMS cell line. The qRT-PCR assays were run on 384-well plates in the ABI Prism 7900 Sequence Detection System. To normalize for RNA content, the control gene 18S RNA was assayed in separate wells of the same run using a premade qRT-PCR assay (Applied Biosystems, Foster City, CA). For the soft agar colony assay, 105 cells in 0.35% agar (Agar Noble, Difco Laboratories, Detroit, MI) were seeded on top of 0.7% agar and then monitored, as described previously.12Xia SJ Rajput P Strzelecki DM Barr FG Analysis of genetic events that modulate the oncogenic and growth suppressive activities of the PAX3-FKHR fusion oncoprotein.Lab Invest. 2007; 87: 318-325PubMed Scopus (17) Google Scholar For the focus formation assay, 103 cells were mixed with 106 NIH3T3 cells, seeded into a 10-cm dish and then monitored, as described previously.12Xia SJ Rajput P Strzelecki DM Barr FG Analysis of genetic events that modulate the oncogenic and growth suppressive activities of the PAX3-FKHR fusion oncoprotein.Lab Invest. 2007; 87: 318-325PubMed Scopus (17) Google Scholar Statistical analysis was performed using SPSS (version 12, SPSS Inc., Chicago, IL). To evaluate tumorigenesis of transduced myoblasts, cells were injected into 4- to 5-week-old female mice (Fox Chase SCID Mice, Charles River Laboratories, Wilmington, MA). For s.c. xenografts, 106 exponentially growing cells were harvested and washed with PBS, resuspended in 200 μl of Matrigel (BD Biosciences, San Jose, CA), and injected subcutaneously into the flank region. For i.m. xenografts, 5 × 105 cells were resuspended in 50 μl of PBS and injected intramuscularly into the rear thigh. Tumor size was measured three times per week, and when tumors reached 1.5 cm, animals were euthanized for tumor harvest and pathological analysis. All animal procedures were performed in compliance with the Institutional Animal Care and Use Committee of the University of Pennsylvania. To culture tumor cells, harvested tumor was minced into small pieces and incubated for 30 minutes with collagenase/dispase (1 U/ml, Roche Applied Science) in F10 medium at 37°C with shaking. After centrifugation and washing to remove enzymes, the cells were cultured in medium with 15% fetal bovine serum. Harvested tumors were fixed in 10% neutral buffered formalin and embedded in paraffin for histological studies. Four-micrometer tissue sections were stained with H&E and assessed histologically by a pathologist (B.R.P.). For immunohistochemical analysis, sections were cut at 4 μm onto charged glass slides. The slides were deparaffinized, and endogenous peroxidase was blocked with 3% H2O2. Antigen retrieval (for myogenin) was performed by heating in a pressure cooker in antigen-unmasking solution (Vector Laboratories, Burlingame, CA). Immunohistochemical staining was performed on a Dako Autostainer (Dako, Carpenteria, CA), using the M.O.M. immunodetection kit (Vector Laboratories). Primary mouse monoclonal antibodies were applied at the following dilutions: myogenin (Dako) at 1:50, desmin (Dako) at 1:20, MyoD1 (Dako) at 1:80, and muscle specific actin (Enzo, Farmingdale, NY) at 1:50 for 30 minutes at room temperature. Detection was done using the Vectastain Elite ABC standard kit (Vector Laboratories) and diaminobenzidine (Dako). Genomic DNA was isolated from cultured cells and tumors using the DNeasy Tissue Kit (Qiagen, Valencia, CA). For Southern blot transfer, 5 μg of DNA was digested with BglII, fractionated by electrophoresis in 0.7% agarose gels, and transferred onto Hybond-N+ membrane (Amersham Biosciences, Piscataway, NJ). For the labeling probe, a DNA fragment from the pBabe puromycin resistance gene was isolated by ClaI/HindII digestion, and a fragment from the pK-Hyg hygromycin resistance gene was isolated by NotI/SalI digestion. The purified DNA fragments were labeled with digoxigenin (DIG High Prime DNA Labeling and Detection Kit, Roche Applied Science), and hybridization was performed according to the manufacturer's instructions. A human myoblast cell line (referred to as Dbt), which is derived from a Duchenne muscular dystrophy donor and immortalized by BMI1 and TERT,8Cudre-Mauroux C Occhiodoro T Konig S Salmon P Bernheim L Trono D Lentivector-mediated transfer of Bmi-1 and telomerase in muscle satellite cells yields a Duchenne myoblast cell line with long-term genotypic and phenotypic stability.Hum Gene Ther. 2003; 14: 1525-1533Crossref PubMed Scopus (81) Google Scholar was used as the starting point for our studies of PAX3-FKHR action. To verify expression characteristics of this myoblast cell line, Western blotting analysis was performed to reveal BMI1 expression and absent ARF and p16 expression as a result of BMI1 action (data not shown). To explore the properties of PAX3-FKHR in these human myoblasts, this fusion product was introduced using the retroviral vector pBabe. Western blot analysis showed low-level PAX3-FKHR expression (Figure 1A), which is significantly less than expression in ARMS cell lines (data not shown). This finding is consistent with the inability of most cell types to tolerate high PAX3-FKHR expression without some event that attenuates growth suppression/cell death associated with high-level expression. To analyze transformation, soft agar colony and focus formation assays were performed. Cells expressing PAX3-FKHR alone failed to demonstrate evidence of transformation in either assay (Figure 1B). However, previous reports indicated that multiple genetic alterations are required to transform human cells.15Hahn WC Counter CM Lundberg AS Beijersbergen RL Brooks MW Weinberg RA Creation of human tumour cells with defined genetic elements.Nature. 1999; 400: 464-468Crossref PubMed Scopus (1991) Google Scholar, 16Kim SH Nakagawa H Navaraj A Naomoto Y Klein-Szanto AJ Rustgi AK El-Deiry WS Tumorigenic conversion of primary human esophageal epithelial cells using oncogene combinations in the absence of exogenous Ras.Cancer Res. 2006; 66: 10415-10424Crossref PubMed Scopus (34) Google Scholar, 17Linardic CM Downie DL Qualman S Bentley RC Counter CM Genetic modeling of human rhabdomyosarcoma.Cancer Res. 2005; 65: 4490-4495Crossref PubMed Scopus (75) Google Scholar An important role for Myc family proteins in tumorigenesis is evidenced by the finding of elevated Myc proteins in many cancers along with their key role in cell cycle regulation.18Nilsson JA Cleveland JL Myc pathways provoking cell suicide and cancer.Oncogene. 2003; 22: 9007-9021Crossref PubMed Scopus (373) Google Scholar Many human cell culture models of transformation require small t antigen, which inhibits protein phosphatase 2A and results in stabilization and accumulation of Myc protein.15Hahn WC Counter CM Lundberg AS Beijersbergen RL Brooks MW Weinberg RA Creation of human tumour cells with defined genetic elements.Nature. 1999; 400: 464-468Crossref PubMed Scopus (1991) Google Scholar, 19Arroyo JD Hahn WC Involvement of PP2A in viral and cellular transformation.Oncogene. 2005; 24: 7746-7755Crossref PubMed Scopus (197) Google Scholar We decided to investigate MYCN as an oncogene in ARMS based on the findings of increased MYCN expression in most cases of ARMS and MYCN gene amplification in a subset of cases of ARMS along with our finding that MYCN collaborates with PAX3-FKHR in NIH3T3 transformation.20Mercado GE Xia SJ Zhang C Ahn EH Gustafson DM Lae M Ladanyi M Barr FG Identification of PAX3-FKHR-regulated genes differentially expressed between alveolar and embryonal rhabdomyosarcoma: focus on MYCN as a biologically relevant target.Genes Chromosomes Cancer. 2008; 47: 510-520Crossref PubMed Scopus (61) Google Scholar When MYCN was introduced into immortalized human myoblasts with PAX3-FKHR (Figure 1A), the myoblasts scored positive in both soft agar and focus formation assays (Figure 1B). In contrast, cells transduced with vector, MYCN, or PAX3-FKHR alone were not transformed. Of note, the cells expressing MYCN only as well as cells expressing MYCN plus PAX3-FKHR grew faster than cell lines without MYCN (Figure 1C). However, this faster growth in cells expressing MYCN only was not sufficient for transformation (Figure 1B). We investigated whether the dystrophin deficiency contributed to the transformed phenotype. To correct the dystrophin defect, a lentiviral vector expressing a minidystrophin gene fused with green fluorescent protein13Li S Kimura E Fall BM Reyes M Angello JC Welikson R Hauschka SD Chamberlain JS Stable transduction of myogenic cells with lentiviral vectors expressing a minidystrophin.Gene Ther. 2005; 12: 1099-1108Crossref PubMed Scopus (75) Google Scholar was introduced into Dbt cells. Fluorescence microscopic detection of green fluorescent protein-expressing cells revealed that greater than 90% of cells were transduced, and Western blot analysis confirmed that the minidystrophin-green fluorescent protein fusion protein was expressed in the transduced cells (data not shown). When these minidystrophin-expressing cells (Dbt-Dys) were transduced with MYCN and PAX3-FKHR, they scored positive in both transformation assays (Supplemental Figure S1, see http://ajp.amjpathol.org), thus indicating that the presence or absence of dystrophin does not have an impact on cell transformation induced by PAX3-FKHR and MYCN. To study tumorigenesis mediated by PAX3-FKHR and MYCN in vivo, we used a xenograft tumor system in SCID mice. In particular, 106 Dbt cells transduced with PAX3-FKHR and MYCN, or either oncogene and the corresponding vector, or both vectors were injected in an s.c. site of the flank region of SCID mice. In these studies, all mice (four of four) injected with cells expressing both PAX3-FKHR and MYCN developed tumors rapidly; tumors were palpable in 8 days and reached 1.3 cm in size in 21 days. Surprisingly, all mice (four of four) injected with cells expressing PAX3-FKHR only also showed tumor formation, but at a very slow rate; tumors were palpable at 21 days and 1.3-cm size tumors were formed in 38 days. Cells transduced with MCYN or vector only did not show any tumor formation during the 52-day observation period. Similar results were obtained with an i.m. injection of 5 × 105 Dbt cells into the hindlimb of SCID mice. Although cells transduced with vector or MYCN alone did not show any tumors during the 52-day observation period, all (four of four) mice injected with cells expressing both PAX3-FKHR and MYCN developed tumors rapidly; by 28 days, the diameter of the injected limb was 1.5 cm compared with a 0.8-cm diameter of the opposite uninjected limb. Intramuscular injection of cells expressing PAX3-FKHR alone also resulted in delayed tumor formation; the injected limb reached a diameter of 1.5 cm in 50 days. Further analysis of mice with s.c. or i.m. tumors did not reveal any gross evidence of metastatic disease. To further characterize these s.c. and i.m. tumors, multiple samples were examined microscopically with standard H&E staining. At high power, this analysis revealed that the tumor cells can be divided into several populations (Figure 2A). One major population consists of small- to intermediate-sized cells with pleomorphic nuclear features, conspicuous nucleoli, and sparse to moderate amounts of cytoplasm. A second subset consists of large cells with large vesicular nuclei and abundant eosinophilic cytoplasm. Finally, there are rare tumor giant cells, which are similar to the giant cells seen in ARMS. Although these tumors do not demonstrate the typically monotonous small round cell appearance of many human ARMS tumors, they are similar to the subset of human ARMS that contain giant cells, with the small- and intermediate-sized population resembling the small cells of ARMS and the large and giant cells reflecting a higher than usual number of differentiated cells. A high proliferative rate was indicated by frequent mitoses in all high-power fields. At lower power, the tumors tended to be circumscribed with occasional areas of invasion into surrounding muscle fibers and adipose tissue, indicative of a malignant neoplasm (Figure 2C). Immunohistochemical staining with the myogenic markers desmin, muscle-specific actin, MyoD1, and myogenin demonstrated strong reactivity, consistent with the diagnosis of rhabdomyosarcoma (Figure 2, E and G). In particular, the percentage of cells demonstrating nuclear myogenin reactivity was high, a finding that is frequent in ARMS tumors. These histopathological findings are similar in both s.c. and i.m. tumors and in tumors from cells expressing PAX3-FKHR with or without MYCN (Figure 2, B, D, F, H). In addition to histological characteristics, a gene expression signature has been defined in fusion-positive ARMS tumors, consisting of PAX3-FKHR target genes and other effects.2Davicioni E Finckenstein FG Shahbazian V Buckley JD Triche TJ Anderson MJ Identification of a PAX-FKHR gene expression signature that defines molecular classes and determines the prognosis of alveolar rhabdomyosarcomas.Cancer Res. 2006; 66: 6936-6946Crossref PubMed Scopus (259) Google Scholar, 3Ebauer M Wachtel M Niggli FK Schafer BW Comparative expression profiling identifies an in vivo target gene signature with TFAP2B as a mediator of the survival function of PAX3/FKHR.Oncogene. 2007; 26: 7267-7281Crossref PubMed Scopus (73) Google Scholar To further confirm that the tumors derived from MYCN/PAX3-FKHR-transduced myoblasts have similar molecular characteristics relative to ARMS, qRT-PCR analyses were performed for MYCN (endogenous), CXCR4, FGFR4, MYOD1, and KCNN3. The qRT-PCR assays reveal that expression of all five genes tested was increased to varying degrees in PAX3-FKHR/MYCN-expressing cells and then further increased in tumor-derived cells (Supplemental Figure S2, see http://ajp.amjpathol.org). To further characterize both s.c. and i.m. xenograft tumors, we used viral integration sites as clonal markers to examine whether tumors were composed of the same cell population as the transduced myoblasts. Restriction endonuclease-digested genomic DNA was analyzed by Southern blot/hybridization analysis with probes from the retroviral constructs. When the puromycin or hygromycin resistance gene was used as a probe, DNA from parental cells transduced with PAX3-FKHR with or without MYCN showed a hybridization pattern different from that of the DNA from corresponding s.c. and i.m. tumors, with some smaller differences among tumor samples (Figure 3, A and B). These findings reveal important differences between cells before injection and cells comprising the actual tumors and suggest that tumors developed from similar but not identical subsets of parental cells. The results suggest that there is selection of a subset of transduced myoblasts with properties that favor tumor progression. Next, we compared PAX3-FKHR expression in parental and tumor cells. After expanding cells from individual tumors in culture, we prepared nuclear extracts and performed Western blot analysis. This analysis showed that PAX3-FKHR expression is much higher in tumor cells than in myoblasts transduced with PAX3-FKHR with or without MYCN (Figure 3C). The PAX3-FKHR expression level in the tumor cells is comparable with or even greater than the level in ARMS cell lines. Subsequent qRT-PCR analysis indicated that PAX3-FKHR expression is also increased at the RNA level in both tumors and tumor-derived cells (data not shown). The finding of increased PAX3-FKHR mRNA in tumors as well as cell lines derived from these tumors indicates that this expression change is not related to cell culture. In addition, comparison of the growth rate in culture showed very little differ
Referência(s)